0115 966 7955 Today's Opening Times 10:00 - 20:00 (BST)

Seasonal Influenza A/H3N2 Virus Infection

Published: Last Edited:

Disclaimer: This essay has been submitted by a student. This is not an example of the work written by our professional essay writers. You can view samples of our professional work here.

Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of UK Essays.

Seasonal Influenza A/H3N2 virus Infection and IL-1β, IL-10, IL-17 and IL-28 Polymorphisms in Iranian Population

  • L. D. Rogo, F. Rezaei, S. M. Marashi, J. Yavarian, M. Mahmoodi, M. Naseri, N. Ghavami, T. Mokhtari-Azad

Abstract

Increased blood cytokines is the main immunopathological process that where attributed to severe clinical outcomes in cases of influenza A/H3N2 virus infection. The study was with aim to find out if there was an association between polymorphisms of IL1B, IL10, IL17 and IL28, and infection and outcome of the disease caused by influenza A/H3N2 in Iran. The study was a Case-Control. Influenza A/H3N2 virus positive patients confirmed with real time PCR were the cases. The controls were those with influenza like illness and asymptomatic healthy contact. DNA samples were genotyped for polymorphisms in rs16944 (IL1B), rs1800872 (IL10), rs2275913 (IL17) and rs8099917 (IL28). Ninety five percent confidence interval (95% CI) and Odds ratio (OR) were calculated. IL-17 rs2275913 (AA and GA) were associated with risk of infection with p value 0.034 and 0.019 that were statistically significant, OR = 2.475 and 1.873, and CI = (1.073 - 5.707) and (1.111-3.159) respectively. IL-17 (rs2275913) (GG) were associated with reduced risk of infection, p< 0.001, OR = 0.332 and CI of (0.193-0.572). Genotype GG and GT of IL-10 (rs1800872) were shown to have significant association with reduced risk of infection with this virus. Conclusively, polymorphisms of genes incriminated in inflammatory and anti-inflammatory process affect the outcome of disease cause by influenza A/H3N2 virus.

Subject: Medical Sciences

Keywords. Influenza A/H3N2 virus, IL-1β, IL-10, IL-17, IL-28, Polymorphism.

1.Introduction

A variety of viruses are responsible for acute upper and lower respiratory tract infections in children and adults worldwide1. These viruses are common community–acquired respiratory pathogens without ethnic, socioeconomic, gender, age or geographic boundaries. Viral transmission occurs mainly via direct contact with contagious secretions from the hands or via large particle aerosols into the eyes and nose2.

Influenza viruses have been widely studied due to their pandemic potential3.

The mechanism of virulence for these viruses is based on their ability to cause immunopathogenesis. Host cytokine responses have been shown to exacerbate severe respiratory disease4. Using adequate investigation, it was shown that the main vital pathological process is systemic dysregulation of cytokines response in the course of infection, which is in line with severity and advances of the disease5. Production of cytokines by affected cells was shown to be necessary for the start of immune response that interfered with viral replication. Also immunopathological process, example increase circulating cytokines is mostly responsible for the severe course of the disease6.

Host genetic factors play a major role in the presentation and outcome of infectious diseases. The insights afforded by a study of host genetics and its effect on infectious diseases are particularly important for Influenza A virus7. Interleukins such as IL-1β, IL-6, IL-10, IL-17, and IL-28 are all reported to act as proinflammatory and anti-inflammatory cytokines in response to viral infection8. It has been found that Polymorphisms of genes incriminated in the process of inflammation affect clinical course of disease by influenza A virus9. Contribution that mutations in genes encoding these cytokines play in the severe outcome of the disease is not well documented. The aim of the current study was to find out if polymorphisms of genes associated with inflammatory/anti-inflammatory process may be affecting the progress of infection and with the clinical outcome in Iranian patients infected with Influenza A/H3N2 virus.

