0115 966 7955 Today's Opening Times 10:00 - 20:00 (BST)

Epigenetic Control of Endocannabinoid Function

Published: Last Edited:

Disclaimer: This essay has been submitted by a student. This is not an example of the work written by our professional essay writers. You can view samples of our professional work here.

Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of UK Essays.

Janis Szeremeta

Epigenetic control of endocannabinoid function

Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2'-deoxycytidine and Trichostatin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments.

Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases α and β (DGLα/β) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by α/β-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphosphatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study).

Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103).

The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research.

An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2'-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2'-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression.

Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2'-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA.

Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21.

Drugs and Compounds

Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2'-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA).

Cell Culture

Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagle's Minimal Essential Medium (EMEM - ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËšC with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 Ã- 105 for DU-145 and 2.5 Ã- 105 cells for SH-SY5Y per well overnight.

Epigenetic Modulation using 5-Aza-2'-deoxycytidine and Trichostatin A

Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1 µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads® mRNA DIRECT„¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted.

Exposure to Hypoxia/Hypoxia Mimetics

Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers' instructions22) and then incubated at 37˚C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1α and HIF2α mRNA levels were assessed for both procedures to evaluate induction of hypoxia.

qPCR

mRNA was extracted using the Dynabeads® mRNA DIRECT„¢ Purification Kit. mRNA (5 µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20 µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËšC, 45 cycles of 10 seconds at 95ËšC and 30 seconds at 60ËšC and melting curve cycle times of 15 seconds at 95ËšC, 15 seconds at 55ËšC and a final step of 95ËšC for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was performed using the ˆ†ˆ†Ct method.

Table 1: primers used for qPCR experiments

Gene

Product

Forward primer (5' to 3')

Reverse primer (5' to 3')

Abhd6

ABHD6

GATGTCCGCATCCCTCATAAC

CCAGCACCTGGTCTTGTTTC

Abhd12

ABHD12

GGCAGAAAGCTCTATAGCATCG

CCTGTAGCCAAGGTCTGAATG

Cnr1

CB1

CACCTTCCGCACCATCACCAC

GTCTCCCGCAGTCATCTTCTCTTG

Cnr2

CB2 1st pair

CATGGAGGAATGCTGGGTGAC

GAGGAAGGCGATGAACAGGAG

CB2 2nd pair

AAACAACTGGGACTCCTC

GTCTAGAAGGCTTTGGGTTG

Ptgs2

COX-2

AGCAGGCAGATGAAATACCAG

ACCAGAAGGGCAGGATACA

Dagla

DAGLα

CCCAAATGGCGGATCATCG

GGCTGAGAGGGCTATAGTTAGG

Daglb

DAGLβ

TCAGGTGCTACGCCTTCTC

TCACACTGAGCCTGGGAATC

Faah

FAAH

CACACGCTGGTTCCCTTCTT

GGGTCCACGAAATCACCTTTGA

Hif1a

HIF1α

GCTGATTTGTGAACCCATTCC

TTCATATCCAGGCTGTGTCG

Epas1

HIF2α

CACAGAGTTCTTGGGAGCAG

ACCCTTTGCAGACCTTGTC

Alox5

5-LOX

ATCCAGCTCAACCAAATCCC

ACCAGATGTGTTCGCAGAAG

Alox12

12-LOX

GATCCGAGGAGAGAAGCAATAC

GGAGGCTGAATCTGGATGAC

Alox15

15-LOX

CGAGGGTTTCCTGTCTCTTTAC

GCACCCAAGAGTACCAGTC

Mgll

MAGL

GGAAACAGGACCTGAAGACC

ACTGTCCGTCTGCATTGAC

Naaa

NAAA

ATGGAGCGTGGTTCCGAGTT

AGGCTGAGGTTTGCTTGTCCT

Napepld

NAPE-PLD

ACTGGTTATTGCCCTGCTTT

AATCCTTACAGCTTCTTCTGGG

Rpl19

RPL19

CACATCCACAAGCTGAAGGCA

CTTGCGTGCTTCCTTGGTCT

[3H]-AEA Hydrolysis in DU-145 Cells

The assay of Björklund et al. (2014)23 was used. Cells (1.5 Ã- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1 µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËšC. Inhibitors (URB597 1 µM, Pentadecylamine 1 µM, URB597 and Pentadecylamine 1µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËšC. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5 µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction volume of 400 µL. The hydrolysis reaction was stopped by adding 600 µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200 µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24.

