The change of FXR expression in liver of obesity rat models

Published:

Running title:

The change of FXR expression in liver of obesity rat models

Objective: AS the core components of metabolism syndrome, obesity and insulin resistance are closely in relation with type 2 diabetes and associated complications, such as dyslipidemia and dysglycemia. Owing to its regulatory actions in lipid and glucose homeostasis, FXR is involved in pathogenesis of multiple metabolic disorders. The role of FXR in obesity rat models has not been evaluated specifically. Methods: A total of 100 Wistar male rats were randomly assigned to either standard diet (SD, n=20) or high fat diet (HFD, n=80) for 6 weeks. Oral Glucose Tolerance Tests (OGTT) was administrated and the extent of insulin resistance was assessed at the end of six weeks. The rat models were anatomyed in the end. The expression of liver FXR was tested by techniques including reverse transcription polymerase chain reaction and immunohistochemistry. Results: Obesity rats in HFD group showed elevated body weight, AUC (glucose), fasting insulin, total cholesterol , Low-density lipoproteins as well as serum bile acid levels compared with control rats in SD group (p<0.05). In addition, a nearly 50% reduction in the expression of FXR was seen in rats liver of HFD group. Conclusions: In obesity rats, elevated serum bile acid levels was associated with the reduction in the expression of FXR. The regulation of FXR in lipid metabolism, insulin sensitivity, energy homeostasis needs further investigation in the obesity model. In short, we may benefit from the regulation of bile acids and FXR in the stage of obesity with the aim of preventing more metabolism disorders.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Key Words FXR; obesity; insulin resistance

  1. Introduction

Obesity is typical of an excess of adipose tissue mass, which leads to the trend of metabolic disorders, including dyslipidemia, dysglycemia, promoting the development of type 2 diabetes mellitus. Dysregulation of various metabolic pathways in tissues such as adipose tissue and liver was closely associated with these metabolic complications. However, the involved mechanisms were not only restricted to the above ones [1].

The farnesoid X receptor (FXR) is a key regulator of bile acid (BA) metabolism. Bile acids have been shown to regulate not only their own synthesis and enterohepatic recirculation, but also triglyceride, cholesterol, energy and glucose homeostasis [2]. Studies on the metabolic function of FXR in T2D patients and animal models were limited and not fully consistent [3].The role of FXR in the adaptation to obesity and its metabolic complications has not yet been evaluated. To resolve this issue, we investigated the change of FXR expression in liver of obesity rats in this paper.

  1. RESEARCH DESIGN AND METHODS
    1. Animals

Wistar male rats (8 weeks old, 200-250 g) were purchased from Shandong University Laboratory Animal Research Center. The animals were housed in standard polypropylene cages (three rats/cage) and maintained under controlled room temperature (22±2 ℃) and humidity (55±5%) with 12:12 h light and dark cycle. All rats were provided with standard diet and water ad libitum, prior to the dietary manipulation. The experiment was conducted under the protocol approved by the Shandong University. All procedures involving rats were conducted in strict compliance with relevant laws, the Animal Welfare Act, Public Health Services Policy, and guidelines established by the Institutional Animal Care and Use Committee of the university.

2.2 Experimental design

After the 1 week of dietary accommodation, 100 Wistar male rats were randomly assigned to either SD (n=20) or HFD (n=80). After six weeks of different diets feeding, rats were anesthetized with ether. Oral glucose tolerance tests (OGTTs) were administrated; blood samples were collected from the retro-orbital plexus at 0, 30, 60, and 120 minutes for the measurement of glucose and insulin; HOMA-IR, area under curve (AUC) of glucose and insulin were calculated. Then, the fasting blood sample was collected in heparinized tubes and then centrifuged and plasma was stored at -80°C for the biochemical analysis of TC, HDL-C, LDL-C, TG and TBA.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

AUC (glucose) = 0.5×BG(0min)+BG(30min)+1.5×BG(60min)+BG(120min)

