Study of gyrA gene polymorphism in Salmonella Enteritidis using RFLP technique

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Study of gyrA gene polymorphism in Salmonella Enteritidis using RFLP technique

INTRODUCTION

Salmonella spp. is important factor well-known foodborne bacterial infection, that causes a significant number of maladies and deaths worldwide. For example, in the United States Salmonella was estimated to represent the leading cause of foodborne illnesses due to bacterial pathogens in 2006 year (CDC, 2007a) (2009 Emergence).Salmonella (genus Salmonella), group of rod-shaped, gram-negative, facultatively anaerobic bacteria in the family Enterobacteriaceae. Their principal habitat is the intestinal tract of humans and other animals. Some species exist in animals without causing disease symptoms; others can result in any of a wide range of mild to serious infections termed salmonellosis in humans. Most human infections with Salmonella result from the ingestion of contaminated food or water That around 9.4 million foodborne infection and 1351 deaths occur in the American each year (Scallan et al., 2011) (2014 samples). From May until November 2010, approximately 1939 infections were reported in the United States that causes S. Enteritidis (CDC, 2010) (2014 samples).Salmonella includes two species, S. enterica and S. bongori (Kauffmann, 1965b; CDC, 2003; Foley et al., 2007). S. enterica is divided into six subspecies (4, 19) that includes S. enterica subsp enterica, S. enterica subsp salamae, S. enterica subsp arizonae, S. enterica subsp diarizonae, S. enterica subsp houtenaeand S. enterica subsp Indica (4, 19) (2000 COMMENTARY).; So far, over 2500 serotypes of Salmonella enterica have been detected from all over the world, and almost all are ab S. enterica is divided into six subspecies (4, 19) that cause infections in humans, birds and animals (2009 Emergence). Salmonellosis one of the most important is an infection in the all worldwide. And as a common disease in humans and animals are found. This diseases transmissible through food is one of the most problems of society. Annual in America Salmonella causes several hundreds of deaths. This bacterium in two sources of meat and eggs poultry has plentiful found (Abdullah et al., 2010; Bichler et al., 1994) (2014 samples). Also one of the most problems important in domestic animals in the world that transmission this bacterial infection to humans and animals can cause economic damage. Mostly this infection by Salmonella enteritidis species that have found all worldwide. From important Salmonella serovars is S. Enteritidis, which is an important cause of human infection with symptoms typically including fever, vomiting, diarrhea and abdominal cramps 12e72 h after ingestion of the bacterium (CDC, 2010) (2014 samples). In most bacterial species the acquired fluoroquinolone resistance was attributed to mutations in the genes encoding DNA gyrase that Included gyrA and gyrB (10, 24–26) (2002 Topoisomerase). In this bacterial species from DNA gyrase as original target that gyrA can mediate resistance to the nonfluorinated quinolone nalidixic acid and reduced susceptibility to fluoroquinolones (10) (2004 Resistance). In this work we aimed to investigate the Studies of gyrA gene polymorphism in Salmonella interetidids Isolated from egg shell in Chaharmahal VA Bakhtiar, Iran using Restriction fragment length polymorphism (RFLP) technique.

MATERIALS AND METHODS

Samples collection

Between 2012 until 2013 two hundred (n=200) egg shells samples were collected from seven Aviculture in Chaharmahal Va Bakhtiari province (Shahrekord, Lordaghan, Farsan, Alikhoh, Khoy, Ardal and Kiyar) and transferred to Biotechnology Research Center, Islamic Azad University.

Culture salmonella

samples were aseptically trimmed to 25 g and homogenised for 1 min in 225 ml aliquots of buffered peptone water (BPW) (Becton Dickinson, MD, USA) using a stomacher (Seward Medical, London, UK). Following overnight incubation at 378C, 0.1 ml aliquots were inoculated in duplicate into tubes containing 10 ml Rappaport–Vassiliadis (RV) broth (Becton Dickinson) and incubated for 48 h at 428Caspreviously ecommended (Anonymous, 1989; Cloak et al., 1999). Brilliant green agar (BGA) plates (Becton Dickinson) were inoculated from each of the RV broths after 24 and 48 h and incubated for 18–24 h at 378C as previously described (De Zutter et al., 1991; De Smedt et al., 1991). Suspect colonies were confirmed biochemically by inoculating into lysine decarboxylase broth (Oxoid, Basingstoke, UK), urea broth (Oxoid) and triple sugar iron agar slopes (Oxoid) with final confirmation carried out using specific SalmonellaO and H agglutinating antisera (Murex Diagnostics, Kent, UK; Behring, Germany) (2002 contamination).

Extraction DNA

Bacterial DNA was extracted from colonies of bacteria using DNPTM Kit (CinnaGen, Iran) according to the manufacturer’s instructions. The quality of extracted DNA was quantified by spectrophotometric measurement at a wavelength of 260 nm according to the method described by Sambrook and Russell (2001).

