Structure And Function Relationship Processing Alpha Glucosidase I Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Attachment of the carbohydrate chain to protein is one of the most significant posttranslational modifications of eukaryotic proteins, especially secreted and membrane proteins, which lead to the formation of a host of protein-bound oligosaccharides with diverse biological functions. There are 5 distinct types of sugar-peptide bonds i.e. N- and O-glycosylated, P-mannosylated, phophoglycation and glypiation (Spiro 2002). The N- glycosidic bond between the glycan chain and Asn residue in the consensus motif (Asn-X-Ser/Thr) of a protein is most predominant among all the types of sugar-amino acid/peptide bonds (Spiro, 1973). There are more than 16 enzymes involved in various steps of glycosylation that occur in endoplasmic reticulum (ER), golgi apparatus, cytosol and nucleus. One of such enzymes is processing alpha glucosidase-I (glu-I), an ER inner membrane bound protein. α-Glucosidase I commences trimming of N-glycans by cleaving the α-(1,2) linked glucose unit from the newly assembled Glc3Man9GlcNAc2 after en bloc transfer to the nascent sequence (Asn-X-Thr/Ser) of proteins (Grinna & Robbins 1980).

It has become evident that the modifications that take place in the ER reflect a spectrum of functions related to glycoprotein folding, quality control, sorting, degradation, and secretion. In the ER, the Glu-I along with alpha-glucosidase-II plays a major role in protein quality control system. Hence any impairment in this pathway leads to drastic effects on function of the secreted glycoprotein as well as the physiology of the organism. The lack of glu-I in humans leads to CDG-IIb [CDG - congenital disorders of glycosylation] (De Praeter et al. 2000). Despite its critical role in the synthesis of glycoproteins, many aspects of structure, catalytic mechanism of glu-I are still unknown.

In Saccharomyces cerevisiae, CWH41 gene encodes glucosidase-I

Baker's yeast, Saccharomyces cerevisiae, a frequently used eukaryotic model organism, only possesses two kinds of protein glycosylation, N-glycosylation of asparagine residues and O-mannosylation of threonine and serine residues (Lehle et al. 2006). These two types of glycosylation are greatly conserved from yeast to human. Moreover, congenital disorders of glycosylation are associated with these two types of glycosylation. Hence, in the current study, baker's yeast will be used as the model organism to study the catalytic mechanism and structure-function relationship of glu-I.

In S.cerevisiae, glu-I is encoded by CWH41 gene (Romero et al. 1997). It catalyses the removal of distal α-1,2 glucose residues from Glc3Man9GlcNAc2 (G3M9GNA2) chain co-translationally attached to Asn residue in the consensus motif Asn-X-Ser/Thr of a nascent protein (Kornfeld and Kornfeld 1985). It belongs to glycosyl hydrolases family 63. This enzyme was first purified by Bause et al. (1986) and reported to be a 95 kDa glycoprotein with optimum pH 6.8. Glu-I along with glucosidase-II

Previous studies

Based on previous studies Bause et al. 1986 , it is evident that the glu-I is a 94 kDa protein that is bound to inner membrane of ER. The deletion of the N-terminal amino acid residues (24 residues) resulted in soluble activity (Faridmoayer). The proteolytic cleavage of glu-I resulted in various truncated forms among which a smallest 37kDa fragment showed highest catalytic activity, 1.9 times higher than that of the whole protein.

There is less information available regarding the amino acid residues that play a role in catalysis and substrate binding of glu-I. In the previous studies, site directed mutagenesis of glu-I was carried out (Faridmoayer and Scaman 2007). When E613 and D617 residues were replaced by alanine, glu-I completely lost its function. This loss of function was either due to loss of active conformation or the loss of catalytic residues.

HYPOTHESES

Processing α-glucosidase I or mannosyl-oligosaccharide glucosidase (EC 3.2.1.106) is a type-II membrane bound glycoprotein with 833 amino acids. The deletion of transmembrane region (1-24 amino acids at N-terminus) resulted in soluble, glycosylated, functional glu-I where as deletion of N-terminal 34 amino acids lead to the nonglycosylated catalytically active protein. This truncated catalytically active 94 kDa fragment of glu-I may be expressed in any strong prokaryotic expression systems like pET in E. coli due to the absence of glycosylation, to maneuver easy purification.

In general, the hydrolysis by glycosidases occurs via two major mechanisms giving rise to either an overall retention or an inversion of configuration (Koshland 1953). The glu-I from S.cerevisiae was found to be an inverting glycosidase (Palcic). Understanding the mechanism of glu-I can help in development of mechanism based drug. The hydrolysis of glycosidic bond by glycosidases takes place through acid- base catalysis which requires two amino acids where one serves as a proton donor and the other as a nucleophile (ref). Based on previous findings on glu-I (Faridmoayer and Scaman 2007), we hypothesize that any two of the conserved carboxylic residues (D601, E613, D617, D602, D670 and E804) play a significant role in either catalysis or substrate binding since these residues lie in catalytic region. However, homology studies revealed that the carboxylic residues E613 and E804 are the potential catalytic residues.