AUC (insulin) = 0.5×INS(0min)+INS(30min)+1.5×INS(60min)+INS(120min)

2.3 Materials

Insulin ELISA test kits (Art. No.10-1250-01) were purchased from Mercodia; glucose, total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) , triglyceride (TG) and total bile acid (TBA) test kits were detected using automatic biochemistry analyzer. Glucometer and glucose testing strips were productions of Roche (Switzerland). Standard diet (SD) consists of 6% fat, 64% carbohydrate, 23% protein and high-fat diet (HFD) consists of 25% fat, 48% carbohydrate, and 20% protein. HiFi-MMLV cDNA first chain synthesis kit and 2×Taq Master Mix purchased from Kang for century biological technology co., LTD (Beijing). Anti-FXR antibody (Santa Cruz biotech firm, NO.H-130) and two footwork Immunohistochemical detection kit (Beijing Chinese fir jinqiao biological technology co., LTD, NO. PV-9000) were used in the immunohistochemistry.

2.4 Liver histology

For histological examination, portions of the right and left liver lobes from each animal were fixed in 10% formaline, embedded in paraffin, and a section of 7 microns thickness were made. Immunohistochemistry with the anti-FXR antibody (Santa Cruz, NO.H-130) and two footwork Immunohistochemical detection kit was performed.

2.5 RT-PCR

Total RNA was isolated from tissues by guanidinium thiocyanate/phenol/chloroform extraction [4] and reverse transcribed into cDNA (HiFi-MMLV cDNA first chain synthesis kit, Kang for century biological technology co., LTD).Then with the primers, cDNA,and 2×Taq Master Mix were used for the gene amplification with the PCR instrument PE5700(ABI). Electrophoresis was performed for detection of the result of gene amplification. Primers used for reverse transcription polymerase chain reaction (RT-PCR) were rat β-actin: CTGAGAGGGAAATCGTGCGT and CGGACTCATCGTACTCCTGCTTG; rat FXR: GACCACGAAGACCAGATTGCT and TCTCCACTGCCTCTCTATCCTT.

2.6 Statistical analysis

All data are expressed as mean ±standard error (SE). The comparisons of groups were made with a one-way ANOVA with post-hoc Tukey's test.

3. Results

3.1 Features of HFD-fed insulin resistant rats

Compared with SD group rats, HFD rats showed disturbed metabolism to a certain extent, indicated by elevated body weight, AUC (glucose), fasting insulin, as well as elevated TC and LDL-C levels (p<0.05). Meanwhile, a decline (without a significant difference) in AUC (insulin)/AUC (glucose) also exhibited in HFD group rats. With respect to serum bile acid, we can see HFD rats displayed significantly elevated serum bile acid levels compared with SD group.Table1, Figure 1 and 2 show the Biochemical parameters, OGTT-insulin curve and AUC (insulin) respectively.

3.2 General character of rats in different groups

The general status of rats in SD group was good; there were no obvious changes in water intake and urine volume during the experiment; the color and luster of hair were fine; food intake and body weight increased persistently and steadily. Compared with SD group, there is a significant increase in food intake and body weight of rats in HFD group. Besides, the color and luster of hair were slightly worse after the HFD diet.

3.3 FXR expression in the liver

In comparison with the SD group, a nearly 50% reduction in the expression of FXR was seen in rats of HFD group. Figure 3A and 3B indicate the expression of liver FXR in SD and HFD rats by RT-PCR and Immunohistochemistry (IHC) respectively. The relative expression (RT-PCR) of FXR was obtained by comparing SD with HFD rats. * P < 0.01 SD rat versus HFD rat.