[3H]-2-OG Hydrolysis in SH-SY5Y Cells

Cells (2.5 Ã- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5 µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1 µM, JZL184 1 µM, WWL70 10 µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËšC followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase.

Cytotoxicity Assessment/Assay

To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers' protocol.

Statistical Analyses

Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2.

Epigenetic regulation of endocannabinoid function

DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system.

Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. "Main effects - cell" describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLβ and FAAH for Aza dC and 12-LOX for TSA).

Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P<0.05 suggesting an effect of the epigenetic silencing treatment. Results will be discussed in more detail below.

Table 2: Three-way ANOVA summary for the PCR data.

Main effects

Interactions

Cell:

Cell:

Cell:

Aza dC:

Aza dC:

Protein

Cell

Aza dC

TSA

Aza dC

TSA

TSA

TSA

CB1

0.0003

0.31

0.060

0.38

0.89

0.14

0.30

NAPE-PLD

0.34

0.40

0.28

0.0093

0.29

0.29

0.54

DGLα

<0.0001

0.87

0.88

0.0049

0.49

0.16

0.61

DGLβ

0.43

0.0004

0.027

0.020

0.031

0.88

0.96

FAAH

<0.0001

<0.0001

0.041

0.0061

0.55

0.17

0.85

NAAA

<0.0001

0.012

0.53

0.44

0.79

0.15

0.40

MGL

<0.0001

0.21

0.019

0.014

0.85

0.25

0.59

ABHD6

0.0004

0.019

0.15

0.0001

0.70

0.43

0.67

ABHD12

0.0078

0.014

0.65

0.091

0.14

0.61

0.11

COX2

<0.0001

0.032

0.62

0.21

0.70

0.83

0.74

5-LOX

0.99

0.45

0.21

0.91

0.98

0.13

0.53

12-LOX

0.0039

0.18

0.0001

0.41

0.55

0.93

0.69

Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆ†Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was "Model<-ezANOVA(data=dataset, dv=.(Protein), wid=.(id), within=.(Aza dC,TSA), between=.(Cell), detailed=FALSE, type=3" (Field, 201225). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini & Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLβ and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures.

Cannabinoid receptors 1 and 2

Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆ†Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells.

Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2)

Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Börner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells.

Endocannabinoid synthetic enzymes

Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLα (B) and DGLβ (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C).

Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLα, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLα (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLα in DU-145 cells, where expression decreased to a small degree. For DGLβ, since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLβ expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compounds were very small (Figure 2C).

AEA catabolic enzymes

Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A).

As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B).

2-AG catabolic enzymes

Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A).

Gene expression analysis of the three key enzymes in 2-AG catabolism did not reveal any significant main effects of either Aza dC or TSA on either cell type and no interaction between cell type and Aza dC for MGL or ABHD12. Statistics suggest an interaction between cell type and Aza dC for ABHD6, however (Table 2). Two-way ANOVA calculated for MGL and ABHD6 revealed marginal differences in expression for MGL in DU-145 (decrease) and ABHD6 in SH-SY5Y cells (increase). An additive effect of Aza dC and TSA decreased expression of MGL in DU-145 cells (Figure 4A and B). Interestingly, overall expression of MGL in SH-SY5Y was very low compared to DU-145 cells, the effect of which was investigated in functional experiments and will be discussed below.

Arachidonic acid catabolizing enzymes

Figure 6: mRNA levels of the endocannabinoid catabolic enzymes COX-2 (A), 5-LOX (B) and 12-LOX (C). For statistical treatment, see Table 2.