2. Methods

The specimens were obtained from the National Influenza Centre at School of Public Health, Tehran University of Medical Sciences. Nucleic acid extraction was carried out according to manufacturer’s protocol (Roche, Germany). RNA extracted from clinical samples was screened for the presence of Influenza A/H3N2 virus by the use of specific primers, probe and RT-PCR Kit (Qiagen, Germany) with Real-Time ABI Step one plus (life technology, USA)

Then, they were grouped into: those positive for Influenza virus (A/H3N2) and those with influenza like illness (as ILI group). An additional group of 147 asymptomatic healthy contacts (AHC group) also participate voluntarily in this study. The AHC group though not related to any of the patients was in personal contact with one of them during the period of the illness. To be sure of AHC group exposure to the virus, antibodies titers to influenza virus A/H3N2 were determined using haemagglutination inhibition technique. The result gave us antibodies titers specific to anti A/H3N2 virus that are not significant indicating they were not expose to the virus before. Those individual with anti A/H3N2 antibodies titers more than 1:16 were regarded A/H3N2 positive for infection or exposure following dilution of their serum samples. None of three groups had received flu vaccine. Data collected in this research includes demographic and clinical history. The current research was approved by Science and Bioethics committee of the Tehran University of Medical Sciences. Clinical form was used to collect the data in line with Iranian Health System. Topics covered included age; gender, disease morbidity and hospitalization. The symptoms evaluated were fever, sore throat, cough, rhinorrhea, dyspnea, nasal congestion, thoracic pain, headache, anorexia and vomiting.

2.1 Genotyping of SNPs

The DNA samples genotyped for polymorphisms are IL-1β rs16944; IL-10 rs1800872; IL-17 rs2275913 and IL-28 rs8099917 using TaqMan commercial probes (Applied Biosystems, USA) using the primers listed in Table 1. Protocol for real time PCR was as follow: 5µL of DNA; 10μL of TaqMan SNP genotyping master mix (Life Technology, USA), 0.8µL distilled water and 0.2μL of probes. Amplification was as follows: 95°C (10 min), 95°C (15second), and 60°C (1 min); followed by 40 cycles of 95°C (15 second), and 60°C (1 min,). Information related to genes for the SNPs checked are presented in Table 2.

Table 1: Showing TaqMan commercial probes used in genotyping of the DNA samples.

Gene (reference

SNP)

Probe

IL1β (rs16944)

TACCTTGGGTGCTGTTCTCTGCCTC[G/A]GGAGCTCTCTGTCAATTGCAGGAGC

IL10 (rs1800872)

CTTTCCAGAGACTGGCTTCCTACAG[T/G]ACAGGCGGGGTCACAGGATGTGTTC

IL17 (rs2275913)

TGCCCTTCCCATTTTCCTTCAGAAG[A/G]AGAGATTCTTCTATGACCTCATTGG

IL28 (rs8099917)

TTTTGTTTTCCTTTCTGTGAGCAAT[G/T]TCACCCAAATTGGAACCATGCTGTA

SNP = Single nucleotide polymorphisms.

Table 2: Showing SNPs genetic data analyzed in the study.

SNP

GENE

 

Symbol Location Position Alleles

rs16944

IL1β Chr 2:113594867 Intron G/A

rs1800872

IL10 Chr 1:206946407 Intron T/G

rs2275913

IL17 Chr 6: 52051033 Intron A/G

rs8099917

IL28 Chr 19: 39743165 Intergenic G/T

SNP: Single nucleotide polymorphisms, IL1β: Interleukin 1 beta, IL10: Interleukin 10, IL17; Interleukin 17, IL28: Interleukin 28.

2.2 Analysis

The polymorphisms were evaluated. Ninety five percent confidence interval (95% CI) and Odds ratio (OR) was calculated. The OR was adjusted by age, sex, and severity of the illness in the logistic regression model. Chi-squire (X2) test was applied to check the differences between the groups. OpenEpi.com online calculation (Epi-Info Version 3.03)10 and Software packages SPSS 19 (IBM, Chicago, IL) were used to analyse the data.

3. Results

The samples were separated into: Influenza A/H3N2 positive, influenza like illness (ILI group) and asymptomatic healthy contact (AHC group) respectively. In the A/H3N2, male were 54 (56.27%) males and 42(43.75%) females in the A/H3N2, there were 54 (47.40%) males and 60 (52.60%) females in the ILI while there were 79(53.70%) males and 68(46.30%) females in the AHC respectively (table 3).

Table 3: Demographical and clinical features of influenza A/H3N2 positive, AHC and ILI subjects.

