The Loss Of Stemness Properties Biology Essay


1 Department of Radiotherapy, 3 Oncology of Chongqing cancer Institute, Chongqing 400011, China. 2 Department of Gastroenterology, The second affiliated hospital of Chongqing medical university, Chongqing 400010, China. 4School of Bioengineering, Chongqing University, Chongqing 400044, China.

Correspondence to: Professor YONG-ZHONG WU, Department of Radiotherapy, Chongqing cancer Institute, NO. 181, Han-Yu Road, Chongqing 400010, P.R. China. E-mail:

* The two authors contributed equally to this paper

Keyword: gastric cancer, stem cell, short hairpin RNA, Regenerating islet-derived family member 4, chemoradioresistance

Running title: WEI ZHOU, MAO SUN et al. RegIV silencing of CSCs in MKN45 cells


Regenerating islet-derived family member 4 (RegIV) is overexpressed in various tumour such as pancreas and gastric cancers (GCs). However, the role it played in gastric cancer stem cells (GCSCs) still unknown. The present study tests the hypothesis that silencing of Reg IV by shRNA in GC cells may cause the loss of its stemness properties, which means the inhibition of growth, proliferation and increase sensitivity to chemoradiation-induced cell death. Human poorly differentiated gastric cancer cells MKN45 were propagated as mammospheres in stem cell culture conditions. Then, mammospheres were identified as CSCs using generally acknowledged CSC markers CD44. A panel of 21-nucleotide shRNA were designed to target Reg IV gene expression. Several shRNA constructs were identified that led to significant reductions in RegIV mRNA expression. Furthermore, the stemness properties of control mammospheres and RegIV Knock down mammospheres were compared by tumorigenicity assay in vivo and plate colony formation assay in vitro. Finally, we evaluated the treatment response in both mammospheres which underwent chemoradiation. Conclusion: The knockdown expression of RegIV by shRNA deprived CSCs of its stemness properties and increases the effectiveness of cell killing following Chemoradiation. Inhibition of endogenous Reg IV expression may be a new therapeutic strategy for human gastric cancers.


Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Gastric cancer (GC) is a world health burden, ranging as the second cause of cancer death worldwide, despite improved prognosis as a result of early diagnosis (1). Only a few progresses have been made in the treatment strategies for GC during the past 30 years (2). Accumulating evidence in recent years strongly indicate the existence of cancer stem cells (CSCs) in solid tumors of wide variety of organs, including GC (3). This situation prompts us to search for new effective treatment methods for GC.

RegIV, a member of the regenerating gene family, is involved in digestive tract malignancies, including the pancreas, colorectum and stomach, as well as in benign diseases such as ulcerative colitis (4-6). RegIV overexpression in tumor cells has been associated with cell growth, survival, adhesion, and resistance to apoptosis even can predict the intrinsic chemo-resistance in advanced GC (7). Recently, a few research groups interested in its possible applications for cancer biomarkers and acquired remarkable achievements. RegIV was found in the serum of patients with GC which could predict the peritoneal dissemination in gastric adenocarcinoma (8-10). However, the relationship between CSCs and RegIV in human GC has not been reported yet. All in all, a better understanding of the relationship between CSC and RegIV may help to improve early diagnosis and potentially identify a new molecular therapeutic target for GC.

Materials and Methods

Cells and animals. Human poorly differentiated GC cell line MKN45 was from the cell bank of the Chinese Academy of Sciences. Cells were cultured in log growth phase in Dulbecco's modified Eagle medium (DMEM), supplemented with 10% heat-inactivated fetal calf serum and 0.01 mg/mL bovine insulin at 37 °C in a humidified atmosphere 5% CO2.Thirty mice used were 4-week-old Balb/cA nu/nu females. They were from Shanghai Experimental Animal Centre of Chinese Academy of Science (Shanghai, China) and maintained in plastic cages (five mice /cage) in a room with constant temperature (22 ± 1°C) with a dark-light cycle (12h/12h). Animal experiments were performed in accordance with the ethics code by the Ethical Committee of Chongqing medical university.