Except for an effect of TSA on 12-LOX in both cell lines, no effect of Aza dC and no interactions between either treatment and cell type was found. Treatment with TSA had a drecreasing effect on the expression of 12-LOX mRNA.

Based on these results, the effect of Aza dC on overall anandamide hydrolysis and on both FAAH and NAAA in particular was investigated in DU-145 cells. In SH-SY5Y cells, where the epigenetic modulation treatment did not have an effect, but MGL expression was very low, the role of ABHD6 in 2-AG degradation without epigenetic modulation was investigated.

Epigenetic regulation of AEA hydrolysis in DU-145 prostate cancer cells

Given that Aza dC affected mRNA expression in DU145 cells, the ability of these cells to hydrolyse 0.1 µM [3H]-AEA was investigated. Cells were plated overnight to allow for adherence and treated with 1 µM Aza dC for 24h. Following epigenetic modulation, cells received inhibitory treatment for 10 minutes which was followed by addition of radioactive AEA and hydrolysis reaction was allowed for another 15 minutes. The reaction was stopped and the aqueous phase was recovered for liquid scintillation measurement.

Total AEA hydrolysis in DU-145 cells was not significantly affected by the Aza dC treatment (Figure 6A). The hydrolysis was completely inhibited by the FAAH inhibitor URB597 (1 µM), whereas the NAAA inhibitor Pentdecylamine (30 µM) had no obvious effect, since the 95% confidence intervals straddle the 100% value. (Figure 6B).

AEA hydrolysis DU145 n=6

Figure 7: Total hydrolysis of AEA in fmol/well following a 24h incubation with Aza dC (1 µM) (A). Relative hydrolysis of AEA following inhibition of either FAAH (URB), NAAA (Penta) or both (U+P) in Aza dC treated DU-145 cells (B) Data are means ± 95% confidence limits, n=6. 

ABHD6 hydrolyzes 2-OG in SH-SY5Y neuroblastoma cells

Figure 8: Relative hydrolysis of 2-OG following inhibtion of either FAAH (URB), MGL (JZL), ABHD6 (WWL) or combinations of these. No differences in hydrolysis for inhibition of either FAAH or MGL. Inhibtion of ABHD6 lead to a decrease of hydrolysis both after individual treatment with WWL70 and in combination with either JZL184 or JZL184 and URB597. Data are means ± 95% confidence limits, n=6.

The mRNA data suggested that the expression of MGL in the SH-SY5Y cells was much lower than the corresponding expression of ABHD6 and ABHD12. To investigate this functionally, the hydrolysis of 0.1 µM [3H]2-OG (a 2-AG analogue) was investigated in intact SH-SY5Y cells. Inhibition of both FAAH and MGL by URB597 (1 µM) and JZL184 (1 µM), respectively, did not affect 2-OG hydrolysis, whereas inhibition of ABHD6 by WWL70 (10 µM) lead to a significant decrease of hydrolysis of around 30 percent. We were not able to determine whether the remaining activity was catalysed by ABHD12, since no inhibitor of this enzyme is commercially available.

Endocannabinoid function and hypoxia (preliminary)

cobalt

Figure 9: mRNA levels of hypoxia-induceable factors 1a and 2a (hif1a and hif2a) after set times of exposure to hypoxia mimetics Co(II)Cl2 or Deferoxamine (A). mRNA levels of endocannabinoid catabolic enzymes following either a 2h or 6h incubation period with Co(II)Cl2(B). Note that these data are preliminary and only represent single experiments in SH-SY5Y cells.