CHARACTERISTICS

A/H3N2(Total:96)

n(%)

AHC (Total:147)

n(%)

ILI (Total:114)

n(%)

SEX

     

Male

54(56.27)

79(53.70)

54(47.40)

Female

42(43.75)

68(46.30)

60(52.60)

       

AGE

     

<20

13(13.5)

15(10.2)

17(14.9)

20-39

28(29.2)

76(51.7)

27(23.7)

40-59

30(31.3)

49(33.3)

26(22.8)

>60

25(26.0)

7(4.80)

44(38.6)

       

Symptomatology

     

Fever (>38°C)

73(76.0)

 

43(37.7)

Nasal Congestion

8(8.33)

 

3(2.6)

Cough

54(56.3)

 

37(32.5)

Rhinorrhea

27(28.1)

 

49(43.0)

Thoracic Pain

28(29.2)

 

6(5.26)

Anorexia

23(24.0)

 

19 (16.7)

Vomiting

18(18.8)

 

7(6.14)

Dyspnea

49(51.0)

 

19(16.7)

       

Co- morbidity

     

Chronic pulmonary disease

17(17.7)

 

3(2.6)

Neurological disease

6(6.25)

 

7(6.16)

Diabetes

9(9.38)

 

11(9.65)

ILI: Influenza like illness, A/H3N2: A/H3N2 positive patients, AHC: Asymptomatic healthy contact.

3.1 Genetic Association Analysis

We have carried out genotyping for four SNPs from four genes related with inflammatory and anti-inflammatory processes. Distribution frequency of IL-17 and IL-10 Alleles by symptom in A/H3N2 and ILI were shown in table 4. Statistical significant relationship between IL-17 and IL-10 has been shown with the outcome of the infection (p < 0.05). This was observed between the groups in mild outcome and within the A/H3N2 in interleukin 17 while it was observed between the groups only in interleukin 10. In respect to age, 20-39 age group shows significant association in IL-17. In IL-10, age groups 40-59 and above 60 shows significant association as shown in table 5. Data checked in respect to genetic information were shown in Table 6. The genetic contribution to the risk/protection from disease by influenza A/H3N2 has been deduced by checking alleles of patient groups and relating the frequencies of alleles with that of AHC group. In both groups, of the four SNPs used, 12 allele pairs were obtained. Within influenza A/H3N2 group genotype rs1800872 TG and GG (IL-10), and genotype AG of IL-17 rs2275913 that demonstrate statistical significant association with reduced risk of infection were identified (p <0.05; OR <1) table 6 below. Also genotype IL-17 rs2275913 AA and GG in the A/H3N2 group shows statistical significant association with risk of infection (p <0.05; OR >1). In the ILI group, four of the five statistical significant association reported in the A/H3N2 group were noted. Genotype GG of IL-28 rs8099917 shows a tendency of association with the reduced risk of infection (OR=0.0581 and CI = 0.334-1.011), with p = 0.055 boarder line of statistical significant.

Table 4: Distribution Frequency of IL-17 and IL-10 genotypes by Symptoms in A/H3N2 and ILI.

Symptoms

Alleles

A/H3N2

No. (%)

ILI

No. (%)

X2 Result

IL-17

AA

3(5.66)

9(12.9)

8.967

Mild

AG

16(30.2)

35(50.0)

 
 

GG

34(64.2)

26(37.1)

p =0.01129

Total

 

53(100)

70(100)

 
 

AA

5(11.6)

5(11.4)

0.3409

Severe

AG

22(51.2)

20(45.5)

 
 

GG

16(37.2)

19(43.2)

p = 0.8433

   

43(100)

44(100)

 

Result

 

X2=6.961,P=0.03079

X2 =0.4144, P=0.8129

 
         
 

AA

8(8.33)

14(12.3)

3.49

All

AG

38(39.6)

55(48.2)

 
 

GG

50(52.1)

45(39.5)

p = 0.1747

TOTAL

 

96(100)

114(100)

 
         

IL-10

       
 

TT

7(13.5)

14(19.2)

 

Mild

GG

13(25.0)

21(28.8)

1.237

 

TG

32(61.5)

38(52.1)

 

Total

 

52(100)

73(100)

p = 0.5388

 

TT

2(4.55)

7 (17.1)

 

Severe

GG

6(13.6)

13(31.7)

9.21

 

TG

36(81.8)

21(51.2)

 

Total

 

44(100)

41(100)

p = 0.0100

Result (X2)

 

X2 = 4.96,P=0.08375

X2 =0.1428, P=0.9311

 
         

All

TT

9(9.38)

21(18.4)

8.2

 

GG

19(19.8)

34(29.8)

 
 

TG

68(70.8)

59(51.8)

P:0.01657

TOTAL

 

96 (100)

114 (100)

 

IL10: Interleukin 10, IL17; Interleukin 17, ILI: Influenza likes illness. Results were considered statistically significant when p value were <0.05.

