Functional Analysis of SlGAMYBL2 Gene in Tomato in Abiotic Stress
✅ Paper Type: Free Essay | ✅ Subject: Sciences |
✅ Wordcount: 2178 words | ✅ Published: 18th May 2020 |
Title
1. SlGAMYBL2, a homologue of GAMYB in tomato, plays an important role in drought and chilling tolerance in transgenic Tobacco plant
2. Improved drought and Chilling stress tolerance in transgenic tobacco plants overexpressing a GAMYB-like 2 gene isolated from the tomato
3. Overexpression of a tomato GAMYB-like 2 gene in tobacco plants enhances resistance to drought and low temperature stresses
4.Functional Analysis of SlGAMYBL2 Gene in Tomato in Abiotic Stress
Abstract: GAMYB was found as a transcription factor in the GA signal response pathway, but GAMYB was found to be regulated by the stress hormone ABA (abscisic acid), indicating the potential roles of GAMYB in stress resistance. In order to study the function of GAMYB in abiotic stresses in tomato, two homologous genes SlyGAMYBL1 and SlyGAMYBL2 of tomato GAMYB were cloned and expressed heterologously in tobacco plants. Phenotypic identification and physiology of transgenic tobacco were also performed. Biochemical analysis showed that overexpression of SlGAMYBL1 and SlGAMYBL2 enhanced resistance to ABA, mannitol, and low temperature stress in transgenic tobacco.
Key words: tomato ,GAMYB ,Abiotic stress,transcription factor
Environmental factors, such as drought、high salt and low temperature stresses, severely limit the production and distribution of many important agronomic crops worldwide. To cope with these stresses, plants trigger a network of events. These events start with stress signal perception, followed by transduction cascades that eventually lead to the expression of target genes which participate in stress tolerance by promoting morphological, biochemical and physiological changes[1]. Gene expression is mediated by one or more interacting transcription factors (TFs), so TFs play vital regulatory roles in abiotic stress responses in plants by interacting with cis-elements present in the promoter region of various abiotic stress responsive genes[2] .
If you need assistance with writing your essay, our professional essay writing service is here to help!
Essay Writing ServiceGAMYB and GAMYB-like genes, encode conserved R2R3 MYB transcription factors, was initially identified as a positive transcriptional regulator of GA-dependent α-amylase and hydrolytic enzymes expression in barley seed aleurone cells[3]. To date, numerous studies have investigated that GAMYB plays an important role in other aspects of plant growth and development, including anther development, stem elongation, floral initiation and seed development[4]. Orthologous proteins have since been identified in other plants, such as Arabidopsis, rice, wheat and Lolium temulentum [5-7]. Members of the MYB family of transcription factors are highly conserved in the N-terminal regions but show great variation in the C-terminal regions[8].
N terminal region of HvGAMYB contains a typical R2/R3- MYB DNA-binding domain, consisting of 2 helix-loop-helix repeats
HvGAMYB gene expression is also inhibited by ABA [9].
Although the function of GAMYB in the aleurone cells of germinating cereal seeds is relatively well defined, its role response to abiotic stresses in the plant is less well understood. Tomato(Solanum lycopersicum)is one of the most important economical crops in the world. Here, we describe the isolation and characterization of the tomato GAMYB-like gene, SlGAMYBL2, and show that overexpression SlGAMYBL2 increased drought and low temperature stresses, but more sensitives in high salt stresses.
1. Materials and Methods
1.1 Plant materials and germination conditions
Tomato variety ‘mcro-Tom’ and tobacco (Nicotiana tabacum) variety ‘Wisconsin 38’plants seedlings were grown under normal conditions (25 °C, 60–65% relative humidity, 16-h day/8-h night). One-month-old plants seedlings were used in the subsequent experiments.
1.2 Isolation of total RNA from tomato and construction of overexpression vector
Total RNA was extracted from tomato leaves using with RNAiso Plus (Takara) according to the manufacturer’s protocol, and cDNA was synthesized using MultiScribeTM reverse transcriptase. SlGAMYBL2 sequence was isolated by PCR amplification on total cDNA template using primers SlGAMYBL2-F(5′ CGGGATCCCCTTTACATTTGCCGTCACTA3′) and SlGAMYBL2-R(5′ GCTCTAGAGACAAGGCACTCCATGCACAA3′), then cloned into the pEasy-Blunt vector (TransGen Biotch,Beijing). The positive clone was sequenced by Shanghai Shenggong Biotech. Sequence analysis of SlGAMYBL2 was performed using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Various tools from Expasy (http://www.expasy.org/tools) were used to compute theoretical pI and molecular weight. Putative domains were identified using Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan). Both the multiple sequence alignments and phylogenic tree of 10 SNW/SKIP proteins were set up using MEGA software 5.05.