Solid tumors often display a hypoxic microenvironment27, so in addition to epigenetic modification, effects of hypoxia (or hypoxia mimetics) on the expression of endocannabinoid catabolic enzymes were investigated in SH-SY5Y cells (Figure 8). Firstly, two different concentrations, either 50 or 100 µM, of two different hypoxia mimetics, Co(II)Cl2 and Deferoxamine, were tested towards their ability to activate expression of hypoxia-inducible factors 1a and 2a (hif1a, hif2a). Hif1a and Hif2a mRNA levels were measured over a period of 8h in 2h intervals. As shown in Figure 8A, Hif1a mRNA expression decreases at first with a slight increase over time, whereas Hif2a mRNA expression increases over time without a drop in expression rate. Both compounds were therefore considered to be able to induce hypoxia in either concentration. In consequence, the effects of Co(II)Cl2 on expression levels of FAAH, NAAA as well as MGL, ABHD6 and ABHD12 were investigated following either 2h or 6h of incubation with the compound, but no obvious changes could be detected (Figure 8B). Note that due to a lack of time, gene expression studies were done for timepoints 2h and 6h and for n=1 only and should be treated as preliminary assumptions.

Prostate cancer has become one of the most frequently occurring tumour types among the male population around the globe28 and it is suggested that the number of diagnoses are about to triple in the western hemisphere over the coming years29. CB1 immunoreactivity has been suggested as a prognostic tool for prostate cancer severity and outcome13 and a previous study found silencing of epigenetic processes induced expression of CB2 mRNA in a neuroblastoma cell line and modulation of CB1 mRNA expression in Jurkat T cells18. Furthermore, silenced CB1 mRNA expression could be upregulated in seven out of eight colorectal cancer cell lines after treatment with a DNA demethylating agent17. All of these findings suggest the endocannabinoid system and its epigenetic regulation as an interesting mechanism to investigate.

The present study investigated the effects of two different epigenetic modulators, Aza dC and Trichostatin A, towards their effect on 12 different components of the endocannabinoid system (see Figure 1) in both a neuroblastoma cell line (SH-SY5Y) and a prostate cancer cell line (DU-145). Aza dC has been shown to alter CB1 expression in colon cancer cell lines whereas histone deacetylase treatment did not17. In SH-SY5Y cells neither treatment with Aza dC nor TSA altered CB1 expression. However, both Aza dC and TSA, as well as the combination of both affected CB2 expression in that same study. and induced elevated expression of normally silenced CB218 Interestingly, both treatments had upregulatory effects on CB1 expression in Jurkat T cells, again individually and additive. This study was able to reproduce the findings of Börner et al in a way, that treatment with both Aza dC and TSA, either individually or combined, did not alter CB1 expression in SH-SY5Y cells. The same effects were observed for treated DU-145 cells. A higher expression of CB1 in the DU-145 cells as compared to SH-SY5Y cells could also be observed (Figure 1A). Interestingly, this study did not find induction of CB2 expression following any kind of epigenetic treatment using two different primer pairs (one taken from Börner et al, one was designed on site) in either cell line, which highlights the importance of not generalizing effects from one cell to another.

In addition, expression of MGL was found to be very low in SH-SY5Y cells compared to DU-145 cells. Functional investigation of 2-OG (a 2-AG analogue) hydrolysis revealed that ABHD6 accounts for some amount of hydrolysed 2-OG (Figure 8), but not all. Since no selective inhibitors for ABHD12 are available as of now, the functional role of ABHD12 could not be investigated. This is interesting because MGL is normally responsible for up to 85% of total 2-AG hydrolysis (these finding are with regards to whole mouse brain tissue lysates, however) and ABHD6 and ABHD12 only account for the remaining 15%30. FAAH could be excluded as a potential candidate for 2-OG hydrolysis, since its inhibition did not affect the amount of radioactive signal in the aqueous phase. Future development of ABHD12 selective inhibitors should help to elucidate ABHD12's function in 2-OG hydrolysis.

Investigation of AEA hydrolysis following Aza dC treatment (Figure 4) was based on small statistically significant changes found in FAAH mRNA expression (Figure 7), but did not reveal any biologically relevant functional changes. Even though both FAAH and NAAA have been shown to partake in AEA hydrolysis31,32, FAAH appears to be the main regulatory enzyme in AEA degradation (Figure 7) in DU-145 cells.

