The Molecular Basis Of Disease Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Gene replacement therapy is a method of treatment of faulty genes with the help of genetic engineering.It was done in humans in the year 1990 for hereditary diseases and is still at the developing stage. Gene replacement therapy helps to import foreign genes to change the genotype of cells for the treatment of eye diseases.In the gene replacement therapy a wild counterpart of the impaired genes is tranfected into the appropriate cells and thereby restore the production of the required gene.This method is difficult to practice.viral and nonviral methods are used to facilitate the transfer of genes into the cells.Transfer of cDNA version of a gene under its truncated version of heterologous promoter is done to get a reliable transfer.Because of many limitations these genes are not able to reconstitute the endogenous expression of the counterpart gene.There are some exceptional cases like that of the sickle cell anemia in which the wild type gene expression is regulated by the β globin promoter and it is expressed normally.

1.2.2 Antisense therapy

Antisense therapy is a method of treating genetic disorders or infections.Recently antisense has been widely used to track various type of cancers like lung cancer, colorectal cancer , pancreatic cancer and many other diseases like asthma and arthritis. The main principle involved in the antisense therapy is inhibiting the translation of a target protein with the help of complimentary oligonucleotide binding to the target mrna.

Genes are composed of double helical DNA.In order to specifically stop a gene that is found to play a role in disease, its genetic code should be known.As a gene gets turned on its genetic code in that segment takes place as a single strand of RNA known as messenger RNA.This messenger RNA can be translated into a series of amino acids to form a protein, so they are called as sense sequence and the strand which is opposite in a DNA double helix is called as the antisense strand.The antisense coding sequence of a disease gene is used to make short Antisense DNAs.These antisense drugsceases the production of the disease causing protein by binding themselves to messenger RNAs from disease genes so that genetic code in the RNA cannot be read.GEM- 231, GTI- 2040,GEM -240 are some examples of antisense agents.

The antisense oligonucleotide when subjected into a cell hybridizes to the corresponding mRNA to form a heteroduplex by Watson crick binding.As the duplex is formed inhibition of the protein translation coded by the sequence of bound Mrna takes place.Several mechanisms are involved in this inhibition in which the most commonly accepted mechanism states that the mRna in the heteroplex is degradedby the ubiquitous enzyme RNAase H.

1.2.3 RNAi Therapy

RNAi interference is a post transcriptional gene silencing in which a double stranded RNA causes specific breakdown of homologous Mrna sequences when it is introduced into the cell.RNA interference has the capability to allow the negative regulation of any gene.The stable propogation of the phenotype to progeny is enabled by transgene RNAi..RNAi therapy was first done in the invertebrate nematode, caenorhabditis elegans.RNAi has been found in unicellular protozoans, insects, fungi and in plants andvertibrates.RNAi acts as a defence mechanism against viruses which include double stranded DNA also.If double stranded DNA is present in a cell, a ribonuclease called the dicer identifies it and process it into small dsRNA molecules.These dsRNA have 21 base pairs.These molecules are called as interfering RNAs.RNAi therapy is found to be an excellent mode for validating drug targets.RNAi therapy is mainly done for patients having diseases like cancer, genetic diseases and viral infections.The major defect of RNAi therapy is that the innate immune responses will be stimulated.Another major problem in RNAi therapy is that there is always competition with the endogenous RNA.

1.3.PROBLEMS ASSOCIATED WITH DELIVERY OF LARGE MOLECULES

Many failures occurred due to the systemic administration of drugs in various clinical trials. This was due to the insufficient amount of drugs reaching the target site and also leading to various side effects. In order to reduce the doses required and also reduce he side effects drug targeting was required to deliver the drugs to the tissue of interest.The major defect of the large molecule delivery is the systemic toxicity and variable penetration of the molecules.An example for the delivery of large molecules into the eye is the delivery of certain antibiotics into the aqueous humor of the eye is prevented by the blood-aqueous barrier.Another barrier in the eye is the blood-retina barrier which prevents the availability of large molecular drugs into the posterior part of the eye which is made up of rtinal pigment epithelial cells and retinal capillaries. Large molecules cannot pass through the blood-brain barrier and only molecules having a molecular weight of less than 400 Daltons can perfuse through it.Molecular therapeutics help in the delivery of small molecular weight dugs into the brain where small protein lead drug molecules are put into force.