""

* P<0.05 VS SD group ** P<0.01 VS SD group

Figure 1 OGTT-Insulin curve

""

Figure 2 AUC (Insulin)

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

"""""""" "" ""

""HFD group left-SD group, right-HFD group

SD group Arrows indicate the positive particles

Figure 3A FXR (RT-PCR) Figure 3B FXR (Immunohistochemistry)

Table 1 Biochemical parameters

Parameters

SD group

HFD group

Body Weight(g)

367.13±20.41

430.92±31.49 $

FBG(mmol/L)

4.29±0.77

5.48±0.95 $$

TG(mmol/L)

0.63±0.10

0.97±0.51

TC(mmol/L)

1.52±0.13

2.08±0.16 $

HDLC(mmol/L)

1.19±0.14

1.26±0.12

LDLC(mmol/L)

0.20±0.07

0.51±0.07 $

TBA(umol/L)

8.31±1.24

11.78±1.36 $

FINS(mIU/L)

9.38±1.86

13.84±3.20 $

AUC(glucose)

24.18±3.45

47.92±6.93 $$

AUC(insulin)

54.32±6.06

58.39±9.10

AUC(insulin)/AUC

(glucose)

2.25±0.03

1.22±0.01

$ P<0.05 VS SD group; $$ P<0.01 VS SD group

Table 2 OGTT- insulin (m IU/ L)

""Time

Group

0 min

30 min

60 min

120 min

AUC

SD group

9.38±1.86

24.86±3.67

10.53±1.47

8.97±0.89

54.32±6.06

HFD group

13.84±3.20 *

14.32±2.18 **

17.12±3.36 *

11.47±2.95

58.39±9.10

* P<0.05 VS SD group ** P<0.01 VS SD group

4. Discussion

In this study, we have demonstrated that obesity rats in HFD group showed elevated body weight, AUC (glucose), fasting insulin, TC, LDL-C as well as serum bile acid levels. In addition, rats in HFD group presented a nearly 50% reduction in the expression of FXR compared with SD group.

Increasing evidences show that a high-fat diet results in increased body weight gain and a progressively increased hyperinsulinemia, indicating progressive worsening of insulin resistance, which is similar to the feature of the early stage of type 2 diabetes [5,6]. According to Table 1, we can see many metabolic parameters, such as body weight, fasting insulin, AUC (glucose), TC, LDL-C, were significantly elevated in HFD-fed rats; meanwhile, AUC (insulin)/AUC (glucose) were declined. The above results demonstrated that we have successfully established insulin resistance rat models.

Bile acids are the end product of cholesterol breakdown and represent the predominant pathway for eliminating excess cholesterol from the human body [7]. Currently, mounting evidence indicates that bile acids are regulatory molecules. By activating specific nuclear receptors (farnesoid X receptor, preganane X receptor, and vitamin D receptor), G protein coupled receptor TGR5 (TGR5), and cell signaling pathways, bile acids are involved in the regulation of glucose, fatty acid, lipoprotein synthesis, metabolism, transport, and energy metabolism [8]. Recent observations indicate that bile acid homeostasis is altered in type 2 diabetes, and that bile acid sequestrants were useful in the management of type 2 diabetes mellitus [9].

From the result in this study, we can see the changes of serum bile acids and Liver FXR levels in obesity rat groups. The farnesoid X receptor (FXR) is a key regulator of bile acid (BA) metabolism. By promoting BA efflux from the liver, inhibiting hepatic BA synthesis and intestinal absorption, FXR controls the enterohepatic cycling of BA[10].This study demonstrated the above viewpoint in the other side, that in obesity rats elevated serum bile acid levels was associated with the reduction in the expression of FXR. In consideration of the relationship of obesity and type 2 diabetes mellitus and cardiovascular disease, people may benefit from the regulation of bile acids and FXR for preventing metabolism dysfunction in the stage of obesity. The regulation of FXR in lipid metabolism, insulin sensitivity, energy homeostasis needs to be further investigated.

Acknowledge

This work was supported by National Natural Science Foundation of China Grants 81170771, 81101183 and 81270175, Science and Technology Development Programme of Shandong Grants 2012GSF11803, International Cooperation Programme of Jinan City Grants 201011008.

Conflict of Interest

There are no conflicts of interest.

1