PCR-RFLP assay

Specific primers for GyrA of S. enteritidis were used for gene amplification. gyrA-F: 5'- TACCGTCATAGTTATCCACGA -3' and reverse primer gyrA-R: 5'- GTACTTTACGCCATGAACGT -3', therefore a fragment of 313 base pairs was expected. PCR test was performed in final volume of 25 μl PCR reactions containing 100 ng of template DNA, 1.5 mM MgCl2, 200μM dNTPS, 2 mM of each primers and one unit of Taq DNA polymerase enzyme. Thermal PCR conditions consisted of initial 5 min at 95°C and then 32 cycles of denaturing temperature at 94°C for 1 min, annealing temperature at 56°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 5 min.

For PCR product was digested with HinfI and BshNI (BanI) which was used for the determination of GyrA gene. Gene fragments was subjected to digestion by restriction enzymes in a total volume of 20 µl (10 µl reaction solution, 2 µl enzyme buffers, 0.2 µl enzymes and 7.8 µl distilled water) and placed in the incubator at 37° C for 5 h.

The restriction products were analyzed by 2% agarose gel electrophoresis. Electrode buffer was TBE (Tris-base 10.8 g, 89 mM, boric acid 5.5 g, 2 mM EDTA (pH 8.0) 4 ml of 0.5 MEDTA (pH 8.0), with all components joined in enough H2O and stired to dissolve). Gels were stained with ethidium bromide, aliquots of 10 μl of PCR products were applied to the gel. Constant voltage of 80 V for 30 min was used for products separation. After electrophoresis, generated bands were screened and digitally photographed under UV light.

Statistical Analysis

Data were analyzed by the chi-square test using the SPSS 17 (SPSS Inc. Chicago, IL, USA) software. P values <0.05 were considered significant.

Result

The results of QRDR in the gyrA gene showed that there were two HinfI cutting sites. After HinfI digestion, there were three fragments sized 111, 102, and 99 bp, respectively. Mutation at the first base of Ser-83 (TCC→TTC or TCC →TAC) caused the loss of HinfI cutting sites. The sizes of HinfI-digested PCR product of QRDR of the S. Enteric serovar Choleraesuis isolate with Ser-83-to-Phe or Ser-83-to-Tyr mutation were 201 and 111 bp. The Asp-to-Gly (GAC→GGC) mutation at codon 87 created a BanI cutting site. The sizes of BanI- digested PCR product of QRDR of the S. Enteric serovar Choleraesuis isolate with Asp-87-to-Gly mutation were 195 and 118 bp (Figure4).

Discussion

Salmonella serotype Enteritidis (SE) is one of the important infections on host and one of the most common serotypes of Salmonella bacteria reported in big city and little city that known most source of SE is egg in poultry (2011 Dynamics). Salmonellosis caused by at least 150 Salmonella species with Salmonella Typhimurium and Salmonella Enteritidis being the most common species in the United States ( 2011pathogen). S. Enteritidis has the authority to survive into these cells (Henderson et al., 1999; Stabler et al., 1994; Okamura et al., 2005). In a recent study in Iran , Salmonella spp. were detected in 4 (0.89%) of 446 study sites, and the authors noted that Salmonella spp. in this show low rate are not detected in water samples by culture methods (2013 Salmonella). Another study producedin the Iran reported a prevalence of Salmonella Enteritidis lower 20% in milk samples with used PCR and Real time PCR methods. They reported that clinically healthy cattle are the main sources of Salmonella Enteritidis infection in Iran (2013 assessment). RFLP is one of the important assays for detect and know mutations in molecular biology. Analysis of RFLP variation in genomes was a vital tool for detect mutation and polymorphism in all host. In present study we show Study of gyrA gene polymorphism in Salmonella serotype Enteritidis using RFLP technique and in this study, RFLP technique was used to investigate Salmonella serotype Enteritidis poultry in Iran. Out of 130 poultry shell egg samples, 14 (10.76 %) were found PCR positive for Salmonella serotype Enteritidis that HinfI cutting sites causes Mutation at the first base of Ser-83 (TCC→TTC or TCC →TAC) and BanI cutting sites causes mutation in codon 87 (Asp-87-to-Asn, GAC →AAC). In human infection cases enteric fever, gastro enteritis and there are infection other (2011 pathogen). Alonso et al (2004) show gyrA mutations associated with fluoroquinolone Resistance in campylobacter coli by RFLP-PCR test (2004 Campylobacter coli). In a study, Muthu et al. show detection of gyrA gene mutation from 41 clinical isolates of Salmonella paratyphi A. They used from PCR-RFLP method to identify and detection of ser83 mutation inthe gyrA gene in clinical samples tertiary care hospitals. The results showed that high rate of gyrA gene mutation in samples (2014 ANALYSIS). gyrA gene mutation has been reported from many countries that including the USA, China, United Kingdom, Taiwan, Iran, South Africa, Danmark, Korea and other region (2005 Korea- 2013 South Africa- 2011 iran- 2011 East China- 2004 Taiwan- 2004 Japanese- 1998 United Kingdom- 1995 usa).

Our results indicate that, although prevalence of SE was 10.76 % in poultry, the gyrA gene mutation in salmonella has a relatively high role in Iranian poultry.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.