1.4 GENE DELIVERY METHOD.

The introduction of healthy gene into target cells is termed as gene delivery.It promote the expression of normal protein and also restore correct cellular function.It is a promising technique,Gene therapy has a pivotal role in the treatment of genetic diseases.It is also applicable to situations which do not have a genetic component.Many different methods of gene delivery are there and it can be mainly subdivided into two groups

Viral gene delivery

Non viral gene delivery method

The gene therapy vectors with sufficient targeting ability,transfection efficiency and safety must be achieved before gene therapy could be used in man.The ideal gene deliver vectors would have any one of the following characteristics,they are specificity, resistance to metabolic degradation,safety and an ability to express.

1.4.1 VIRAL GENE DELIVERY

Virus mediated gene delivery is viral delivery method.A foreign gene is packed into a viral particle and this virus inject the gene inside a host cell.There are mainly four types of viruses in use of gene therapy.They are adeno viruses, adeno associated viruses, lentiviruses,lentiviruses and reteroviruses.Among these Reteroviruses and adenoviruses are the most commonly used vectors.

Adenoviruses

Adenoviruses are mostly used in experimental and clinical approaches because of their advantages such as relative ease of production and broad target tropism.These vectors were the first bioactive substances to be delivered to the heart using ultrasound targeted microbuble destruction method.

Adeno-associated viruses:

Adeno associated virus vectors are single stranded DNA viruses that can infect target cells and may incorporate their genome into the host cells.They have certain advantage when compared with adenoviral vectors which makes them superior in some clinical settings showing only minimal immunogenicity,no direct toxicity.

Reteroviral vectors

Reteroviral Vectors are single stranded RNA viruses that intergrate their genome into the host cell with the help of reverse transcriptase.Thus it is not used in dividing cells and present the risk of inducing malignancies by dysregulation of gene at the prodigal intergration site.

Lentiviral vectors

Lentiviral vectors also have the ability to integrate their genome into the host cells.It is also used for non dividing cells.It is based on the human immune deficiency virus type 1

Viral gene delivery have several advantages, but also have many undesired side effects such as viral toxicity and host immune rejection.

1.4.2 NON VIRAL METHODS

Non-viral methods include physical and chemical methods. The Physical methods such as microinjection, gene gun, electroporation, sonoporation and magnetofection. The chemical methods include liposomes and miscelles.

1.4.2.1 SUPRAMOLECULAR SYSTEMS

1.4.2.1.1. Liposomes:

Liposomes are microscopic sacs or tiny vesicles made from synthetic or natural fatty substances consisting of phospholipids. Simply it is an aqueous compartment enclosed with same material as a cell membrane called phospholipids. The name liposome for these tiny bubbles came from two Greek words, Lipos meaning fat and soma meaning body. Liposomes were first described by British hematologist Dr Alec D Bangham FRS in 1961.

Since phospholipids are part of the cell membrane they can easily penetrate the horny epidermal layer of skin and can trap any substance that will dissolve oil or water. The bilayer is formed by the arrangement of hydrophilic groups facing outside and hydrophobic tails repelled inwards ,in this same way the second layer is formed by tail group repelled by the water inside the cell,in an acquous solution. Thickness of the bilayer is approximately 5-6nm Benefits of liposomes as drug carriers.The main advantage of Liposomes are that it can be used to entrap a wide variety of hydrophilic and lipophilic drugs.Liposomes protect the drugs from enzymatic degradation.They have the capability to entrap a wide variety of hydrophilic and lipophilic drugs.They Can be made with different sizes and compositions.

1.4.2.1.2. MISCELLES

Lipid monolayers with fatty acid core and polar surface are called micelles. Inverted micelles are those with a Polar core and fatty acid surface. The process of forming micelle is called micellization.By increasing the surfactant concentration ofa liquid the amount of surfactant adsorbed is increased at the liquid air and liquid container interfaces.When the concentration is further increased the adsorption of the surfactant molecules ends up with tightly packed monolayer.At this point interfacial tension become constant and it reaches the bulk solubility limit of the surfactant.If more surfactant is added to the solution it will associate into small aggregates called miscelles.The concentration at which this happens is called critical miscellar concentration.The formation of miscelles is dependent on temperature and is usually measured at 25 degree celcius,.This temperature is called critical miscellar temperature.Depending on the concentration miscelles tend to change their shape.At concentrations above critical miscellar concentration, it tends to be spherical and if the concentration is increased the shape changes to laminar or cylindrical.