Cancer stem cell culture. To obtain cancer stem cells and to propagate them as mammospheres, cells floating in the supernatant of 4-day-old cultures were collected by centrifugation for 5 minutes at 500g, washed in Hank's buffered salt solution, and resuspended in phenol red-free DMEM supplemented with 0.4% bovine serum albumin (BSA, Sigma), 5 ug/mL bovine insulin, 20ng/mL basic fibroblast growth factor (bFGF, Sigma), 10ng/mL epidermal growth factor (EGF, Sigma) at a density of 1000 cells/mL. Growth factors were added to the mammosphere cultures every 3 days.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Flow Cytometry to measure CD44, CD24 and CD133 Expression. CD44, CD24 and CD133 expression were analyzed in cells derived from monolayer cultures or in 15-day-old mammospheres following incubation in trypsin-EDTA dissociation with a Pasteur pipette and passage through a 40-um sieve. At least 105 cells were pelleted by centrifugation at 500g for 5 minutes at 4 °C, resuspended in 10 µL of monoclonal mouse antihuman CD44-phytoervthrin (PE) antibody, monoclonal mouse antihuman CD133-phytoervthrin (PE) antibody and a monoclonal mouse antihuman CD133-phytoervthrin (PE) antibody, respectively, and incubated for 20 minutes at 4 °C.

RegIV knockdown by Lentivirus-Mediated Short Hairpin RNA. RegIV knockdown in mammospheres was performed by infection with a lentivirus that expresses human RegIV-specific short hairpin RNA (shRNA) and contains a green fluorescent protein gene under a separate promoter for tracking the transfection efficiency. Briefly, the lentivirus vector plasmid encoding human RegIV-specific shRNA (Sigma-Aldrich) was transfected with capsule and packaging plasmids using Superfect (Qiagen, Valencia, CA) into HEK293T cells, and after 48 hours, supernatant was collected and used as infection solution without enrichment. Among the three predesigned target sequences for human RegIV (GeneBank accession: NM_001159352), 5'- TGGATTGTTTTTCTCAAATAATA -3', 5' ATGGATTGTTTTTCTCAAATAAT-3', and 5'- TGGATGGATTGTTTTTCTCAAAT -3'. The following sequence was used in this experiment: 5'- TGGATTGTTTTTCTCAAATAATA -3'. The scramble shRNA obtained from Addgene (Cambridge, MA) was used as control. Forty-eight hours after viral infection, RegIV knockdown was confirmed by Real time-PCR analysis.

In vivo xenograft assay. Cells were derived from RegIV KD or control mammospheres by incubation in trypsin-EDTA dissociation with a Pasteur pipette. Adjust the concentration of the cell suspension to be inoculated to 5Ã-104/mL in PBS. Inject 0.2 mL of the cell suspension subcutaneously in the right hind limb of the mice, respectively. Fifteen mice were injected in each group. Mice were observed daily and inspected for tumour growth each week for 8 weeks.

Plate clone formation assays. RegIV KD and control mammospheres were incubated in trypsin-EDTA dissociation with a Pasteur pipette. Seeded at 1000 cells in each 6-well plate and cultured in DMEM medium containing 10% FCS for about 14 days. When most cell clones reached more than 50 cells, fixed with 4% paraformaldehyde for 15 min, and stained with 1% crystal violet at room temperature. Each experiment was repeated for three times.

Drug sensitivity and Apoptosis analysis. The RegIV KD and control mammospheres were used to determine the cell growth inhibition ability of 5-Fu and Cisplatin. Cells were re-inoculated into 96-well plates (5,000) cells per well) in triplicated on the day prior to testing. Each well was supplied medium containing 10% FCS, 20 ng/mL bFGF, and 10 ng/mL EGF; In the next day, cells were incubated along with a chemotherapy reagent 100 µM 5-fluorouracil (5-Fu) and 100 µM of Cisplatin (both sigma-Aldrich) or no drug as control. After 2 days, 20 µl of MTT solution (5 mg/mL in PBS) was added to each well, and cells were incubated for 4 hours at 37 °C. Then 50 µL DMSO was added to each well and plates were incubated at 37 °C overnight. The optical absorbance at wavelength 450 nm was measured for the supernatant of each well using the plate reader.