Based on current understanding, trypsin hydrolysis of glu-I at positions Lys524 and Phe525 releases a 37 kDa fragment which is 1.9 times more active than the whole enzyme. The recombinant expression of 37kDa fragment as an individual protein in S.cerevisiae did not lead to a catalytically active protein. This may be due to the requirement of non-catalytic n-terminal domain for the active conformation/ folding. Based on these studies on glu-I, we can hypothesise that the N-terminal domain of glu-I has two significant roles i.e. assistance in acquiring active conformation/folding and regulatory function.

We hypothesize that the N-terminal fragment, due to its regulatory function, decreases the activity by stringently specific binding to its natural substrate. The 37 kDa truncated form, which is not regulated by N-terminal domain, may show relaxed specificity for sugars (basis or supporting information needed. YGJK may be an example for this but homology…..).

We also hypothesise that N-terminal domain of glu-I displays lectin-like activity which facilitates specific binding to glycan chain.

Objectives

The main obstacle in studying the structure and catalytic mechanism of glu-I is the quantity of the active protein. Purification of ER membrane bound glu-I is tedious and also yields were very low (ref). In order to get the large quantities of glu-I for further characterization studies, the over expression of glu-I will be carried out in E.coli since N-glycosylation is not important for the function of glu-I.

Generally, the mechanism of action of glycosyl hydrolases involves participation of two carboxylic residues. Based on previous findings (Faridmoayer and Scaman 2007), we hypothesize that any two of the conserved carboxylic residues (D601, E613, D617, D602, D670 and E804) play a significant role in either catalysis or substrate binding since these residues lie in catalytic region. However, homology studies revealed that the carboxylic residues E613 and E804 are the potential catalytic residues. Using site directed mutagenesis, amino acids at these positions will be replaced by their amine forms. Further mutagenesis studies will also be carried out in order to understand the catalytic mechanism.

The pH and temperature optima and the kinetic parameters (substrate specificity, km, Vmax, and Ki against inhibitors like deoxynojiromycin) of the catalytically active variants will also be carried out.

Functional expression of truncated forms of CWH41 will be carried out for further understanding of the roles of various domains.

Three dimensional structures of eukaryotic glu-I have not yet been reported although they were studied extensively. The studies to determine the 3-dimensional structure of glu-I are being carried out at a collaborator's laboratory. However, preparations will be carried out for crystallographic studies of C-terminal 37kDa fragment and mutant forms of glu-I.

E. coli expresses a protein called ygjK which is homologous to glu-I (Kurakata et al. 2008). Due to its more relaxed substrate specificity, mutagenesis studies will also be carried out on ygjK to understand the important residues involved in substrate binding and catalysis.

Experimental procedures

Microorganisms and culture media

Saccharomyces cerevisiae:

The growth of Saccharomyces cerevisiae AH22 will be carried out in yeast minimal medium supplemented with histidine (50 µg/ml) at 28°C and 300 rpm.

Escherichia coli:

The growth of E. coli DH5α and BL21 strains will be carried out in autoclaved LB medium at 37 °C and 250 rpm.

Glucosidase assay

The glu-I assay will be carried out by spectrophotometric method using synthetic trisaccharide as a substrate (Reference unpublished data). The synthetic trisaccharide, α-D-Glc-(1,2)-α-D-Glc-(1,3)-α-D-Glc-COOCH3 will be incubated with the glu-I and the released glucose will be determined by coupled enzyme assay (unpublished data). D-glucose, thus formed due to glu-I activity will be oxidized by glucose oxidase to glucuronic acid and hydrogen peroxide. The latter product will be used by peroxidase to convert colorless reduced O-dianisidine to the brown oxidized form.

Cloning and heterologous expression of glu-I and its truncated forms in E. coli

The gene encoding the glu-I, cwh41, will be amplified using following primers-

Forward primer: 5'TCCCCCGGGGAAGAATATCAAAAGTTCACGAATGA3'

Reverse primer: 5'CCGCTCGAGTTAGAAGCGTCCAAGGATGTTG3'

Expression of glu-I will be carried out in E.coli using pET 47b (+) vector. The amplified cwh41 gene will be cloned into pET 47b (+) between SmaI and XhoI restriction sites and expressed in E.coli BL21(DE3) or E.coli BL21-codonplus strain. Optimization of induction levels and temperature will be carried out for the higher production of glu-I. The recombinant protein will be expressed with 6xHis tag which facilitates easy purification.

The genetic region for truncated forms of glu-I will also be amplified using specific primers and will be cloned into pET 47b (+) vector and expressed as described above.

