Treatment of several pathologies

Published:

Hypericum perforatum L. (HP), commonly known as St. John's wort is an important medicinal plant used in the treatment of several pathologies since ancient times. The clinical efficacies of the HP extracts in the therapy of mild to moderate depressions have been confirmed in recent studies . Many other important pharmaceutical properties of HP including antiviral , anticancer , neuroprotective and antioxidant activities have also been reported. Since treating humans and animals with HP extracts does not show any serious adverse side effects , use of this medicinal herb has increased dramatically during the past decade. Today, HP products are one of the top selling herbal medicines worldwide which are sold in the USA as a dietary supplement, while in Europe as anti-depressive agents . These important pharmaceutical properties of the HP secondary metabolites have been the main thrust for the enormous research with cell cultures focused at present .

The use of plant cell and tissue cultures for the large-scale production of secondary metabolites has so far achieved only limited success due to the low and unreliable yields of the secondary products. Although significant improvements in product yields have been achieved through conventional biochemical approaches and the manipulation of the culture and process factors, the reproducibility of results is still a major concern [14]. Metabolic engineering is envisaged as an effective and powerful tool for improving the biosynthesis of therapeutically useful compounds in medicinal plants [15,16]. As the pharmacological activities of HP extract are largely attributed to hypericin and hyperforin which are exclusively produced in this species, improving their production is an important target for genetic manipulation. This goal could not be achieved so far because of the poor knowledge about their biosynthesis and namely due to the absence of transformation systems. Establishment of procedures for genetic transformation for HP would be useful for studying the biochemical and gene expression profiles of the biosynthetic pathways, and for metabolic engineering. Hence, there is an immediate need for establishing a transformation system for HP.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Among the several gene transfer techniques currently in practice, Agrobacterium tumefaciens mediated transformation is the most efficient and commonly used technique in plant genetic engineering. On the other hand, hairy root cultures established by Agrobacterium rhizogenes mediated transformation often sustain stable productivity in hormone-free culture conditions resulting in large amounts of secondary metabolites accumulation [17]. Particle- bombardment technique has been successfully used in the genetic transformation of a wide variety of plant species including many that are not amenable to Agrobacterium mediated transformation and become the second most widely used technique for plant transformation .

In the current investigation, we evaluated the efficiency of A. tumefaciens, A. rhizogenes and particle- bombardment techniques for transformation of HP. We report the successful genetic transformation of HP via particle- bombardment mediated gene transfer for the first time.

Materials and methods:

  • Sources of explants and plant regeneration:
  • Various plant parts such as leaf blade, petiole, stem and root segments excised from the aseptic seedlings of HP var Helos (purchased from Richters, Goodwood, Canada) were used as differentiated explants. The regeneration protocol adopted has been described elsewhere.

    As a source of undifferentiated explant, cell suspension culture was established from compact callus induced from HP (var. Helos) leaf explants as described earlier . The established suspension cultures possessed morphologically distinct white and green cell types. The later cell type developed into green nodular structures of about 1-3 mm in diameter. These structures were filtered and cultured separately in MS liquid medium supplemented with 0.475 mg l-1 NAA. For multiplication, 10 ml of the organogenic nodular suspension was subcultured to Erlenmeyer flasks (250 ml) each containing 70 ml of liquid medium once in 30 days. Cultures were incubated at 25 °C under photoperiodic (16 h) conditions on a rotary shaker at 80 rpm. Organogenic nodular structures (ONS) obtained from these suspensions were used as undifferentiated explants . MS medium supplemented with various concentrations of benzylaminopurine (BA) (0, 0.1, 0.5, 2.0) with 0.0 or 0.1 mg l-1 naphthaleneacetic acid (NAA) was tested for plant regeneration from ONS. Cultures were incubated at 25 °C in the dark and subcultured once in 15 days until neoformation of calluses or shoot initials were observed and thereafter transferred to photoperiod conditions.

    Half-strength MS medium with 0.5 mg l-1 indole-3-butyric acid (IBA) was used for rooting. Combination of 3% (w/v) sucrose and 0.8% (w/v) agar was common to all media. The pH of the medium was adjusted to 5.8 (unless otherwise mentioned) before autoclaving at 1.0 kg cm-2 for 15 min. Disposable Petri dishes containing 20-25 ml medium were inoculated with 5-10 explants, sealed with parafilm and cultured.

  • Optimization of hygromycin selection:
  • Lady using a tablet
    Lady using a tablet

    Comprehensive

    Writing Services

    Lady Using Tablet

    Plagiarism-free
    Always on Time

    Marked to Standard

    Order Now

    To determine the appropriate concentration of hygromycin for the selection of transformants, the ONS (Fig. 1A) and other explants (leaf blade, petiole, stem and root segments) were cultured on optimized regeneration medium supplemented with different concentrations of hygromycin (5-50 mg l-1). The ONS tissues were maintained in dark whereas the other explants were maintained under photoperiod and sub-cultured onto fresh medium for every 10 days. The viability of explants was monitored by visual observation and fluorescein diacetate staining.