Additionally, exposing cells to anoxic gas and hypoxia mimetics over prolonged periods of time was assumed to mimic a tumours hypoxic microenvironment. To reduce stress and to isolate potential effects of hypoxia itself, cells did not receive epigenetic modulatory treatment. Unfortunately, due to a lack of time, cells could be treated but not all cells' nucleic acids could be extracted nor could their mRNA expression levels be measured. However, expression levels of Hif1a and Hif2a following treatments with hypoxia mimetics were indicative for a successful induction of hypoxia when referring to Uchida et al33 (Figure 9A). Thus far, evaluation of endocannabinoid catabolic enzymes (Figure 9B), did not reveal any effects of hypoxia, but analysis of the remaining experiments might help to determine differences. Based on these findings, future experiments could be constructed around epigenetic modulation and hypoxia.

Even though this study was unable to reproduce the findings of Börner et al in regards to induced CB2 expression in SH-SY5Y cells, and no other apparent effects of epigenetic modulation were observed, the results of different studies taken together clearly indicate an involvement of epigenetic regulation in the endocannabinoid system17. Evaluation of the hypoxia data might open up new perspectives and epigenetic modification could have different outcomes for these conditions. Future experiments should take into consideration that, since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and are worth investigating. The findings of this study merely form the basis for future experiments.

References

1.Di Marzo, V. Targeting the endocannabinoid system: to enhance or reduce? Nat. Rev. Drug Discov. 7, 438-455 (2008).

2.Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. Biochemical and pharmacological characterization of human α/β-hydrolase domain containing 6 (ABHD6) and 12 (ABHD12). J. Lipid Res. 53, 2413-24 (2012).

3.Muccioli, G. G. Endocannabinoid biosynthesis and inactivation, from simple to complex. Drug Discov. Today 15, 474-83 (2010).

4.Guindon, J. & Hohmann, A. G. The endocannabinoid system and cancer: Therapeutic Implications. Br J Pharmacol 163, 1447-1463 (2011).

5.Hanahan, D. et al. Hallmarks of cancer: the next generation. Cell 144, 646-74 (2011).

6.Schnekenburger, M., Florean, C., Dicato, M. & Diederich, M. Epigenetic alterations as a universal feature of cancer hallmarks and a promising target for personalized treatments. Curr. Top. Med. Chem. 16, 745-776 (2015).

7.Kulis, M. & Esteller, M. in Advances in Genetics 70, 27-56 (2010).

8.Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 16, 6-21 (2002).

9.Stresemann, C. & Lyko, F. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int. J. Cancer 123, 8-13 (2008).

10.Virani, S., Virani, S., Colacino, J. A., Kim, J. H. & Rozek, L. S. Cancer epigenetics: a brief review. ILAR J. 53, 359-69 (2012).

11.Berger, S. L. The complex language of chromatin regulation during transcription. Nature 447, 407-412 (2007).

12.Bray, F., Lortet-Tieulent, J., Ferlay, J. & Forman, D. Prostate cancer incidence and mortality trends in 37 European countries: An overview. Eur. J. Cancer 46, 3040-3052 (2010).

13.Chung, S. C. et al. A high cannabinoid CB1 receptor immunoreactivity is associated with disease severity and outcome in prostate cancer. Eur. J. Cancer 45, 174-182 (2009).

14.Ruiz, L., Miguel, A. & Díaz-Laviada, I. Delta9-tetrahydrocannabinol induces apoptosis in human prostate PC-3 cells via a receptor-independent mechanism. FEBS Lett. 458, 400-4 (1999).

15.Melck, D. et al. Suppression of Nerve Growth Factor Trk Receptors and Prolactin Receptors by Endocannabinoids Leads to Inhibition of Human Breast and Prostate Cancer Cell Proliferation 1. Endocrinology 141, 118-126 (2000).

16.Nithipatikom, K. et al. 2-Arachidonoylglycerol: A Novel Inhibitor of Androgen-Independent Prostate Cancer Cell Invasion. Cancer Res. 64, 8826-8830 (2004).