Table 5: Distribution frequency of each respective IL-10 and IL-17 genotypes by age groups in A/H3N2 and ILI.

AGE GROUPS (YEARS)

GENOTYPES

A/H3N2

No. (%)

ILI

No.(%)

X2

RESULTS

IL-17

AA

0(0.00)

0(0.00)

0.1312

< 20

GG

6(46.2)

9(52.9)

P=0.7172

 

AG

7(53.8)

8(47.1)

 

Total

 

13(100)

17(100)

 
 

AA

3(10.7)

3(11.1)

5.890

20 – 39

GG

17(60.7)

8(29.6)

P=0.053

 

AG

8(28.6)

16(59.3)

 

Total

 

28(100)

27(100)

 
 

AA

4(13.3)

2(3.85)

2.039

40 – 59

GG

14(46.7)

11(42.6)

P=0.361

 

AG

12(40.0)

14(53.8)

 

Total

 

30(100)

26(100)

 
 

AA

1(4.00)

9(20.5)

3.669

>60

GG

13(52.0)

17(38.5)

P=0.160

 

AG

11(44.0)

17(40.9)

 

Total

 

25(100)

44(100)

 

All

AA

8(8.33)

14(12.3)

3.49

 

GG

50(52.1)

45(39.5)

P=0.1747

 

AG

38(39.6)

55(48.2)

 

TOTAL

 

96(100)

114(100)

 

IL-10

       
 

TT

3(23.)

5(29.4)

0.709

< 20

GG

3(23.1)

2(11.8)

p:0.702

 

TG

7(53.8)

10(58.8)

 

Total

 

13(100)

17(100)

 
 

TT

5(17.9)

2(7.14)

1.411

20 – 39

GG

11(39.3)

10(37.0)

p:0.494

 

TG

12(42.1)

15(55.6)

 

Total

 

28(100)

27(100)

 
 

TT

1(3.33)

3(11.5)

8.862

40 – 59

GG

3(10.0)

10(38.5)

p:0.012

 

TG

26(86.7)

13(50.0)

 

Total

 

30(100)

26(100)

 
 

TT

0(0.00)

11(25)

14.07

>60

GG

2(8.00)

12(27.7)

p:0.0008

 

TG

23(92.0)

21(47.7)

 

Total

 

25(100)

44(100)

 

All

TT

9(9.38)

21(18.4)

8.2

 

GG

19(19.8)

34(29.8)

p:0.01657

 

TG

68(70.8)

59(51.8)

 

TOTAL

 

96(100)

114(100)

 

IL10: Interleukin 10, IL17; Interleukin 17, ILI: Influenza likes illness. Results were considered statistically significant when p value were <0.05

Table 6: Association of Influenza A/H3N2 virus infection with genetic frequency of the genotypes of the four SNPs.

Gene and

Genotype

Genetic Frequency

A/H3N2 (%)

ACH

(%)

p

OR

95% CI

ILI

(%)

p

OR

95% CI

IL-1β rs16944

                 

AA

18.8

17.7

     

22.8

     

AG

59.4

55.1

     

56.1

     

GG

21.9

27.2

     

21.1

0.070

2.060

0.942-4.507

                   

IL-17 rs2275913

                 

AA

8.33

19.0

0.034

2.475

1.073-5.707

12.3

0.040

2.161

1.007-4.638

AG

39.6

53.1

0.000

0.332

0.193-0.572

48.2

0.000

0.345

0.201-0.594

GG

52.1

27.9

0.019

1.873

1.111-3.159

39.5

0.020

1.833

1.100-3.055

                   

IL-10 rs1800872

                 

TT

9.38

17.0

     

18.4

     

GG

19.8

24.5

0.035

0.552

0.317-0.959

29.8

0.078

0.445

0.180-1.095

TG

70.8

58.5

0.035

0.552

0.317-0.959

51.8

0.032

0.475

0.240-0.939

                   

IL-28 rs8099917

                 

GG

6.25

12.2

0.055

0.581

0.334-1.011

6.14

     

TT

60.4

25.9

0.075

2.540

0.910-7.089

54.4

     

GT

33.3

61.9

     

39.5

     
                   

IL1β: Interleukin 1 beta, IL10: Interleukin 10, IL17: Interleukin 17, IL28: Interleukin 28,

A/H3N2: Patients infected with influenza A/H3N2 virus, ILI group: Are individuals with Influenza likes illness, AHC group: asymptomatic healthy contact, OR: Odd Ratio, CI: Confidence Interval. Results were considered significant if p value were <0.05.