To study the overexpression of SlGAMYBL2 in tobacco, PCR products were digested with BamH Ⅰ和Xba Ⅰ, then cloned into binary vector LP100-35S[10] under the CaMV 35S promoter. Agrobacterium tumefaciens mediated transformation was used for obtaining transgenic plants according to previously described(补充文献). Transformed lines were selected on kanamycin firstly (100 mg/L) and then screened by both PCR and GUS staining. Homozygous lines from F2 or later generations were used for further analysis.
Protoplast isolation and transient expression of SlGAMYBL2-GFP fusion protein
Subcellular localization analysis
To confirm the subcellular localization of the SlGAMYBL2 protein, the SlGAMYBL2 open reading frame (ORF) was amplified by PCR sing primers SlGAMYBL2-F(5’CGGGATCCCCTTTACATTTGCCGTCACTA3’ )and SlGAMYBL2-R(5’GCTCTAGAGACAAGGCACTCCATGCACAA3’) from tomato cDNA. As a C-terminal fusion protein expressed under the control of the 35S promoter, SlGAMYBL2 ORF was fused with green fluorescent protein (GFP) into the pGreen vector (Hellens et al. 2000). The protoplast transfection was assayed and analyzed according to the method described by Wang and Ren et al. (2011).
Expression analysis by qRT-PCR
Total RNA was isolated using Trizol (Invitrogen, USA), treated with DNase I (Fermentas, UK) for 15 min at 37℃, and purified as per the handbook description. The first-strand cDNA synthesis was performed using 2 lg of total RNA using a Fermentas Reverse Transcription Kit. Quantitative real-time RT-PCR (qRT-PCR) was performed using SYBR® Premix Ex Taq TM from
TaKaRa (China) on an Applied Biosystems Q6 real-time PCR system.
The tomato Actin were used as internal controls in analyzing gene expression. And three biological replicates were performed for these experiments. The primers used for the quantitative real-time PCR are listed in Supplementary information(补充引物)
Plant evaluation of stress tolerance in transgenic tobacco plants
To observe transgenic tobacco germination phenotype under various stresses, the seeds of WT and transgenic tobacco were germinated and grown in MS medium under normal growth conditions for 8–10 days. Then the seedlings were transferred into MS media plates containing either 200 mM NaCl, 400 mM mannitol, 0.2 mmol GA and 0.1 mM ABA。For chilling stress, the plates were exposed to 4℃ for4 days and then transferred into normal condition. The root length of the seedlings after growing in controlled conditions for 14 days was measured.
For plant physiological parameters determinations, the top three leaf fully expanded leaves from 40-day-old plants of WT and transgenic line were quickly washed in distilled water, and leaf disks (1 cm in diameter) were punched out using a cork borer.
以下句子摘自(The tomato 2-oxoglutarate-dependent dioxygenase gene SlF3HL is critical for chilling stress tolerance)
The level of MDA was determined using the thiobarbituric acid method as previously described
The relative electrical conductivity (REC) was measured as previously described. Ten leaf disks (each 0.6 cm in diameter) from each line were
harvested and placed
Antioxidant enzymes activities were measured as previously described. In brief, leaf sample
Measurements of relative electrical conductivity (REC) and Malondialdehyde (MDA) were performed as described(补充文献), The activities of SOD 、 POD and CAT were detected with methods represented by Wang(补充文献).
GAMYBL2亚细胞定位
To further determine the subcellular localization of SlGAMYBL2 protein, the SlGAMYBL2–GFP fusion protein was constructed under the control of the cauliflower mosaic virus (CaMV) 35S promoter and introduced into tobacco protoplasts by polyethylene glycol method. As shown in Fig. 4,the SlGAMYBL2–GFP fusion protein is localized in the nucleus (Fig. 4A–C). As a control, the signals of 35S:GFP are detected throughout the cell (Fig. 4D–F). Previous studies indicated that the GAMYB proteins of a wide variety of organisms from yeasts to humans are all localized at the nucleus[11]. They are highly conserved
These results are consistent with the identity of SlGAMYBL2 as a nuclear-localized protein, which is in consistent with its predicted function as a putative splicing factor.
Cite This Work
To export a reference to this article please select a referencing stye below:
Related Services
View allDMCA / Removal Request
If you are the original writer of this essay and no longer wish to have your work published on UKEssays.com then please: