The HIV Uses An RNA Interference Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Since its discovery in 1981, the human immunodeficiency virus (HIV) has infected and killed more than 25 million people. In 2008 alone, it was estimated by the Joint United Nations Programme on HIV/AIDs (UNAIDS; www.unaids.org) that 2.7 million new infections were reported world wide, resulting in a total of 31 to 36 million people living with HIV. The majority of HIV cases (71%) are reported in Sub Saharan Africa, where the disease not only devastates an already weak economy and drastically increases poverty, but also creates an alarming number of orphans. Although several therapies have been developed to slow down the infection, there is no known cure for HIV.

The HIV is a lentivirus that infects human immune cells such as CD4+ T cells, macrophages, and dendritic cells and disables the immune response required to defend the body against foreign pathogens. The HIV will transfer two single stranded RNA molecules into the host cell accompanied by several enzymes necessary for viral replication such as reverse transcriptase and integrase. The viral reverse transcriptase will then produce a single stranded cDNA molecule from the viral RNA transcript. Using the cDNA strand as a template, a viral DNA dependant DNA polymerase produces double stranded viral DNA molecules that are then incorporated into the host's cells genome by integrase. Once in the genome, viral DNA can produce numerous copies of viral RNA. After immune cells become infected, the cell is unable to induce apoptosis and the viral genome self replicates. Ultimately the infected cell is destroyed but not before releasing numerous viruses into the vasculature and lymph nodes; feeding the viral cycle. As CD4+T cells begin to decrease in number, cell-mediated immunity is lost and acquired immune deficiency syndrome (AIDS) persists, where the body becomes increasingly susceptible to opportunistic infections such as herpes, mycobacterium avium complex, and pneumonia.

The HIV uses an RNA interference (RNAi) pathway to disrupt human immune cell apoptosis following the viral infection. RNAi by microRNAs (miRNAs) involves production of a double stranded RNA (dsRNA) molecule containing a hairpin within the mammalian cell nucleus. The hairpin is processed by two enzymes, Drosha and DGCR8 before the dsRNA molecule (pre-microRNA) is exported out of the nucleus (Yeung et al., 2007). In the cytoplasm, the hairpin is bound by Dicer; an enzyme that cleaves the dsRNA into smaller double stranded fragments that are approximately 22 nucleotides in length. These fragments are then loaded into the RNA-inducing silencing complex (RISC) where one strand is degraded while the other is typically used to bind semi-complimentary mRNA molecules to disrupt gene expression (Yeung et al., 2007).

The HIV viral genome consists of seven structural landmarks and contains 9 genes which encode 19 proteins. One important landmark within the viral genome, the HIV trans-activation response (TAR) element, is known to be required for the activation of the viral promoter and for replication of the viral genome (Mi et al., 2005). In addition to being a transcriptional activator, TAR RNA can form a hairpin that results in production of a pre-microRNA that produces mature microRNAs (miRNAs) from both strands of the TAR stem-loop. Previous studies have shown that when cells are infected with HIV, Dicer will bind viral TAR miRNAs (Klase et al., 2007).

The HIV miRNAs derived from the TAR RNA hairpin can regulate the apoptosis genes excision repair cross complimenting-group 1 (ERCC1) and intermediate early response 3 (IER3) located within the infected cell genome (Yang, 2009). Typically, when immune cells are infected, ERCC1 and IER3 are expressed to induce cell death or apoptosis. However, when immune cells are infected with HIV, production of the TAR miRNAs block apoptotic gene translation and the cell is unable to induce cell death before viral replication (Yang, 2009).

Disabling TAR miRNAs would allow HIV infected cells to express ERCC1 and IER3 and induce apoptosis prior to viral genome replication; ultimately disrupting the viral cycle (Krutzfeldt et al., 2005). Recent work has verified that a novel class of chemically engineered oligonucleotides referred to as 'antagomirs', are efficient and specific silencers of endogenous miRNAs. Antagomirs are cholesterol-conjugated single-stranded RNA molecules that are 21 to 23 nucleotides in length and are engineered to be complimentary to the mature target miRNAs (Krutzfeldt et al., 2005). As a direct result of silencing endogenous miRNAs, miRNA-repressed genes can be expressed.

Our objective is to verify the sequence of TAR (Klase et al., 2007) and design antagomirs that will show specificity for the TAR miRNAs that are produced in HIV infected cells. Upon transfection of the exogenous TAR miRNA antagomirs into cultured HIV infected human CD4+T cells (Klase et al., 2007), gene expression analysis will be performed to measure expression levels of TAR miRNAs as well as the apoptosis genes ERCC1 and IER3. We hypothesize that transfection of exogenous antagomirs (Krutzfeldt et al., 2005), specific for TAR miRNAs, into human HIV infected cells will effectively silence the HIV miRNA and stimulate expression of ERCC1 and IER3 genes; consequently inducing apoptosis in immune cells infected with HIV. By utilizing antagomirs to allow HIV infected cells to undergo apoptosis prior to viral replication; we may effectively break the viral cycle and disrupt HIV infection.

In a global report released in 2008, it was estimated that roughly 2 million people died of HIV including 280,000 children under the age of 15 (UNAIDS; www.unaids.org). The use of antagomirs as therapeutic targets for HIV infection is particularly alluring for those interested in an innovative and effective treatment for such an alarming and disheartening disease. If antagomirs are the answer, the next challenge for researcher is to develop an appropriate method to deliver antagomirs, specifically targeting TAR miRNAs, to patients diagnosed with HIV. Only when these challenges are met, will we have an opportunity to arrest the most destructive human virus in history; the human immuno-deficiency virus (HIV).

Materials and Methods

Cloning and sequencing of the TAR miRNA

cMagi cells will be infected with HIVIIIB and microRNA enriched libraries will be prepared using suitable adaptors. RT-PCR amplification with an excess of the reverse primer will be used to produce a cDNA library. Biotinylated capture oligonucleotides for the TAR-5p and TAR-3p (5' and 3' arm) were then hybridized to the library in buffer. Hybridized pairs will be captured and the single-stranded miRNA will be eluted. Recovered single-stranded cDNA molecules will be amplified by PCR, ligated into a vector and transformed into bacteria. Positive colonies will identified and sequenced.

Synthesis of antagomirs

RNAs will be synthesized using commercially available 5'-O-(4,4'-dimethoxytrityl)-2'-O-methyl-3'-O-(2-cyanoethyl-N,N-diisopropyl) RNA phosphoramidite monomers of 6-N-benzoyladenosine (ABz), 4-N-benzoylcytidine (CBz), 2-N-isobutyrylguanosine (GiBu), and uridine (U), according to standard solid phase oligonucleotide synthesis protocols. For antagomirs. i.e., cholesterol conjugated RNAs, the synthesis will start from a controlled-pore glass solid support carrying a cholesterol- hydroxyprolinol linker. Antagomirs with phosphorothioate backbone at a given position will be achieved by oxidation of phosphite with phenylacetyl disulfide (PADS) during oligonucleotide synthesis. After cleavage and de-protection, antagomirs will be purified by reverse-phase high-performance liquid chromatography, while the unconjugated RNA oligonucleotides will purified by anion-exchange high-performance liquid chromatography. Purified oligonucleotides will be characterized by ES mass spectrometry and capillary gel electrophoresis. The single-stranded RNAs and modified RNA analogues used in this study will consist of a 21-23-nucleotide length with modifications as specified:

anti-TAR, 5′-GGGUCUCUCUGGUUAGACCA-3′;

anti-TARpS, 5′- gsgsgucucucugguuagsascscsa-3′;

anti-TARfS, 5′- gsgsgsuscsuscsuscsusgsgsususasgsascscsa-3′;

antagomir-TAR, 5′- gs gsgucucucugguuagascscsas-Chol-3′;

The lower case letters represent 2′-OMe-modified nucleotides; subscript 's' represents a phosphorothioate linkage; 'Chol' represents cholesterol linked through a hydroxyprolinol linkage; anti-TARpS is anti-miR-TAR RNA with partial phosphorothioate backbone and anti-122fS is anti-miR-TAR RNA with full phosphorothioate backbone.

Assay of luciferase activity

Human full-length 3′ UTR sequences for ERCC1 and IER3 will be PCR-amplified with specific primers designed with Xba1 sites and will be cloned into the unique Xba1 site in the luciferase expression vector pTL-Luc (Figure 1). Human CD4+ T cells will be cultured in 24-well plates and each well will be transfected with the respective pTL-Luc 3′ UTR contructs, pGL3 control vector and double-stranded siRNA. Cells will be harvested and assayed 24-30 h after transfection. Results will be normalized to the control and will be expressed relative to the average value of the control miRNA.

Construction of DKO-hu HSC mice with human CD34+/− cells from human cord blood

Human CD34+ cells will be isolated from human cord blood. Cord blood CD34+ cells will be injected intrahepatically into each newborn DKO mouse. Human leukocytes (CD45+) will be analyzed for CD3, CD4, CD8, CD45RO, CD19, CCR5(2D7), and CXCR4(12G5).

HIV-1 infection and pathogenesis in DKO-hu HSC mice

At least 15 weeks after CD34 hematopoietic stem progenitor cell transfer, DKO-hu HSC mice with stable human leukocyte reconstitution will be intravenously infected with HIV-1 (mock supernatant or heat-inactivated HIV-1 stocks will be used as negative controls). Plasma viral load will be monitored, and blood CD4+ T cells will be measured. Central and peripheral lymphoid organs will be harvested to investigate HIV replication and pathogenesis in the thymus, spleen, and lymph nodes.

RNA extraction/RT-PCR

Total RNA from lymphoid organs will be isolated by lysis and homogenization in TriZOL (Invitrogen), followed by chloroform/isopropanol extraction, ethanol precipitation, and resuspension in buffer. RNA samples will be prepared and cDNA will be generated. Primers used for PCR will be: ERCC1F: GGCGACGTAATTCCCGACTA, ERCC1R: AGTTCTTCCCCAGGCTCTGC, IER3F: TCTACCCTCGAGTGGTGAGTATC, IER3R: ACTAAGGGGAGACAAAACAGGAG

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.