Biology Essays
The essays below were written by students to help you with your own studies. If you are looking for help with your essay then we offer a comprehensive writing service provided by fully qualified academics in your field of study.
Essay Writing ServiceSearch this section
Tip: If you can't find what you are looking for, try shortening your search phrase. E.g. "CSR"
Latest Biology Essays
- How can Aspartate Aminotransferases be Exploited in Biocatalysis?Published: Mon, 23 Sep 2019Extract: How can Aspartate Aminotransferases be Exploited in Biocatalysis? Background and structure: Aminotransferases (transaminases) are very useful in pharmaceutical drug discovery because of their ability to introduce chirality into amines or amine derived compounds. Aspartate aminotransferase catalyses the reversible transfer of an alpha amino group between aspartate and glutamate. A well-known example of aminotransferases in the […]
- Unique Function of P53 Homolog P63Published: Mon, 23 Sep 2019Extract: P53 homolog p63 has a unique function P53 is commonly known as a transcription factor and is well characterized for its role in DNA damage and cell cycle control (1), but less is known about its related homologous genes, p63 and p73 (2). While p63 and p73 are very similar in structure to p53, recent […]
- Evolution of the Human HandPublished: Mon, 23 Sep 2019Extract: The Evolution of the Human Hand Introduction The hand is one of the most discernible features of humankind. A key advantage to hominin evolution is the advancement of dexterity and structure of the human thumb. Modern homo sapiens possess a highly distinct thumb considerably stronger than any other digit. Compared to other apes, humans have […]
- Developmental Process of Human SpermatozoaPublished: Mon, 23 Sep 2019Extract: Human spermatozoa take 74 days to complete their development. Discuss the developmental significance of the process by breaking this period down into the main stages of spermatogenesis, describing them in relation to where in the male reproductive tract these stages are found. The ability of a species to reproduce is a characteristic seen across every […]
- CGRP Receptor Activation Mechanism and ApplicationsPublished: Mon, 23 Sep 2019Extract: CGRP Receptor activation Proposal Summary The calcitonin gene-related peptide (CGRP) receptor is a complex of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). This receptor plays an important role in vasodilation, neurogenic inflammation and is involved in the pathology of migraine. Though mechanisms have been proposed, it is largely unknown how exactly the […]
- attraction response of mosquitoes when exposed to CDC light trapsPublished: Mon, 23 Sep 2019Extract: Master’s degree proposal Introduction Aedes aegypti As a well-known vector of diseases such as Yellow Fever, Dengue, Chikungunya, and Zika virus the Aedes aegypti have remained a global health issue. The ancestral roots of this species are suspected to have begun in the sub-Saharan region on the continent of Africa as a tree-hole laying mosquito […]
- How Did the Cat Evolve to Become Tame?Published: Mon, 23 Sep 2019Extract: How did moggy become so tame? History In Cyprus 9.5 kya, and later Asia, as humans shifted towards more agricultural lifestyles, we see the first evidence of the domestic cat (Felis silvestirs catus) 1, 2. This may have been a result of the benefit cats provide farmers through vermin control. Today, the domestic cat is […]
- Sexual and Asexual Reproduction in PlantsPublished: Mon, 23 Sep 2019Extract: Compare and contrast sexual and asexual reproduction in plants and give medicinal plant examples. Introduction Plants are eukaryotic organisms that evolved over billions of years. There is enormous diversity in reproductive strategy in plants. Eukaryotes have nuclei in each cell that contain DNA coiled into chromosomes. Chromosomes are the organism’s reproductive functional unit and occur […]
- Effect of Exposure to Synthetic Estrogen on Fish PopulationsPublished: Mon, 23 Sep 2019Extract: The Effect of Exposure to Synthetic Estrogen on Fish Populations In a world full of pharmaceutical drugs and hormone replacement, pharmacists and toxicologists alike squabble with the implications of improper chemical disposal. Fewer professionals fully analyze how these chemicals are making it into the aquatic environment in ways other than improper disposal and to the […]
- Handroanthus impetiginosus (Mart. ex DC.) Mattos AnalysisPublished: Mon, 23 Sep 2019Extract: Handroanthusimpetiginosus (Mart. ex DC.) Mattos “Ipê roxo”, “ipê rosa” or “pink lapacho” “Ipê roxo is a common name for Handroanthusimpeginosus. “Ipê” is a tupi[1] word that main “thick bark tree” and “roxo” is a Brazilian word for purple. Even the flowers being pink the most common name for the tree is purple ipê. The group […]
- Cerebral Infarction of the Uygur and Han Ethnic GroupsPublished: Mon, 23 Sep 2019Extract: Research Article The Difference of the Polymorphism of RS4360791 Loci of ALOX5AP Gene between Cerebral Infarction of the Uygur andHan Ethnic Groups InXinjiang 1. Abstract Objective：To explore the difference of the polymorphism of RS4360791 loci of ALOX5AP gene between cerebral infarction of the Uygur and Han ethnic groups in Xinjiang Province, China. Methods：This is […]
- The Human Spleen: Functions and ImportancePublished: Mon, 23 Sep 2019Extract: The Human Spleen Description The spleen is an organ system located in the upper far left part of the abdomen, to the left of the stomach. I chose to discuss this organ because it is often neglected as essential and I wanted to know how it impacts one’s health. This organ fluctuates in size […]
- Southern Blot Technique to Detect the Ultrabithorax GenePublished: Mon, 23 Sep 2019Extract: Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction Enzymes Abstract: The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample […]
- Aligned Myoglobin SequencesPublished: Mon, 23 Sep 2019Extract: DNA sequencing gel Forward reaction DNA sequence (e value: 5e-44) GCCGTTGTTGAGTCGCAACAAAAAGCCCCCACCTTTCGGTGGGGGCTTTCCGATTCAACTGACGCTGAATCTTTTGGAGACTTCAGCCTCAGCCGATGGCG Reverse reaction DNA sequence (e value: 5e-44) GGCATCCGTGAGCCCGTCGCTGGCTCCCTGATCTACGGCAACAACATCATCTCCGGTGCTGTTGTGCCCTCCTCGAACGCCATCGGCCTTCACTTCTATCC The sequenced gene belongs to the psbA multigene family and codes for the D1 protein of photosystem II (PSII) in cyanobacteria such as Synechococcus WH7803. The D1 protein forms the core of the PSII’s reaction centre […]
- Are Viruses Alive?Published: Mon, 23 Sep 2019Extract: Table of Contents Introduction What are viruses? What does it mean to be alive? Why is there controversy over viruses being alive? Argument 1: viruses are not alive because they cannot self-organise or self-maintain. Argument 2: viruses are not alive because they don’t replicate or evolve without the aid of cells. Argument 3: viruses are […]
- Why is Testosterone Regarded as the Male Hormone?Published: Mon, 23 Sep 2019Extract: Testosterone is considered a male hormone despite females also producing testosterone. Therefore, the purpose of this essay is to determine why it is regarded as a male hormone. It will define the biological processes in the brain and the stimulations of testosterone that may explain why. It will then evaluate the consequences of the higher […]
- Overview of the Human Respiratory SystePublished: Mon, 23 Sep 2019Extract: Respiration is an example of an exothermic reaction. It releases energy from glucose molecules for use by the body. Organisms need this energy for chemical reactions to build larger molecules, for movement and to keep warm. Respiration in cells can be aerobic (with oxygen) or anaerobic (without oxygen). Aerobic respiration takes place in the mitochondria […]
- Research into Epigenetic Based Cures for CancerPublished: Mon, 23 Sep 2019Extract: Introduction Cancer is one of the most prominent diseases of modern times that a consistently effective cure has not been discovered for. Those born after 1960 have a 50% chance of being diagnosed with any given type of cancer in their lifetime; inferring that almost everyone will be affected by cancer during their lives (Cancer […]
- Towards an Understanding of the Epigenetic Regulation of Hydra RegenerationPublished: Mon, 23 Sep 2019Extract: Towards an understanding of the epigenetic regulation of Hydra regeneration Abstract Hydra is a Cnidarian polyp that has been used as a model organism in a wide range of settings for over 200 years. This small freshwater organism has a remarkable ability to regenerate, which can be attributed to a large pool of stem […]
- The Biology of Marfan SyndromePublished: Mon, 23 Sep 2019Extract: The Biology of Marfan Syndrome Abstract Marfans syndrome (MFS) is a connective tissue disorder, affecting multiple organ systems around the body, leading to a large variety of symptoms. It is an incurable disease, with symptoms commonly occurring during puberty, neonatal Marfan syndrome is an exception to this as symptoms are present at birth. The disease […]
- Contributions of Tumour Heterogeneity to MetastasisPublished: Mon, 23 Sep 2019Extract: Describe how tumour heterogeneity is thought to contribute to metastasis and how this may be overcome for the treatment of cancer Introduction The evolution of cancer has been described as the repetitive process of genetic diversification, clonal expansion and the outgrowth of clones which have been selected due to phenotypic advantage within tumour-microenvironment […]
- Biology of the Stress ResponsePublished: Mon, 23 Sep 2019Extract: ‘Making sense of Simon and Anthea’s situation through understanding the biology of the stress response’ Understanding the biological basis of stress helps to appreciate the nature of it, positive or negative, the brain reacts in the same way; how we choose to feel about a situation deemed stressful, depends on the outcome. Looking at Simon […]
- Evolution and Genomics of the Human BrainPublished: Mon, 23 Sep 2019Extract: INTRODUCTION The human species is known for having larger brains in comparison to other animals. Dating back roughly 2.4 million years ago, the human brain has tripled in size beginning with the species, Homo habilis (Lieberman). However, the aspects used in determining the overall changes in the brain can be deemed difficult. The lack of […]
- Monoclonal Antibodies as Therapeutic AgentsPublished: Mon, 23 Sep 2019Extract: Development and optimization of monoclonal antibodies as therapeutic agents Abstract: As medicinal treatments move to a more personalized approach, new developments must be made in order to assist in treating each patient on an individual basis. Within the past thirty years monoclonal antibodies (mAbs) have transformed from being scientific tools, to powerful therapeutics to help […]
- Demonstrating lacZ Gene Regulation and Expression in E.Coli Under Various ConditionsPublished: Mon, 23 Sep 2019Extract: Demonstrating lacZ Gene Regulation and Expression in E.Coli Under Various Conditions Introduction Numerous studies have been completed on gene expression of β-Galactosidase by utilizing sensitive lacZassays. Researchers were able in one study to detect which genes showed progressive hormonally regulated tumor promoter function in mammalian cells (Hall et al,1983). By doing so, this has further […]