In the case of water insoluble and sparingly soluble drugs can be solubilised with the incorporation of suitable miscelles depending on the structure of the drug.Miscelles are also used as drug delivery vehicles.Some of them are used as preservatives for drug formulations.

1.5 INTRACELLULAR TRAFFICKING

Endocytosis

Endocytosis can be defined as process in which an extracellular molecule is invaginated into the cell forming a membrane bound vesicle around it.The portion of the endosomes get invaginated into the cell forming a a vesicle enclosing the molecules known as endosomes.In the endocytic process the molecule which is to be ingested first gets invaginated and then it slowly pinches to form a vesicle called as the endocytic vesicle. The endocytosis can be divide into pinocytosis, phagocytosis and receptor mediated endocytosis

Pinocytosis

Pinocytosis is a type of endocytosis where the extracellular fluids are maily engulfed into the cells.They form small fluid filled vesicles inside the cells.

Phagocytosis

Phagocytosis is a a type of endocytosis where molecules, mainly solid particles are engulfed into the cell.It also helps in removing pathogens and other unwanted cellular materials.

Receptor mediated endocytosis

Receptor mediated endocytosis is where the engulfing of specific molecules takes place.Receptor proteins on the surface of the cell is responsible for the process.Uptake of low density lipoproteins into the cell is a classic example of receptor mediated endocytosis.

In endocytosis there are mainly divided into early endosomes and late endosomes.

Early Endosomes

They are the vesicles into which the invaginated molecules are first delivered. Early endosomes are also known as sorting endosomes.Rab4, Rab5 and transferring receptor proteins are the characteristic proteins associated with early endosomes. The Rab proteins are distributed characteristically on the cell membranes.The early endosomes have an acidic environment inside it.

Rab5

Rab5 is a protein that belongs to the Ras family of proteins. The rab proteins are involved in the trafficking of molecules into the cells and they are monomeric in nature.In the GTP bound form the Rab5 protein is active and in the GDP bound state they prove to be inactive .Rab5 proteins also bind to other proteins known as Rab effectors to enable the docking process in edocyotosis.Rab5A is found in the plasma membrane and clathrin coated vesicles and Rab5c is found in early endosomes.

GREEN FLUORESCENT PROTEIN (GFP)

Green fluorescent protein was first isolated 30 years from a jelly fish Aequorea Victoria.After the GFP was cloned and expressed in other organisms ,led to the use of GFP as a fluorescent protein marker.The importance of this protein led it to the Nobel Prize in 2008.Green fluorescent protein is a monomer with a conformation which is highly stable.The stability of GFP can be established by a half life equivalent to 26 hours in most of the cells.GFP expressed at 37 degree Celsius is far less fluorescent than GFP at 15 degree Celsius.The structure of GFP is similar to that of other proteins.The secondary structure is a series of pleated sheets and helices due to the hydrogen bonding.The teriary structure is in the shape of a barrel made up of 11 sheets and capped by helices.At the centre there is a short chain of aminoacids which is the chromophore for the emission of light. As shown in fig:1.

Fig:1 Tertiary structure of structure of GFP

GFP is made up of 238 amino acids and with a weight of 27,000 atomic mass units.The fluorescence of eGFP is due to the chromophores which forms 65 to 67 ser-tyr-gly cyclisation of aminoacids.GFP has proved to be great tool with excellent potential in protein localisation and gene expression.

Polymerase Chain Reaction (PCR)

The quick method of amplifying a particular piece of DNA in the testube is called polymerase chain reaction.With this method unlimited copies of a single DNA molecules can be made from a mixture of dna molecules.In the PCR technique the intended piece of DNA is amplified using particular primers The main concept behind this method is the ability of DNA polymerase to systhesise the DNA strand complimentary to its template.

