The dynamic environment



Cells live in a dynamic environment. The cells have to constantly overcome osmotic stresses such as extreme pH-values, nutrient limitation and extreme heat. In order to survive, cells can respond in different ways to the osmotic stresses by changing for example the metabolic pathways, such as alter their metabolic processes to grow under conditions when nutrient becomes a limiting factor[1].

Osmtic stress adaptation of yeast is conserved among eukaryotes, with differences between species. S. cerevisiae is easy to grow and to transfect with DNA. Preparing gene knockouts is relatively simple. In previous study, Overexpression screening for drug resistance and microarray analysis were used to investigate the growth adaptation of S. cerevisiae on a medium containing small molecules. In overexpression screening assay, S. cerevisiae was transformed with a DNA liberary to identify cellular target of small molecules. In this approach, an array of S. cerevisiae was constructed with each a unique yeast gene and each S. cerevisiae were examined for growth defects after adding the small molecules. These S. cerevisiae were used to identify the genes which are responsible for growth on a medium with small molecules (resistance). For this yeast strain, microarray analysis was used for identification of genes expression. In this approach, gene expression patterns of control samples were compared with gene expression patterns of S. cerevisiae exposed to the small molecules[2]. Microarray results shows that some genes are up regulated and some genes are down regulated. One of the gene that is down regulated is called Zinc regulated transcription factor, Zap1. Zap1 protein is 880 amino acids long. Zap1 DNA binding domain has five zinc fingers at c-terminus. Zap1 acts as a transcription activator and ZAP1 expression is increased when zinc levels is decreased. Zap1 has two domains, AD1 and AD2. When zinc levels are high in the cell, zinc binds to the AD1 and AD2 and this binding inhibits the transcription activation by Zap1. Some studies show that several genes are directly regulated by ZAP1. Expression of ZRT1, ZRT2 and FET4 is regulated by Zap1 in zinc limited cells[3].

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

The aim of the experiment is to evaluate the adaptation of S. cerevisiae (BY4741 strain) which has overexpressed ZAP1, on a medium that contains paracitamol. To evaluate the adaptation of S. cerevisiae, a wilde type strain was transformed with YEplac195 construct containing ZAP1. Generation of polymerase chain reaction (PCR) product containing ZAP1 was generated by using primers with ASP781 restriction site (5'GGTAC^C 3'). The PCR products were ligated to the YEplace195 which was also restricted with ASP718. E.coli (DH5a strain) was used to produce more copies of this construct. After miniprep the construct containing the insert was transformed in to S. cerevisiae strain and growth on medium containing Uracil. If S. cerevisiae has picked up the YEplac195 construct, the S. cerevisiae will grow on medium containing uracil.


YEplace195 was used to construct the ZAP1 gene. YEplac195 contains URA3 which encodes for orotidine 5-phosphate decarboxylase, this is involved in uracil biosynthesis, 2-µm origin of replication is a DNA sequence which is responsible for replication initiation. Multi-cloning site where the restriction sites are and the ampicilin resentence gene was used to control the transformation efficiency and selection. The multi-cloning site of YEplace195 was digested with ASP718.

The primers were designed with ASP718 site. The ZAP1 was amplified with PCR from yeast genomic DNA using forward primer (5'AAAGGTACCCGTATCCACCAGGCATAGC 3') and reverse primer (AAAGGTACCAGTGCTGATAAAGATGCAG 3'). After amplification, the 3500 bp PCR products were digested with ASP718 to produce restriction enzyme site for the ligation into the YEplace195. The ligation was carried out with T4 ligase and after ligation the constructs were transformed in to the E.coli and plated on a LB medium containing Ampicilin. After O/N incubation at 37 C, the growth single colony was incubated O/N at 37 C in 3 ml LB medium containing ampicilin for the miniprep. After miniprep, the concentrated DNA was collected. The presence and the orientation of ZAP1 in the Yeplace195 were verified by a digestion reaction with BamHI restriction enzyme (Fig. 1). After digestion with BamHI, the size of forward cloned PCR product in the YEplace 195 is 1300 base pares which is shown in fig. 1 (lane 1,2) and the size of reverse cloned PCR product is 2500 base pares which is also shown in fig.1 (lane 3). Both construct containing forward and reverse orientation of ZAP1 is transformed to the S. cerevisiae and growth on medium containing uracil. S. cerevisiae containing forward orientation and S. cerevisiae containing reverse orientation of ZAP1, they were able to grow on a medium containing uracil.


Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

To understand the function of Zinc regulated transcription factor Zap1, the over expression of Zap1 is an option, because in Zap1 overexpressed cells, yeast activates entire genes which is regulated by Zap1 [4]. In zinc limited cells, Zap1 is overexpressed and induces the expression of ZRT1, ZRT2 and FET4. ZRT1 and ZRT2 both encodes for Zn+ transporters which pumps the zinc from external environment in to the cytoplasm and FET4 encodes for Fe2+, Cu+ and Zn+ transporter[3].

Microarray data shows that SNQ2 is up-regulated and ZAP1 is down-regulated after S. cerevisiae was growth on LB medium containing Diclofinac. SQY2 is a multidrug transporter and Zap1 is also involved in up-regulation of transporter proteins. Therefore both play a role in nutrient transport in the cell. This could mean that the cells use nutrient transporters to remove the toxicity of the drug from the cells. The Goal of this experiment was to investigate the roll of Zap1 protein in resistance against toxicity of Paracitamol. For this, ZAP1 was cloned in to the multicopy vector YEplac195. The presence of this construct in S. cerevisiae (BY4741 strain) leads to over production of Zap1 protein. Results of this experiment show that the S. cerevisiae is able to take up the construct with forward orientation and reverse orientation of ZAP1 and due to this the cells can grow on medium containing uracil. But with these results we can not conclude about the roll of Zap1 in presence of paracitamol.

To determine the role of Zap1 in presence of Paracitamol, the S. cerevisiae containing construct have to incubate in a medium that contains Paracitamol. If the cells have overcome the toxicity of Paracitamol and they reached an acceptable OD, the next step will be performing a microarray assay to determine the gene expression pattern under the influence of Paracitamol. If Zap1 has a central role in resistance against Paracitamol, then there will be up and down-regulation of nutrient transporter genes by Zap1. Using these results, we can distinguish genes and analyzing them further by using Over-expression screening for drug resistance and microarray analysis to determine the connections between different genes involved in drug resistance.


  1. Chang-Yi Wu et. al., Differential control of Zap1-regulated genes in response to zinc deficiency in Saccharomyces cerevisiae, BMC Genomics 2008, 9:370
  2. Nikë Bharucha and Anuj Kumar, Yeast Genomics and Drug Target Identification, Combinatorial Chemistry & High Throughput Screening, 2007, 10, 618-634
  3. David J. Eide, Homeostatic and AdaptiveResponses to Zinc Deficiency in Saccharomyces cerevisiae, The Journal of Biological Chemistry vol. 284, NO. 28, pp. 18565-18569, July 10, 2009
  4. Thomas J. Lyons et. al., Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast, PNAS u July 5, 2000 u vol. 97 u no. 14 u 7957-7962