  • Plasmid vector, Agrobacterium strains and culture:
  • The plasmid pCAMBIA1301 (CAMBIA, Australia) containing the selectable hpt gene that encodes hygromycin phosphotransferase and the reporter gusA gene disrupted by catalase intron that favors the expression only in eukaryotic cells was used in all the transformation experiments. Both these genes are driven by CaMV 35S promoter, and are cloned in opposite orientation . For Agrobacterium-mediated transformation, pCAMBIA1301 was transferred to the disarmed A. tumefaciens strains LBA4404 and EHA105 using CaCl2 method . A. tumefaciens strains were maintained in LB medium supplemented with 25 mg l-1 rifampicin and 50 mg l-1 kanamycin. Wild type A. rhizogenes strains A4 and LBA9402 were grown in MYA and YMB media respectively.

    Single Agrobacterium (tumefaciens/ rhizogenes) colony was inoculated into 5.0 ml of appropriate liquid bacterial culture medium augmented with suitable antibiotics if required and incubated at 28 °C in a rotary shaker at 200 rpm for 12-16 h. Subsequently, 0.5 ml of grown bacterial broth was transferred to 250 ml Erlenmeyer flask containing 100 ml of bacterial culture medium and maintained under similar conditions. When the bacterial culture reached the optical density (OD) of 0.8-1.0 at 660 nm, bacteria were spun down using a tabletop centrifuge (Eppendorf, USA) at 4000 rpm and re-suspended in the vir gene induction medium [1x AB salts , 2 mM NaPO4, 50 mM 2-morpholinoethanesulfonic acid (pH 5.6), 0.5% glucose and 100 µM acetosyringone (AS)].

  • Agrobacterium mediated transformation:
  • Explants precultured for 24 h in respective regeneration media (MS+0.5 mg l-1 BA + 1.0 mg l-1 IAA for differentiated explants and MS+ 1.0 mg l-1 BA + 0.1 mg l-1 NAA for ONS) were infected with the bacterial suspension for 5, 10, 20 and 30 min, blot-dried and transferred onto CC medium (regeneration medium + 200 µM AS, pH 5.2) for co-cultivation. To check the efficacy of antioxidants and ethylene inhibitor on T-DNA transfer, the co-cultivation medium (CC) was supplemented with 10.0 mg l-1 butylated hydroxytoluene (BHT), 400 mg l-1 cysteine, 100 mg l-1 AgNO3 and 5.0 mg l-1 aminoethoxyvinylglycine (AVG) in different experiments. Explants co-cultivated with Agrobacterium (tumefaciens/ rhizogenes) were thoroughly washed with sterilized distilled water to remove Agrobacterium contamination and transferred to regeneration medium under selection (with 20 mg l-1 hygromycin and 250 mg l-1 ticarcillin clavulanate) or without selection (with only ticarcillin for bacteria elimination).

  • Plasmid isolation, precipitation of plasmid DNA onto gold particles and preparation of explants for bombardment:
  • Plasmid DNA (pCAMBIA1301) was isolated from the E. coli strain (DH5α) using the Wizard®plus midipreps DNA purification system (Promega, USA) and precipitated onto 1.0-μm gold particles (Bio-Rad, USA) following standard procedures. Briefly, the following components were orderly added to an Eppendorf tube (1.5 ml) containing 87.5 µl of 1µm gold particles (7 mg in 50 μl glycerol) in agitation: 5 μl of plasmid DNA (1µg/ µl), 87.5 μl of 2.5 M CaCl2 and 35 μl of 100 mM spermidine. The mixture was rested on ice for 10 min before centrifugation at 6000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 µl ethanol (100%). Just prior to loading the particle bombardment apparatus, the particles were vortexed for a few seconds to disperse any clumps. For each bombardment, 10 μl of DNA-gold suspension containing 700 μg gold particles associated with 0.5 μg plasmid DNA was spread and air-dried onto a macrocarrier.

    Based on the results with Agrobacterium-mediated transformation, ONS explant was only selected for further experiments with particle bombardment. Approximately 4 h before bombardment, ONS were harvested from the suspension culture and placed in the liquid osmotic medium (regeneration medium without agar + 34 g/l mannitol and 34 g/l sorbitol). For each bombardment assay, 1.0 ml of the explants along with osmotic medium was poured at the center (3 cm diameter) of a sterile round Whatman filter paper disk until excess liquid was absorbed. Each disk was then carefully transferred to Petri dish (100 mm) containing 20 ml of solid osmotic medium before bombardment.