Requirements:

DNA template-Targeted sequence of DNA

DNA polymerase-enzyme

Primer-short oligonucleotides complimentary to 3' end of each strand of DNA to be amplified

Nucleotide-Deoxynucleotide triphosphates(dATP,dCTP,dGTP,dTTP)

General steps involved in PCR:

Select the dna to be amplified

Synthesise primer complimentary to the 3' end of DNA which need to be amplified

Heat the dNA sample and separate the strands and mix with the pimer

Binding of primer to complimentary sequence of DNA begind from 5' to 3'(This polymerisation reaction continues until each newly synthesised strand identifies its own primer

This result in the formation of DNA molecule identical to original molecule..

With the help of an automated equipment more than a billion copies after 30 cycles can be made.

PCR is used in the diagnosis of diseases like leukemia and lymphoma.It is also used in the identification of slowgrowing microorganisms.It is used in the detection of viral DNA.Quantitative PCR methods are used to determine the levels of gene expression.PCR fingerprint methods are used to identify genetic relationship between individuals.It is used in paternity testing and to determine evolutionary relationships.

SEQUENCING

Sequencing is basically needed for the Bio molecular researches . The sequencing ids done by the step by step incorporation of nucleotides. sequencing by-synthesis is the technique which uses dna polymerase enzyme to read the sequence of the template at the 3′ terminus of an annealed primer strand with exquisite precision and to extend the primer by only that nucleotide that is complementary to the template base. If the identification of each nucleotide incorporated by the polymerase is possible then the sequence is easily read.

Incorporation of a chain terminating nucleotide which is labelled fluorescently in single nucleotide reactions uses the principle of . This method can also be called as solid phase minisequencing and is used for multiplexed dna sequences.

TRANSFECTION

Transfection is the introduction of an exogenous material (DNA/RNA, Protiens or antibodies) into a eukaryotic cell. The process is followed by the intergration of DNA subsequently to its recipient cells chromosomal DNA. Usually these exogenous DNA or RNA for transfection are isolated from a bacteriophage or a plant, or animal cell resulting in complete replication of virus from which the genetic material is isolated. But in eukaryotes non viral method is preferred.

1.6) AIM

2. MATERIALS AND METHODS

2.1) MINI PREP

The bacterial cells were pelleted by microcentrifuging the overnight culture of MC 1061 Strain of bacteria at 6000xg for 15 minutes and the supernatant liquid was removed.

The bacterial pellet was resuspended in 0.3ml of buffer P1 which is a combination of 50mM Tris Hcl Ph 8,10mM EDTA and 10µg/ml RNAase A .Lyse blue reagent was also added to the buffer P1.

To the above solution 0.3ml of buffer P2 which is a combination of200mM sodium hydroxide, 1%SDS in water was added and mixed thoroughly by inverting the sealed tube a couple of times.The solution turns blue due to the presence of Lyse blue reagent.

0.3ml of refrigerated buffer P3 which is 3.0M potassium acetate at Ph 5.5 was added to the above mixture and mixed thoroughly and incubated on ice and a precipitate of genomic DNA, cell debris and protein is obtained .The blue colour disappears completely.

Then the above suspension is microcentrifuged at 20,000xg for 10 minutes and the plasmid DNA containing supernatant liquid is removed.

The qiagen tip 2500 is equilibrated using 1ml buffer QBT which is 750 mM Nacl,50mM MOPS at PH 7, 15% isopropanol and 0.15% of triton-100 and the column was allowed to empty.

The supernatant in the 5th step was applied to the qiagen tip and was allowed to enter the resin column.

The qiagen tip was washed with 2-2ml of buffer QC which is 1.0 M NACL,50mM MOPS at PH 7 and 15% isopropanol.

The DNA was eluted into polycarbonate centrifuge tubes using 0.8ml of buffer QF which is 1.25M Nacl, 50 mM Tris-HCl at pH 8.5 and 15% isopropanol.

The eluted DNA was precipitated out using 0.7volumes of isopropanol at room temperature and it was microcentrifuged at 10,000xg for 30 minutes.

The pelleted DNA was washed with 7ml of 70% ethanol and centrifuged at 10000rpm for 10 minutes.

The pellet was air dried and resuspended in sterile deionised water.