To determine the extent of cellular apoptosis following drug treatments, both cells were plated into 6-well plates (5Ã-105 cells/well). After 24 h, the media was removed and fresh media containing 100 μmol of 5-Fu or Cisplatin were added. The cells were then stained with Annexin-V and Propidium iodide (PI). Annexin V-FITC Apoptosis Detection Kit used in this experiment was purchased from Beyotime (Beijing, china). The protocol supplied by the manufacture was strictly followed. Briefly, cells were trypsinized, washed twice with cold PBS and pelleted by centrifugation at 800 rpm for 5 min. The pellets were resuspended in 100 μl of 1X Annexin binding buffer and 5 μl fluorescein isothiocyanate (FITC)-Annexin-V. Propidium iodide (100 μg/ml) was added to each 100 μl of cell suspension. The stained cells were immediately analyzed by flow cytometry.

Radioresistance Experiments. In radioresistance experiment, the RegIV knock down and control mammospheres were inoculated into six-well plates (100 cells per well) in triplicate on the day prior to testing. To mimic the monolayer cultures, cells were plated in DMEM media containing 10% FCS and irradiated with 2 and 4 Gy of radiation, respectively, using Varian Clinac iX linear accelerator (VARIAN, USA). The single cell gel electrophoresis (SCGE)/ comet assay was used for detecting DNA single strand breaks in both groups two hours after the irradiation. CASP image analysis system was adopted for the quantitation of SCGE data by measuring the length of DNA migration (Tail length). Generally, 30 randomly selected cells are analyzed per slide. The performance of the comet assay was mainly based on the method described by Olive (11).

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Real-time PCR. Total RNA was isolated using the TRIzol reagent according to the manufacturer's instructions. Quantitative real-time RT-PCR was performed using the Maxima SYBR Green/ROX qPCR Master Mix (2X) (both Fermentas, Canada). Reactions were carried out using iCycler (Bio-Rad, USA) and the results were evaluated with the iCycler real-time detection system software. Relative quantitation of target gene expression was evaluated by the comparative Ct method.

Statistical Methods. All data are represented as means and differences of the means with 95% confidence intervals (CIs). P values of 0.05 or less, calculated using a paired two-sided Student's t test were considered to indicate statistically significant differences.


Growth factors induced MKN45 suspension cells to propagate as mammospheres. Non-CSCs failed to proliferate under the growth factors rich, low attachment and serum-free culture conditions. Only CSCs could clonally proliferate to form suspension mammospheres which was considered to be one of the most important characteristic of CSCs (12). Mammospheres formed in significant numbers in cells with growth factor treatment for 15 days, while a few MKN45 cells formed sphere bodies without growth factor treatment. Interestingly, those sphere bodies could be gradually detached into monolayer culture cells in 2 days after RegIV Knock down, which indicated the loss of "stemness" capacity (Figure 1).

Surface marker expression profile in mammospheres of MKN45. To further verify whether those mammospheres were cancer stem cells, we analysed the expression patterns of cell surface markers for cancer stem cells by using FACS for the mammospheres of human gastric cancer cell line MKN45. Based on previous published reports regarding CSCs in solid tumours, the following markers were studied: CD44, CD24, and CD133. The results of the FACS studies for CD44, CD24 and CD133 are shown in Figure 2. Mammospheres of MKN45 showed a high level of expression of CD44 with up to 87% of cells expressing CD44, while showed as little as 5% expression of CD24 and CD133, which is consistent with other verified reports (13). So, we interpreted this data by the fact that those mammospheres are suitable candidates for CSCs of MKN45 cells.

Validation of lentiviral shRNA constructs for RegIV knockdown. Lentiviral constructs shRNA-RegIV (Nos. 1-3) and controls (scrambled sequence) were first examined in submerged MKN45 mammosphere cultures. The vector also contains a human EF1-α promoter diriving the GFP marker gene for tracking transduced cells (Figure 3). Therefore, cells that receive silencing constructs can be detected by fluorescence of GFP at the single cell level. We confirmed the detection of GFP in the mammospheres of MKN45 in 2 days of post-transfection under laser confocal microscopy (Figure 4A).The Real-time quantitative PCR analysis revealed a strong reduction of RegIV at the mRNA level for designed shRNA (No.1) when compared to the scrambled control. The other two shRNA-RegIV constructs (Nos.2-3) showed no differences in mRNA expression levels when compared to the scrambled control (Figure 4B). These data indicate that shRNA-RegIV1 plasmid is the most effective construct in knock-down RegIV expression. Hence, the stable transfected clone was used for further studies.