  • Particle bombardment:
  • Lady using a tablet
    Lady using a tablet

    This Essay is

    a Student's Work

    Lady Using Tablet

    This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

    Examples of our work

    The bombardment chamber of a Particle Delivery System (PDS-1000/He, Bio-Rad) was evacuated at a pressure of 28 in. of mercury. Explants were bombarded with DNA-coated particles (1.0 µm in size; Bio-Rad), discharged with 9.0 and 12.0 cm flying distances (distance between stopping screen and target tissue). Different rupture disks such as 650-psi, 900-psi and 1,100-psi were used. Four hours after bombardment, the ONS were transferred onto regeneration medium. After 2 days incubation on regeneration medium, half of the bombarded explants were transferred to selection medium and the other half were left in the regeneration medium supplemented with 250 mg l-1 ticarcillin clavulanate.

  • Regeneration of transgenic plants:
  • Calluses with shoot initials developed from the ONS explants on regeneration medium with or without selection were transferred to MS basal medium with hygromycin (20 mg l-1) for shoot elongation. For root induction, elongated shoots (3-5 cm) were excised from the explant and transferred to Baby Food Jars containing 50 ml of half-strength MS medium supplemented with 0.5 mg l-1 indole-3-butyric acid (IBA) and 20 mg l-1 hygromycin.

  • Enzymatic histochemical GUS Assay:
  • GUS assay was performed periodically (after 2, 10 and 90 days) for explants from various experiments to monitor transformation. The percentage of transient expression was calculated as the number of explants showing blue spots divided by the total number of explants assayed and multiplied by hundred.

  • PCR analysis of putative transgenic plants:
  • Genomic DNA from the hygromycin- resistant and control plants was isolated using DNeasy plant mini kit (QIAGEN, Germany). The gusA gene fragment was amplified using forward primer sequence 5'GATCGCGAAAACTGTGGAAT3' and reverse primer sequence 5'TGAGCGTCGCAGAACATTAC3'. The forward and reverse primer sequences for the hpt gene amplification were 5'ATTTGTGTACGCCCGACAGT3' and 5'GGATATGTCCTGCGGGTAAA3' respectively. The reaction mixture contained 50 ng of genomic DNA, 2.0 µl of each primer (5 pmol), 0.5 µl of dNTP mix (2.5 mM each), 2.5 µl of PCR buffer and 0.25 µl of Taq DNA polymerase (5U/ µl), and the volume was adjusted to 25µl with sterile distilled water. The PCR conditions included hot start at 94 °C for 4 m, followed by 30 cycles of denaturation (94 °C, 1 m), annealing (55°C, 2 m) and extension (72 °C, 2 m), with a final extension of 10 m at 72 °C. PCR amplification products were resolved in 0.8% agarose gel with ethidium bromide.

  • Southern blot analysis:
  • For Southern blot analysis, 20-μg aliquot of genomic DNA was digested with the restriction endonuclease EcoR I, electrophoresed on a 1.0% agarose gel and transferred onto a Hybond nylon membrane (Amersham, UK). The pCAMBIA1301 DNA was used as the positive control. Prehybridization and hybridization were performed respectively for 3h and 16h in church buffer (250 mM Sodium phosphate buffer (pH 7.2), 1% BSA, 7% SDS and 1mM EDTA) at 55 °C. A 1.3-kb PCR fragment of the gusA gene was labeled with α-[32P] dCTP (Amersham, UK) using Prime-a-Gene® labeling kit (Promega, USA) and used as probe. Hybridized blots were washed twice with 2X SSC+0.1% SDS each for 15 min and with 0.1X SSC+0.1% SDS for 5 min at 55 °C. The blots were exposed to the imaging screen for 12 h and scanned in a Phosphorimager (Bio-Rad, USA).

  • Data analysis:
  • In all the treatments at least 30 samples, representing three independent replications, were analyzed statistically. Regeneration from ONS under different combinations of plant growth regulators (PGRs) was analyzed by Kruskal-Wallis test (one way ANOVA) followed by Dunn's multiple comparison test. Statistical analyses were performed using GraphPad Prism version 4.00 for Windows (GraphPad Software, San Diego, California, USA).

    Results and discussion:

    1. Organogenic cell suspension cultures as source of explants:
    2. Several regeneration protocols have been reported for HP so far . Recently, we have developed an efficient genotype-independent regeneration system from several explant tissues such as leaves, root segments and stem segments . In spite of the robustness of this regeneration protocol, we were unable to achieve HP transgenic shoots from Agrobacterium transformations since the bacteria failed to infect any of the differentiated explants. The recalcitrance of these explants to Agrobacterium infection might be due to the accumulation of hypericin and hyperforin, which are known antibacterial compounds . Since, these compounds are only found in the differentiated tissues, in the present work we have tested in comparison the efficiency of Agrobacterium and particle bombardment-mediated transformation in an undifferentiated explant, the green nodular structures produced from cell suspension cultures. Vardapetyan et al first reported the accumulation of globular structures in the later stages of HP cell suspension cultures which resembled raspberry fruit. However, the utility of these structures in regeneration and transformation of HP has only now been demonstrated.