4. Discussion

Genetic determinants investigation has implications beyond defining individual risks for severe infections but also offers significant insights about the pathogenesis of the offending microbe. It was shown that genes associated with inflammation are linked with pulmonary and infectious diseases11. Host cytokine responses have been shown to exacerbate severe respiratory disease. Up till now there was no immediate relationship between these polymorphisms and influenza A/H3N2 virus disease that has been documented.

In our study, logistic regression analysis of the influenza A/H3N2 virus group, the ILI group and AHC group shows that IL-17 rs2275913 (AA and GG) were associated with risk of Influenza A/H3N2 virus infection with p value of 0.034 and 0.019, OR = 2.475 and 1.873, and CI = (1.073 – 5.707) and (1.111 – 3.159) respectively. This cytokine is known with diverse functions in host defense and in the pathology of chronic inflammatory diseases, autoimmune disorders and cancer. This may be due to immunosuppressive activities of this cytokine as reported by Gosmann et al,12 mucus hypersecretion and exacerbation of allergic airway responses that can be implicated in chronic lung conditions such as chronic obstructive pulmonary disease13. It supported the finding of Lucas et al,14 who reported association between IL17 and RSV infection. It was also reported that this cytokine induced pulmonary pathogenesis during viral respiratory infection and exacerbation of allergic diseases13. Other works indicate the role of IL-17 as an important cytokines for the clearance of Klebsiella pneumoniae, in respiratory tract infection15, 16. In the current study IL-17 rs2275913 (AG) genotype was associated with reduced risk of Influenza A/H3N2 virus infection with p value of 0.000, OR = 0.332 and CI = (0.193 – 0.572). Genotype GG and TG of IL-10 (rs1800872) was shown to have significant association with reduced risk of infection with this virus. This finding indicates that carrier of GG and TG (IL-10 rs1800872) has more reduced risk from having a more severe form of influenza A/H3N2 virus infection. This may be due to the anti-inflammatory nature of IL10 that inhibits NK and T cell activity and thus is believed to control the strong inflammatory response after primary infection17. IL-10 polymorphisms were also connected to differential clinical expression of various diseases, such as asthma and systemic lupus erythermatosis18. In the current study, IL-28 rs8099917 (GG) polymorphism and influenza A/H3N2 virus demonstrated reduced risk of infection (p 0.055) just missing being statistical associated. In a study by Chayama and Hayes19 statistical association was found between IL-28 and HCV clearance. Genetic polymorphisms near theIL-28Bgene are also reported to have strongly associated with sustained viral response and spontaneous viral clearance in patients with chronic HBV infection20

Currently we shows at the first time that polymorphisms in genes associated with inflammatory and anti-inflammatory activities affect the risk of influenza A/H3N2 virus infection and of adverse outcome. Another possible mechanism that may result for a severer clinical course of the infection can be from imbalance between the alleles causing haplotypes that alter the presentation and action of cytokines and chemokines.

With the possibility of serious consequence from influenza A/H3N2 virus infection, the approach used in this research could acquire great values as polymorphisms study and may acquire greater value in determining direction that the infection will take in future out breaks of influenza A/H3N2 virus in Iran.

5. Conclusion

Interleukin IL-17 rs2275913 (AA and GG) polymorphisms studied shows an increased risk of susceptibility to influenza A/H3N2 virus disease. This genetic variant may result in adverse clinical outcomes in Iranian population. And also interleukin IL-17 rs2275913 (AG) and IL-10 rs1800872 (GG and TG) polymorphisms studied were found to have significant association with reduced risk of influenza A/H3N2 virus infection. Thus, these genetic variant may contribute to the mildness in clinical manifestations in the studied population.

5. Acknowledgments

The authors thanks all those that contributed in some way to the completion of this research and financial support by Tehran University of Medical Sciences International Campus. [Grant number D/93/MB/1467].

6. Conflict of interest: Authors declares no conflict of interest.


To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Request Removal

If you are the original writer of this essay and no longer wish to have the essay published on the UK Essays website then please click on the link below to request removal:


More from UK Essays

We can help with your essay
Find out more