Fig.1 Vector map of pET47b(+) (courtesy- www.emdchemicals.com)

Site-directed mutagenesis of glu-I to identify catalytic residues

Homology studies revealed that the carboxylic residues near to C-terminus are the potential catalytic residues. Hence, to determine their role in catalysis, these carboxylic residues will be replaced with their aminated counterparts (i.e. sterically conserved residues-asparagine and glutamine).

The site-directed mutagenesis of glu-I will be carried out using Quik Change® site-directed mutagenesis kit (Agilent technologies). The mutagenic primers will be designed in order to replace E670 and E804 with their aminated counter parts. The mutant genes, thus obtained will be cloned and expressed in E. coli to study their function and conformation. If necessary, further mutations will also be carried out in order to understand the catalytic mechanism of glu-I

Biophysical and biochemical characterization of glu-I and its C-terminal 37 kDa fragment (cwh41t3p; M526 to F833)

Biophysical characterization of glu-I and its variants will be carried out using CD spectrometry. The CD spectra of glu-I and its variants will be useful in understanding secondary structure and its variations due to mutagenesis. Biochemical characterization of glu-I and its variants will be carried out to understand the substrate specificity and other kinetic parameters like km, Vmax, Kcat etc.

Co-expression studies of n- and c-terminus of glu-I

Co-expression of non catalytic N- terminal (---- to ------) and catalytic C-terminal (---- to ------) domains of glu-I will be carried out in E.coli to study their individual properties and interactions. These domains will be expressed as individual proteins with 6xHis tags. These individual domains will be purified using affinity columns (IMAC for 6xhis tag) and will be tested for interaction.

The interaction of these domains will be determined initially with his pulldown technique and then with yeast two-hybrid system.

His pull down to determine interaction between n- and c-terminal domains

The co-immunoprecipitation is commonly used to test whether two protein interact with each other. The n- and c-terminal domains will be expressed as individual proteins. The purified individual his tagged N-terminal domain will be treated with HRV3C protease and purified using IMAC affinity chromatography to remove its 6xhis tag. The N-terminal domain (without his tag) thus obtained will be incubated with his-tagged C-terminal domain which is immobilized onto Ni2+ affinity column. The bound protein will be eluted and eluted fractions will be analyzed on SDS-PAGE.

If any interaction is observed between the c-terminal and n-terminal domains, further experiments will be carried out to determine exact location or region that is responsible for interaction.

Determination of lectin activity of glu-I

N-terminal region may act as a sugar binding domain (lectin like) and regulates activity of glu-I. The lectin-like activity of glu-I will be determined by using microtiter plates that are impregnated with various glycan chains.

Structural characterization of variants of glu-I

The structure of glu-I will be determined using crystallography and X-ray diffraction methods which will be carried out at collaborator's lab. The crystals will be grown using hanging drop vapor diffusion method. The crystals thus formed will be used for diffraction and subsequent analysis for the determination of 3D structure.

Cloning and over expression of ygjk protein of E. coli and its characterization

Due to relaxed substrate specificity, ygjk protein will be a good model for studying catalytic mechanism. Hence, the over expression of ygjk will be carried out in E.coli. Site directed mutagenesis studies of ygjk will also be carried out in order to identify catalytic residues and the residues that play a role in substrate binding and specificity.

Significance

The biochemical activity of the glu-I is vital for the normal development and function of many organisms including humans (De Praeter et al. 2000). Understanding of various aspects of this enzyme will help in understanding numerous disease states that are directly or indirectly associated with its function.

Inhibitors of N-linked glycosylation pathway have been extensively tested for antiviral activity since viral membrane proteins are synthesized and modified post-translationally by host machinery. The inhibitors of glu-I reportedly inhibited the replication of many viruses, which require heavily glycosylated proteins (which strongly depend on canexin/calreticulin lectin chaperone system) for their assembly and function, including human immune deficiency virus [HIV] (Dwek et al. 2002). Understanding the structure and catalytic mechanism of glu-I will significantly help in developing mechanism- based drugs that are useful in treatment of various disease conditions. Currently many glu-I inhibitors like…. are used as drugs to treat viral infections. Mechanism-based inactivators/drugs provide same potential clinical advantages as previously observed with inhibitor based drugs. The dissociation rate for mechanism based drugs, which covalently modify their target enzyme, is very low or equals to zero whereas interaction of inhibitors with their enzyme counterparts is reversible. The mechanism-based drugs rely on chemistry of enzyme active site and highly selective to target enzyme which provide ultimate specificity for use as drugs.

Understanding of glu-I will also enhance the knowledge of N-glycosylation, which is necessary for manipulation of glycan chains or glycoengineering for heterologous production of various medically or commercially important proteins.

Conclusion

The processiong α-glucosidase-I plays a significant role in quality control of protein N-glycosylation. The current study will enhance the understanding of glu-I catalytic mechanism and structural insights. The site-directed mutagenesis of glu-I will provide more details about the amino acid residues that play a role in catalysis. The coexpression studies will bring more insight

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.