RegIV knockdown reduced tumorigenicity and clone formation of MKN45 mammospheres in vivo and in vitro. With serum stimulation, cells from control mammospheres showed higher clone formation ability than RegIV KD cells and significantly increased rate of clone efficiency (Figure 5A).

To verify RegIV KD in MKN45 CSCs may have a significant role in supporting tumorigenicity in vivo, we injected these RegIV KD cells subcutaneously in nude mice. We observed that RegIV-KD cells produced fewer (4/15) and much smaller tumours than those from control mammospheres (13/15) (Figure 5B). The tumour diameter was monitored every week up to 8 weeks. In the experiment, control mammospheres generated tumours of greater volume, formed measurable tumour masses in animals in the first week of post-injections (Figure 5B).

RegIV knock down enhanced chemoradiosensitivity and apoptosis in MKN45 mamospheres. The ability of chemo-reagent to inhibit the growth of RegIV-KD and control mammospheres was assessed by cell viability and apoptosis assay. It was observed that RegIV-KD mammospheres significantly decreased cell viability to 33% (5-Fu) and 44% (Cisplatin) as compared to control mammospheres. Similar results were obtained in Annexin V cell death assay wherein RegIV-KD results in a significantly higher cell death as compared to control (Figure 6A).

To assess the radiosensitivity of the RegIV-KD cells, the comet assay was performed on the irradiated tumour cells. RegIV-KD cells showed a higher percentage of DNA in the tail when compared to the control, suggesting that the DNA damage was higher in radiosensitive RegIV knock-down MKN45 cells (Figure 6B).


Although the biological function of RegIV is poorly understood, it has been reported that RegIV may function as a growth and antiapoptotic factor in colon and gastric cancers (6, 14, 15). In our literature review, we learned that RegIV expression in different cell types was associated with regeneration, survival and migration (6, 16, 17). RegIV is systematically overexpressed in colon, pancreas and gastric cancers and in disease that predispose to colon cancer such as ulcerative colitis (5, 18, 19). However, the role RegIV played in CSCs has not been fully elucidated. We demonstrated for the first time that the knockdown expression of RegIV deprived CSCs of its "stemness" properties by a series of experiments, including chemoradioresistance in vitro and xenograft assay in vivo. Other studies had confirmed RegIV expression in gastric, colorectal, and pancreatic carcinoma, and that RegIV has a potential role in diagnosing digestive tract neuroendocrine tumours (20-22). Gastric cancer stem cells with overexpressing RegIV protein grew more rapidly and were more resistant to 5-Fu and Cisplatin treatment. Besides, previous studies had shown that RegIV overexpression was thought to be chemoresistant in GC patients (23, 24). Furthermore, RegIV was reported recently to be an important target gene of Gli1(25). Thus, we concluded that the RegIV plays a very important role for maintaining the stemness properties of CSCs and SHH-GLi1-RegIV signal cascade may be involved in.

Cancer stem cells use multiple signaling pathways to control self-renewal and differentiation (26, 27). Misregulation of these pathways may lead to the loss of CSC properties. Numerous signaling pathways have been implicated in this process including Wnt, Notch, EGF, PTEN, SHH (28-32). Furthermore, frequent misregulation of crucial embryonic signaling pathways (i.e. Hedgehog signaling pathway) contribute to the process of gastric carcinogenesis (33). The Hedgehog signal is transmitted by transmembrane protein smoothened (SMO) through binding to a second receptor Patched (Ptc) in extracellular and terminated in intracellular Hedgehog signal transduction via Hedgehog transcription factors that are Glioblastoma factors GLi1, GLi2 and GLi3.

In conclusion, this is the first report that demonstrates RegIV could manipulate the stemness properties of CSCs in GC cells. Our work may contribute to the body of research on gastric carcinogenesis and provide insight into the possible network of signalling pathways through the GLI1/RegIV axis. It may also help to provide a new insight into treatment strategy for GC. Further studies are required to determine whether the biological behaviour of GC Patients may be achieved by regulating RegIV.


Special gratitude to Jian-Ye Xu for his technical assistance and valuable discussion with the experiments.