    3. BA concentration and light conditions affected plant regeneration from ONS:
    4. Plant regeneration from the ONS explants was affected by the BA concentration in a dose-dependent manner. There was a positive relationship between the percentage of ONS explants showing regeneration and BA concentration until 1.0 mg l-1 (Table 1). Addition of NAA (0.1 mg l-1) along with BA further increased the percentage of regeneration, with an optimum concentration of 1.0 mg l-1 BA and 0.1 mg l-1 NAA. Our previous study with differentiated explants also suggested that for callus induction and subsequent regeneration, HP needs a high cytokinin/auxin ratio . In the absence of growth regulators or with NAA as sole PGR, no shoot induction was observed. Incubation in continuous dark until neo-formation of calluses (1-2 weeks) is critical for plant regeneration from ONS, as the explants turned brown and showed delayed callusing when cultured under photoperiod at the start of culture. On the other hand, this initial dark treatment was not essential for regeneration from differentiated explants .

    5. HP explants are highly sensitive hygromycin:
    6. When the explants were cultured on optimal regeneration medium supplemented with different concentrations of hygromycin B, all the explants died within 10 days on medium containing hygromycin concentrations higher than 15 mg l-1. Only 5% of the explants formed callus on medium containing 15 mg l-1 hygromycin. Hence, 20 mg l-1 of hygromycin was considered optimum for the selection of transformants. Hygromycin selection was originally applied for the transformation of monocotyledonous species but it efficiently works also for recalcitrant dicotyledonous species also .

    7. Agrobacterium did not infect differentiated tissues:
    8. Susceptibility of the plant cell towards Agrobacterium infection is the foremost requirement for T-DNA transfer. In the present study, all the tested differentiated explants were found to be resistant to Agrobacterium and T-DNA transfer did not occur. None, out of hundred explants from each treatment assayed for GUS showed blue spots regardless of under selective or non-selective conditions. Hence, we did not continue the experiments with these explants further. There are several reports of high necrosis and poor survival rate of target plant tissues during the process of Agrobacterium-mediated T-DNA transfer in other species as a consequence of plant's hypersensitive reaction to Agrobacterium infection. In the case of HP, differentiated tissues generally accumulate several secondary metabolites such as hypericin, a known antimicrobial compound suggesting that the inability of Agrobacterium to grow and infect this species could be due to antimicrobial activity of these compounds.

    9. Agrobacterium infected ONS in a low frequency in the presence of butylated hydroxy toluene (BHT):
    10. All the ONS explants turned brown within one day of co-cultivation with A. tumefaciens. Browning of explants co-cultivated with A. tumefaciens became more intense under selection pressure eventually resulted in necrosis within 10 days and none of the explants showed transient gusA expression or callus formation. However, under non-selective conditions, all the ONS co-cultivated with A. tumefaciens and A. rhizogenes regained their normal growth within 5 days and produced calluses as the control. Staining of cells from these calluses using fluoresein diacetate 10 days after Agrobacterium infection confirmed 100% cell viability . In spite of the browning occurring after Agrobacterium infection, the cells managed to survive upon subculture in medium with no selection pressure. Moreover, genomic DNA isolated from the explants co-cultivated with A. tumefaciens did not show any fragmentation indicates that the incompatibility of Agrobacterium-mediated transformation in HP is not due to necrosis induced by programmed cell death as reported for other species.

      Out of hundred ONS explants assayed for GUS after co-cultivation with Agrobacterium EHA105 on CC+BHT medium, two explants exhibited GUS foci when cultured on medium without selection. Similarly, one of the explants infected with the other Agrobacterium LBA4404 also showed GUS foci suggesting that A. tumefaciens can infect HP under special conditions but in a very low frequency. These positive results eventually due to the use of a strong anti-oxidant combined with an undifferentiated explant (ONS) which are devoid of organ-specific compounds such as hypericin. ONS explants co-cultivated in the presence of other antioxidants and ethylene inhibitors did not show any GUS foci indicate that BHT is more effective in scavenging harmful reactive molecular species. It seems that BHT can be used as a potential antioxidant in other recalcitrant plant species also. Even though the calluses obtained from ONS under non-selective conditions after co-cultivating with Agrobacterium regenerated shoots as the control, none of them were transgenic. Hence, they were not analyzed further.

      A number of species previously considered recalcitrant are now efficiently transformed by supplementing antioxidants and ethylene inhibitors in the co-cultivation medium. This is mainly due to the fact that oxidative burst or ethylene production during plant - Agrobacterium interaction could be suppressed by these scavengers. However, in our case the tested antioxidants and ethylene inhibitor in the co-cultivation medium did not prevent browning indicating that the browning may be connected to the cellular defense responses. Recently, it was demonstrated that plants can modulate their gene expression in response to Agrobacterium infection and that Agrobacterium can actually trigger the plant defense machinery . Changes in the phenolic profile and darkening of HP suspended cells after elicitation with fungal biomass was also reported . Hence, the browning response of HP when infected with Agrobacterium could be somewhat connected to the modulation of the phenylpropanoid pathway.

    11. Rupture disk pressure, target distance and number of bombardments affected DNA delivery:
    12. In the present investigation with HP, the velocity of gold particles and the flying distance affected callus induction frequencies of ONS but, there was no clear pattern or correlation. However, the number of bombardments (once and twice) significantly affected callus induction but, did not make any difference in the transient expression level of explants until two days . The degree of variability between rupture disk pressure and flying distance in callus induction frequencies may be attributed to the dissimilar penetration rate of the gold particles in the explant tissue. Effective penetration of the target plant tissue by the microprojectiles carrying the DNA is essential for successful gene delivery. The flying distance and rupture disc pressure are obviously affecting the speed of the microprojectiles when reaching explant surface . Among the different rupture disk pressures (650, 900 and 1100 psi) and flying distances (9 and 13 cm), the combination of 9 cm flying distance with 1100 psi rupture disk produced the best results (higher frequency of callus induction under hygromycin selection). This result indicates that the higher acceleration we tested to drive the microprojectiles was the most beneficial for HP transformation.

    13. Timing of hygromycin selection affected transformation efficiency:
    14. Timing of the hygromycin selection of bombarded explants critically affected transformation efficiency . When the explants were transferred to selection medium 2 days after bombardment, only after 10 weeks about 25% of explants produced callus from each plate . These calluses regenerated shoot buds after 6-9 months of bombardment, but in a very low frequency . Around 40% of shoots rooted on half-strength MS medium supplemented with indole-3-butyric acid and 20 mg l-1 hygromycin .

      Under non-selective (late selective) conditions, ONS proliferated during the first two weeks of culture, and callus began to appear 4 weeks after bombardment similar to the control. Two weeks later, about 90% of these explants had formed yellowish calluses with a characteristic red pigmentation , 55% of which regenerated shoots . Subsequently after 2-3 months, when transferred to selection medium, these cultures produced several albinos along with green shoots . Repeated selection of cultures with shoots under non selective conditions finally resulted in the regeneration of uniform green shoots . Around 20% of the green shoots produced roots on rooting medium with selection. In rice, late selection resulted in the formation of chimeric callus lines while in colonial bent grass it produced albino plantlets . A total of seven hygromycin resistant putatively transgenic plants (2 from early selection and 5 from late selection) were hardened and established in garden pots as described earlier .

    15. GUS histochemical evidence for transformation:
    16. Transient gusA gene expression 48 h after bombardment was used as an initial indicator of the efficiency of gene transfer . DNA delivery frequencies ranged from 45% to 75% of GUS-positive explants per bombarded plate . This high variability in transient gene expression between plates is probably due to the variations in the degree of the gold particles coating with the DNA as reported earlier , or to the aleatory distribution and penetration of gold particles, or even to variations in physiological status of the ONS. In all the GUS-positive explants, the foci were observed in the clustered multi-cell aggregates rather than single cells . Individual GUS focus could be seen even after 10 days of bombardment eventually indicating stable expression.

      When the explants with slow-growing calluses obtained from early selection were subjected to GUS assay, blue staining was confined only to the neoformed calluses indicating that growth of non-transformed tissues was completely prevented by this early selection. When the explants with callus and shoots, developed under non-selective conditions, were subjected to histochemical GUS test, blue staining was found in the calluses and in small parts of the shoots indicating chimeric gusA gene expression.

      One out of five hygromycin- resistant plants obtained from late selection (R7) and all the plants obtained from early selection (R4 and R5) established in the pots stably expressed the gusA gene in roots and leaves . Since genes interrupted with an intron will only express after intron splicing, and the non-transformed HP explants tested for GUS expression were negative , the integration of the transgene in these 3 plants could be confirmed.

    17. Molecular evidence for transgene integration in the transgenic plants:
    18. PCR amplification of the genomic DNA from the seven hygromycin-resistant plantlets revealed that the three GUS positive plants (R4, R5 and R7) had the expected fragments of gusA (1.3 Kb) and hpt (0.8 kb) genes were amplified . This reveals that both gusA and hpt genes have stably integrated at least in one loci of their genome. As expected, the transgenes were not amplified in the control plant.

      Southern blot analysis of the seven hygromycin resistant plants (R1-R7). Among these, the three plants which were positive for GUS and PCR (R4, R5 and R7) had hybridization signals in the Southern blot which confirmed the presence of the gus gene in these transgenic HP plants. No hybridization signal was detected in genomic DNA from nontransformed control plants.

      Southern blot analysis also revealed that the gusA gene had integrated into the HP genome of different individuals with diverse copy numbers and insertion sites. The observed band pattern indicates that the three transgenic plants were derived from three independent transformation events. The difference in the banding pattern between R4 and R5 point for different transformation events, although both shoots derived from the same callus. Each sample showed a different band pattern depending on where the T-DNA integrated in the plant genome, since only one Eco RI site was present in the T-DNA . The Southern pattern showed eight or more fragments, thus representing hybrid molecules containing DNA from both the vector and the plant genome, and demonstrating transgene integration in different loci (eight to ten sites). The strong bands in the lanes of R4 and R7 probably indicate multiple copies of the transgene integrated as concatemers.

      Biolistics- mediated transformation generally results in high copy number transgene integration which may lead to transgene silencing. From the Southern analysis of the transgenic HP plants, we found no correlation between transgene copy number and expression, since the transgenic HP plants stably expressing GUS are multicopy for GUS gene. Craig et al also demonstrated the lack of correlation between gene copy and/or insertion site number with gene expression levels in biolistically transformed potato lines. Similarly, transgenic rice lines that received multicopies of GUS and/or bar could express the gene(s) stably at high levels up to the R3 generation .

      In conclusion, as the host range of Agrobacterium pose obstacles for the transformation of HP, particle bombardment can be successfully combined with the regeneration of shoots from ONS via organogenesis in producing transgenic HP plants. This lays the foundation for metabolic engineering of HP for the production of important secondary metabolites such as hypericin and hyperforin. The use of ONS as target tissue is a key factor for the recovery of transgenic HP plants in our study.

      Acknowledgements:

      We are grateful to Dr. Richard Jefferson for providing the plasmid pCAMBIA1301 and to Dr. David Tepfer for the gift of Agrobacterium rhizogenes strains A4 and LBA9402. This work was supported by Fundação de Ciência e Tecnologia (POCTI/ AGR/ 40283/ 2001) and a postdoctoral fellowship (SFRH/ BPD/ 17102/ 2004) awarded by Fundação de Ciência e Tecnologia to G. Franklin is gratefully acknowledged.

      References:

      1. Y. Lecrubier, G. Clerc, R. Didi, M.Kieser, Efficacy of St- John's wort extract WS 5570 in major depression: a double-blind, placebo-controlled trial, Am J Psychiatry 159 (2002) 1361-1366.
      2. V. Butterweck, Mechanism of action of St. John's wort in depression: what is known? CNS Drugs 17 (2003) 539-562.
      3. R.F. Schinazi, C.K. Chu, J.R. Babu, B. Oswald, V. Saalman, D.L. Cannon, B.F.H Ericksson, M. Nasr, Anthraquinones as a new class of antiviral agents against human immunodeficiency virus. Antiviral Res. 13 (1990) 265-272.
      4. P. Agostinis, A. Vantieghem, W. Merlevede, A.M. Peter, Hypericin in cancer treatment: more light on the way. Int J Biochem Cell Biol. 34 (2002) 221-241.
      5. B.A. Silva, A.C.P. Dias, F. Ferreres, J.O. Malva, C.R. Oliveira, Neuroprotective effect of H. perforatum extracts on beta-amyloid-induced neurotoxicity. Neurotox Res. 6 (2004) 119-130.
      6. B.A. Silva, F. Ferreres, J.O. Malva, A.C.P. Dias, Phytochemical and antioxidant characterization of Hypericum perforatum alcoholic extracts. Food Chem. 90 (2005) 157-167.
      7. R.D. Trautmann-Sponsel, A. Dienel, Safety of Hypericum extract in mildly to moderately depressed outpatients. A review based on data from three randomized, placebo-controlled trials. J Affect Disord. 82 (2004) 303-307.
      8. D. Jean, M. Pouligon, A.C. Henriot, Pharmacological activity of three commercial Hypericum perforatum preparations in mice. Phytother Res. 20 (2006) 653- 654.
      9. A.B. Kirakosyan, H.R. Vardapetyan, A.G. Charchoglyan, The content of hypericin and pseudohypericin in cell cultures of Hypericum perforatum L. (St. John's wort) and production of hypericin. Russ J Plant Physiol. 47 (2000) 270-273.
      10. M.A.L. Smith, H. Kobayashi, M. Gawienowski, D.P. Briskin, An in vitro approach to investigate chemical synthesis by three herbal plants. Plant Cell Tiss Org Cult. 70 (2002) 105-111.
      11. G. Pasqua, P. Avato, B. Monacelli, A.R. Santamaria, M.P. Argentieri, Metabolites in cell suspension cultures, calli, and in vitro regenerated organs of Hypericum perforatum cv. Topas. Plant Sci. 165 (2003) 977-982.
      12. A.C.P. Dias, M.F. Ferreira, Production of phenolics by in vitro cultures of Hypericum perforatum: a case study. In: A.P. Rauter, M.E. Araujo, F.B. Palma, J. Justino, S.P. Santos (eds), Natural products in the new millennium: prospects and industrial application, Dordrecht: Kluwer Academic Publishers, 2003, pp. 367-374.
      13. A.C.P. Dias, The potential of in vitro cultures of Hypericum perforatum and Hypericum androsaemum to produce interesting pharmaceutical compounds. In Edzard Earnst (ed), Hypericum: the genus Hypericum, Taylor and Francis, 2003, pp. 137-154.
      14. L.G. Zhou, J.Y. Wu, Development and application of medicinal plant tissue cultures for production of drugs and herbal medicinals in China. Nat Prod Rep. (2006) DOI: 10.1039/b610767b.
      15. W. Hu, J. Zhong, Effect of bottom clearance on performance of airlift bioreactor in high-density culture of Panax ginseng cells. J Biosci bioeng. 92 (2001) 389-392.
      16. T.M. Kutchan, A role for intra- and intercellular translocation in natural product biosynthesis. Curr Opin Plant Biol. 8 (2005) 292-300.
      17. N. Sevon, K.M. Oksman-Caldentey, Agrobacterium rhizogenes-mediated transformation: root cultures as a source of alkaloids. Planta Med. 68 (2002) 859-868.
      18. A. Kemp, J. Parker, C. Grierson, Biolistic transformation of Arabidopsis root hairs: a novel technique to facilitate map-based cloning. Plant J. 27 (2001) 367-371.
      19. A. Jahne, D. Becker, H. Lorz, Genetic engineering of cereal crop plants: a review. Euphytica 85 (1995) 35-44.
      20. G. Franklin, A.C.P. Dias, Organogenesis and embryogenesis in several Hypericum perforatum genotypes. In vitro Cell Dev Biol- Plant 42 (2006) 324-330.
      21. A.C.P. Dias, R.M. Seabra, B. Andrade, F. Ferreres, M.F. Ferreira, Xanthone production in calli and suspended cells of Hypericum perforatum. J Plant Physiol. 158 (2001) 821-827.
      22. T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant. 15 (1962) 473-497.
      23. T. Tzfira, C.S. Jensen, W. Wang, A. Zuker, B. Vinocur, A. Altman, A. Vainstein, Transgenic Populus tremula: a step-by-step protocol for its Agrobacterium- mediated transformation. Plant Mol Biol Rep. 15 (1997) 219-235.
      24. M-D. Chilton, T.C. Currier, S.K. Farrand, A.J. Bendich, M.P. Gordon, E.W. Nester, Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall tumors. Proc Natl Acad Sci USA 71 (1974) 3672-3676.
      25. R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: b-glucronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6 (1987) 3901-3907.
      26. F.R. Pretto, E.R. Santarem, Callus formation and plant regeneration from Hypericum perforatum leaves. Plant Cell Tiss Org Cult. 62 (2000) 107-113.
      27. S.J. Murch, K.L. Choffe, J.M.R. Victor, T.Y. Slimmon, S. Krishnaraj, P.K. Saxena, Thidiazuron-induced plant regeneration from hypocotyl cultures of St.John's wort (Hypericum perforatum cv 'Anthos'). Plant Cell Rep. 19 (2000) 576-581.
      28. S.M.A. Zobayed, P.K. Saxena, In vitro grown roots: a superior explant for prolific shoot regeneration of St. John's wort (Hypericum perforatum L. cv 'New Stem') in a temporary immersion bioreactor. Plant Sci. 165 (2003) 463-470.
      29. S.M.A. Zobayed, S.J. Murch, H.P.V. Rupasinghe, P.K. Saxena, In vitro production and chemical characterization of St. John's wort (Hypericum perforatum L. cv 'New Stem'). Plant Sci. 166 (2004) 333-340.
      30. P. Avato, F. Raffo, G. Guglielmi, C. Vitali, A. Rosato, Extracts from St John's wort and their antimicrobial activity. Phytother Res. 18 (2004)230-232.
      31. H.R. Vardapetyan, A.B. Kirakosyan, A.G. Charchoglyan, The kinetic regularities of the globular structures growth in cell cultures of Hypericum perforatum L. Biotechnologia 4 (2000) 53-58.
      32. P.M. Olhoft, L.E. Flagel, C.M. Donovan, D.A. Somers, Efficient soybean transformation using hygromycin B selection in the cotyledonary-node method. Planta 216 (2003) 723-735.
      33. X. Li, X.D. Wang, X. Zhao, Y. Dutt, Improvement of cotton fiber quality by transforming the acsA and acsB genes into Gossypium hirsutum L. by means of vacuum infiltration. Plant Cell Rep. 22 (2004) 691-697.
      34. M. Sujatha, M. Sailaja, Stable genetic transformation of castor (Ricinus communis L.) via Agrobacterium tumefaciens-mediated gene transfer using embryo axes from mature seeds. Plant Cell Rep. 23 (2005) 803-810.
      35. V. Kumar, K.V. Satyanarayana, S. Sarala Itty, E.P. Indu, P. Giridhar, A. Chandrashekar, G.A. Ravishankar, Stable transformation and direct regeneration in Coffea canephora P ex. Fr. by Agrobacterium rhizogenes mediated transformation without hairy-root phenotype. Plant Cell Rep. 25 (2006) 214-222.
      36. A. Mercuri, L.D. Benedetti, G. Burchi, T. Schiva, Agrobacterium mediated transformation of African violet. Plant Cell Tiss Organ cult. 60 (2000) 39-46.
      37. R. Chakrabarty, N. Viswakarma, S.R. Bhat, P.B. Kirti, B.D. Singh, V.L. Chopra, Agrobacterium-mediated transformation of cauliflower: optimization of protocol and development of Bt-transgenic cauliflower. J Biosci. 27 (2002) 495-502.
      38. D.K. Das, M.K. Reddy, K.C. Upadhyaya, S.K. Sopory, An efficient leaf-disk culture method for the regeneration via somatic embryogenesis and transformation of grape (Vitis vinifera L.). Plant Cell Rep. 20 (2002) 999-1005.
      39. T. Sirvent, D.M. Gibson, Induction of hypericins and hyperforin in Hypericum perforatum L. in response to biotic and chemical elicitors. Physiol Mole Plant Pathol. 60 (2002) 311-320.
      40. G. Hansen, Evidence of Agrobacterium-induced apoptosis in maize cells. Mol Plant Microbe Interact. 13 (2000) 649-657.
      41. B.R. Frame, H. Shou, R.K. Chikwamba, Z. Zhang, C. Xiang, T.M. Fonger, S.E.K. Pegg, B. Li, D.S. Nettleton, D. Pei, K. Wang, Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binary vector system. Plant Physiol. 129 (2002) 13-22.
      42. J-S. Han, C.K. Kim, S.H. Park, K.D. Hirschi, I-G. Mok, Agrobacterium-mediated transformation of bottle gourd (Lagenaria siceraria Standl.) Plant Cell Rep. 23 (2005) 692-698.
      43. C. Petri, N. Alburquerque, O. Perez-Tornero, L. Burgos, Auxin pulses and a synergistic interaction between polyamines and ethylene inhibitors improve adventitious regeneration from apricot leaves and Agrobacterium-mediated transformation of leaf tissues. Plant Cell Tiss Org Cult. 82 (2005) 105-111.
      44. E.S. Seong, K.J. Song, S. Jegal, C.Y. Yu, I.M. Chung, Silver nitrate and aminoethoxyvinylglycine affect Agrobacterium-mediated apple transformation Plant Growth Regul. 45 (2005) 75-82.
      45. R.F. Ditt, E. Nester, L. Comai, The plant cell defense and Agrobacterium tumefaciens. FEMS Microbiol Lett. 247 (2005) 207-213.
      46. L.F.R. Conceição, F. Ferreres, R.M. Tavares, A.C.P. Dias, Induction of phenolic compounds in Hypericum perforatum L. cells by Colletotrichum gloeosporioides elicitation. Phytochemistry 67 (2006)149-155.
      47. R. Marchant, J.B. Power, J.A. Lucas, M.R. Davey, Biolistic transformation of rose (Rosa hybrida L.). Ann Bot. 81 (1998) 109-114.
      48. P. Christou, T.L. Ford, The impact of selection parameters on the phenotype and genotype of transgenic rice callus and plants. Transgenic Res. 4 (1995) 44-51.
      49. M.L. Chai, K.K. Senthil, D.H. Kim, Transgenic plants of colonial bentgrass from embryogenic callus via Agrobacterium- mediated transformation. Plant Cell Tiss Org Cult. 77 (2004) 165-171.
      50. S.V. Sawant, P.K. Singh, R. Tuli, Pretreatment of microprojectiles to improve the delivery of DNA in plant transformation. Biotechniques 29 (2000) 246-248.
      51. C. Gao, L. Jiang, M. Folling, L. Han, K.K. Nielsen, Generation of large numbers of transgenic Kentucky bluegrass (Poa pratensis L.) plants following biolistic gene transfer. Plant Cell Rep. 25 (2006) 19-25.
      52. W. Craig, D. Gargano, N. Scotti, T.T. Nguyen, N.T. Lao, T.A. Kavanagh, P.J. Dix, T. Cardi, Direct gene transfer in potato: A comparison of particle bombardment of leaf explants and PEG-mediated transformation of protoplasts. Plant Cell Rep. 24 (2005) 603-611.
      53. A. Kohli, D. Gahakwa, P. Vain, D.A. Laurie, P. Christou, Transgene expression in rice engineered through particle bombardment: Molecular factors controlling stable expression and transgene silencing. Planta 208 (1999) 88-97.