2.2) MEGA PREP

The bacterial cells were pelleted by centrifuging the overnight culture of LB at 6000xg for 15 minutes at 4 degree Celsius and the supernatant liquid was removed.

The bacterial pellet was resuspended in 50ml of buffer P1 which is a combination of 50mM Tris Hcl Ph 8,10mM EDTA and 10µg/ml RNAase A .Lyse blue reagent was also added to the buffer P1.

To the above solution 50ml of buffer P2 which is a combination of200mM sodium hydroxide, 1%SDS in water was added.The solution turns blue due to the presence of Lyse blue reagent.

50ml of buffer P3 which is 3.0M potassium acetate at Ph 5.5 was added to the above mixture and mixed thoroughly and incubated on ice and a precipitate of genomic DNA, cell debris and protein is obtained .The blue colour disappears completely.

Then the above suspension is centrifuged at 20,000xg at 4 degree Celsius for 30 minutes and the plasmid DNA containing supernatant liquid is removed.

The above supernatant liquid is again centrifuged at 4 degrees for 30 minutes at 20,000xg,and the supernatant liquid is obtained.

The qiagen tip 2500 is equilibrated using buffer QBT which is 750 mM Nacl,50mM MOPS at PH 7, 15% isopropanol and 0.15% of triton-100 and the column was allowed to empty.

The supernatant in the 6th step was applied to the qiagen tip and was allowed to enter the resin column.

The qiagen tip was washed with 200ml of buffer QC which is 1.0 M NACL,50mM MOPS at PH 7 and 15% isopropanol.

The DNA was eluted into polycarbonate centrifuge tubes using 35ml of buffer QF which is 1.25M Nacl, 50 mM Tris-HCl at pH 8.5 and 15% isopropanol.

The eluted DNA was precipitated out using 24.5ml of isopropanol at room temperature and it was centrifuged at 15,000xg for 30 minutes at 4 degree celcius.

The pelleted DNA was washed with 7ml of 70% ethanol and centrifuged at 15000xg for 10 minutes at 4 degree celcius.

The pellet was air dried and resuspended in sterile deionised water.

2.3) POLYMERASE CHAIN REACTION (PCR)

MATERIALS REQUIRED:

Forward primer

Reverse primer

Template

GreenTaq

Nuclease free water

METHOD

GREEN TAQ(µl)

OLIGO-110(µl)

OLIGO-113(µl)

OLIGO-111(µl)

OLIGO-112(µl)

TEMPLATE(µl)

NUCLEASE FREE WATER(µl)

1st tube

50

1.25

1.25

0

0

1

46.5

2nd tube

50

0

0

1.25

1.25

1

46.5

In the first tube 50µl of green taq,1.25 µl of oligo 110,1.25 µl of oligo 113, 1 µl of template and it was made upto 100µl with 46.5 µl of water.

In the second tube50 µl of green taq,1.25 µl of oligo 110,1.25 µl of oligo 113, 1 µl of template and it was made upto 100µl with 46.5 µl of water.

The samples were placed in the pcr machine and the lid was closed.

The program was set for 2 kb and the annealing temperature was set at 45 degree celcius and the pcr machine was allowed to run.

2.4) AGAROSE GEL ELECTROPHORESIS

Materials Used

Electrophoresis chamber

Gel casting trays

Electrophoresis buffer which is Tris acetate EDTA

Loading buffer which was 1% glycerol

Ethidium Bromide

Transilluminator

METHOD

1% agarose gel was prepared with 0.5µg/ml of ethidium bromide at 60 degreee celcius and it was poured into casting trays.

Then the sample combs were placed closer to one end of the tray and it was allowed to solidify.

The combs were then taken out without disturbing the wells formed.

Then the tray was placed on the electrophoresis chamber with the well close to the negative electrode because DNA are negatively charged.

Then Tris Borate EDTA buffer was added to the electrophoresis chamber until it covers the top of the gel.

The 6µl of the sample mixed with 2 µl of the loading dye were loaded into the wells without puncturing the wells.

At either side of the sample wells ladders were also loaded which is composed of chromatographically purified fifteen DNA fragments in base pairs.

Then the lid was closed and the cords were plugged and the power was switched on and the voltage was set to 120V.

It was allowed to electrophorese for 40 minutes.