17.Wang, D. et al. Loss of cannabinoid receptor 1 accelerates intestinal tumor growth. Cancer Res. 68, 6468-6476 (2008).

18.Börner, C., Martella, E., Höllt, V. & Kraus, J. Regulation of opioid and cannabinoid receptor genes in human neuroblastoma and T cells by the epigenetic modifiers trichostatin A and 5-Aza-2'- deoxycytidine. Neuroimmunomodulation 19, 180-186 (2012).

19.Kim, Y., Lin, Q., Glazer, P. & Yun, Z. Hypoxic Tumor Microenvironment and Cancer Cell Differentiation. Curr. Mol. Med. 9, 425-434 (2009).

20.Yuan, Y., Hilliard, G., Ferguson, T. & Millhorn, D. E. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J. Biol. Chem. 278, 15911-6 (2003).

21.Semenza, G. L. Regulation of Mammalian O 2 Homeostasis by Hypoxia-Inducible Factor 1. Annu. Rev. Cell Dev. Biol. 15, 551-578 (1999).

22.Billups-Rothenberg, I. Modular Incubator Chamber Instructions. at <http://www.brincubator.com/pop_mic.htm>

23.Björklund, E. et al. Involvement of Fatty Acid Amide Hydrolase and Fatty Acid Binding Protein 5 in the Uptake of Anandamide by Cell Lines with Different Levels of Fatty Acid Amide Hydrolase Expression: A Pharmacological Study. PLoS One 9, e103479 (2014).

24.Boldrup, L., Wilson, S. J., Barbier, A. J. & Fowler, C. J. A simple stopped assay for fatty acid amide hydrolase avoiding the use of a chloroform extraction phase. Journal of Biochemical and Biophysical Methods 60, (2004).

25.Field, A. P., Miles, J. & Field, Z. Discovering statistics using R. (Sage, 2012).

26.Hochberg, Y. & Benjamini, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Controlling the False Discovery Rate: a Practical and Powerful Approach to Multiple Testing. Source J. R. Stat. Soc. Ser. B J. R. Stat. Soc. Ser. B J. R. Stat. Soc. B 57, 289-300 (1995).

27.Kim, Y., Lin, Q., Glazer, P. & Yun, Z. Hypoxic Tumor Microenvironment and Cancer Cell Differentiation. Curr. Mol. Med. 9, 425-434 (2009).

28.Schröder, F. H. Prostate cancer around the world. An overview. Urol. Oncol. Semin. Orig. Investig. 28, 663-667 (2010).

29.Quon, H., Loblaw, A. & Nam, R. Dramatic increase in prostate cancer cases by 2021. BJU Int. 108, 1734-1738 (2011).

30.Blankman, J. L., Simon, G. M. & Cravatt, B. F. A Comprehensive Profile of Brain Enzymes that Hydrolyze the Endocannabinoid 2-Arachidonoylglycerol. Chem. Biol. 14, 1347-1356 (2007).

31.Sun, Y. X. et al. Involvement of N-acylethanolamine-hydrolyzing acid amidase in the degradation of anandamide and other N-acylethanolamines in macrophages. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids 1736, 211-220 (2005).

32.Ueda, N., Puffenbarger, R. A., Yamamoto, S. & Deutsch, D. G. The fatty acid amide hydrolase (FAAH). Chem. Phys. Lipids 108, 107-121 (2000).

33.Uchida, T. et al. Prolonged hypoxia differentially regulates hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha expression in lung epithelial cells: implication of natural antisense HIF-1alpha. J. Biol. Chem. 279, 14871-8 (2004).

 

 

UMU_pos_20mm

Department of Molecular biology

Umeå university

901 87 Umeå, Sweden

Telephone +46 90 785 28 69

www.molbiol.umu.se


To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Request Removal

If you are the original writer of this essay and no longer wish to have the essay published on the UK Essays website then please click on the link below to request removal:


More from UK Essays

We can help with your essay
Find out more