Then the casting tray was placed in the transilluminator and the bands were observed under the U.V. and the imaging was done.

2.5) TRANSFECTION

Internalisation

vero cells were incubated in the medium with 2ml TxR-BSA at a concentration of 10mg per ml and 2ml of rab5-GFP at a concentration of 2mg per ml. Then cells were washed in 3times in sterile PBS, then and the cells were incubated for 4 hours.

Fixation

The cells are fixed on coverslips before the Microscopy.

Three cover slips were taken in three separate dishes and the cover slips were washed with PBS three times.Then The cell culture was placed on the cover slips and washed three times with pbs and incubated for 16 hours before fixation.

METHANOL FIXATION FOR LAMP

100% methanol was poured onto the cells in dish where the cover plates are placed and the dish was left on the bench for 5 minutes, then wash repeatedly with PBS.

ALDEHYDE FIXATION

2% Para formaldehyde solution preparation.

1g paraformaldehyde , 5ml pbs made upto 10 times with water,1ml of 5N NaoH and 1ml of 5N Hcl was mixed together to prepare paraformaldehyde solution for aldehyde fixation.

Aldehyde fixation for EEA1 and Transferrin.

The cells were rinsed cells with PBS at room temperature. 2 % paraformaldehyde in PBS was poured into the dishes for aldehyde fixation and keptfor 15 min at room temperature.The plates were washed 3times with PBS before permeablisation.The cells were permeabilized with 0.1% Triton X-100 in PBS for 5 minutes.Then the dishes were rinsed with PBS.

2.6) MICROSCOPYThe fixed cells were imaged using a microscope connected to a camera(Nikon) and it was read into the computer screen.

3) RESULTS

The plasmids were synthesisised using the Megaprep and 1.9g of the plasmid was obtained.The yield was obtained using a U.V. spectrophotometer.After the gel agarose electrophoresis straight bands were obtained which showed the plasmids were linear and the bands were corresponding to the molecular weight of the plasmids .The reference was the ladder on either side of the sample wells.

PCR was done with the plasmids and a proper rab5 gfp sequence was obtained.The results osf the sequencing data showed the sequence as that of the rab5-gfp.

Ladder tube 2 tube 1 ladder

SEQUENCE DATA:

51Rab5a-111: Oligo 111

51Rab5a-113: Oligo 113

51Rab5a-110: Oligo 110

51Rab5a-112: Oligo 112

OLIGO

SEQUENCE

Oligo 110

ccactacctgagcacccagtc

Oligo 111

gactgggtgctcaggtagtgg

Oligo 112

aacttgtttattgcagcttat

Oligo 113

: ataagctgcaataaacaagtt

Rab5 contig.tiff

Sequencing was done and the sequencing data was analysed and the sequence was read.The sequence was read and the GFP-Rab5 sequence was read in the sequence.

After the sequencing results were obtained the plasmids along with bsa texas red were transfected into the vero cells and the fluorescent microscopy was done .and the results obtained showed that in the early sorting endosomes the gfp rab5 and the EEA1 co localises, where as in the late endosomes it never happened and the green and the red fluorescence showed separately in those images.In Fig:2 it clearly shows the red colour of BSA Texas red and the green colour of GFP-Rab5 separately.In Fig: 3 it shows that the GFP-Rab5 is co localised with Texas-Red in a single vesicle.

Fig:2

Fig:3

Discussions

Gfp-Rab5 led to understanding the nature of vesicle formation in the cells and about early endosomes.In the plasmids synthesised the sequence data obtained showed that it was the rab5 gfp plasmid sequence.Then in the transfection results enabled to understand and identify that that the rab5 and EEA1 colocalised with the early sorting endosomes.In the late endosomes the flouresence were seen separately and it distinguished the early endosomes from the late endosomes.

Through this we were able to monitor the fate of these polymers in the cell and was able to track them in different compartments using fluorescent probes.The imaging of both live and fixed cells is possible using rab5-gfp.Since the compartments are different in their characteristics inside the cells and the results showed that EEA1 only corresponds to early endosomes, LAMP to late endosomes and Transferin to lysosomes. The challenge of delivery of the molecules especially the macromolecular drugs can be accomplished by the intramolecular trafficking.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.