Sphagnum Geography Nature And History Biology Essay


Like conventional PCR, qPCR uses taq polymerase, a buffer containing salts, dNTPs, and primers to amplify small amounts of DNA. It differs from the conventional method in that it incorporates the use of a fluorescent signal which is monitored by a special, computerized thermocycler. The fluorescent reporters used vary depending upon the goal of the experiment. The four most common are: Molecular Beacons, Scorpions®, SYBR® Green and TaqMan®. If the goal of the experiment is to evaluate one or a few genes, probes such as TaqMan®, Molecular Beacon or Scorpions® can be used. However, because probes must be designed for a specific target sequence, evaluation can be costly (because a different probe must be designed for each targeted sequence). Experiments involving multiple genes, or laboratories with multiple researchers using qPCR analysis, may be better served with SYBR® Green as the reporter dye. The SYBR® Green binding dye is non-specific, providing a fluorescent signal in the presence of double-stranded DNA.

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Regardless of the fluorescent reporter chosen, every qPCR reaction requires properly designed primers. If SYBR® Green is the reporter dye chosen, the proper design of primers is especially critical. Since the dye intercalates into the DNA double strand it cannot distinguish between specific and non-specific PCR products or primer dimers. There are multiple free primer design tools available on the World Wide Web which can be used to design qPCR primers [6-13]. These programs can be used to produce oligonucleotides and probes, check for non-specific hybridization and assess the formation of secondary structures which might form between primers or the amplicon.

The following experiment provides a general overview of the four major fluorescent chemistries involved in qPCR, addresses the basics involved in primer design, and discuses common pitfalls encountered along the way. With an understanding of how qPCR uses fluorescent signals to quantify DNA, coupled with knowledge of primer selection criteria, the student will be walked through a step-by-step procedure for designing SYBR® Green primers using free, online software. The student will be instructed how to analyze primer dimers and secondary structure formation which can give false results and unreliable data in SYBR® Green based qPCR.

Laboratory Experiment: SYBR® Green based primer design using Primer3 software.

1.0. Background

1.1. Fluorescent chemistries of qPCR. To quantify the amount of mRNA, DNA or cDNA in a sample, the use of non-specific or sequence-specific fluorescent signals can be used in conjunction with RT-PCR. Sequence-specific detection (e.g. TaqMan®, Molecular Beacon and Scorpion) use specially designed probes which have fluorophores bound to their 5' end and quenchers bound to their 3' end (Figure 1). Fluorophores are molecules (or part of a molecule) that become excited in the presence of light and release fluorescence. The quencher is a molecule which extinguishes the fluorescence. When a qPCR reaction is ran using a specialized thermocycler (i.e, BioRad iCycler) the optical module of the thermocycler selects the most favourable wavelength of light for excitation and reflects it into the well where the PCR reaction mix is located. The fluorophore becomes excited and emits fluorescence which passes from the wells through an emission filter and intensifier. There, the thermocycler uses its optical detection system to measure and quantify the amount of fluorescent emission in each tube. For example: a TaqMan® based experiment would require a fluorogenic probe along with the sequence specific primers to be added to the PCR reaction mixture. The probe is an oligonucleotide sequence which is designed to hybridize to an internal region of the PCR product. It contains the fluorescent reporter dye (fluorophore) attached to its 5' end and a quencher moiety attached to the 3' end (Figure 1). The fluorophore and quencher are separated by the length of the probe. The distance is close enough to allow the quencher to cover the signal of the fluorophore. This prevents the detection of the fluorescent signal from the probe. During the annealing cycle the probe will anneal to its target sequence in-between the forward and reverse primer. As long as the probe is intact, the fluorescence of the reporter dye is quenched; however, when DNA polymerase extends the primer and replicates the template on which the TaqMan® probe is bound the exonuclease activity of polymerase cleaves the probe and releases the reporter molecule allowing fluorescence to occur. The process is repeated during each cycle of the PCR, increasing the level of fluorescence as additional probes are cleaved. These types of detection are ideal for detecting single nucleotide polymorphisms (SNPs) or detection of specific sequences. The probes can be labelled with different reporter dyes allowing the user to detect more than one specific sequence in a sample (this is called a multiplex qPCR).

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Non-specific detection uses fluorescent dyes like SYBR® Green I. When SYBR® Green dye is added to a PCR reaction mixture it will immediately bind to any dsDNA present and emit a fluorescent signal that is 1,000 fold greater than unbound SYBR® Green [5]. As the thermocycler rotates through its cylces (denatureannealextend), new amplicons are synthesized by taq polymerase and are immediately bound by the SYBR® Green dye present in the mix. The result is an increase in fluorescent intensity which is directly proportional to the increase in dsDNA. This type of detection system is the simplest and most economical choice for qPCR, but has its disadvantages in that it is not selective. False positives may result due to primer dimers and non-specific amplification. It is therefore critical to design primers which reduce the chance of dimerization and non-specific amplification.

The presence of artifacts can be detected by the thermocycler automatically at the end of the PCR assay. When using SYBR® Green detection, the real-time thermocycler should be programmed to run a disassociation curve (or melt curve) after the PCR cycles end. Since all PCR products of a set of primers have the same melting temperature all the amplicons should have the same melt temperature. Here's how it works: The machine is programmed to perform a disassociation curve after the PCR reaction ends. During the disassociation curve analysis the products from the PCR are melted (the points at which enough heat is applied to break all bonds between the dsDNA separating the strands). This is achieved by subjecting the PCR reaction product to a range of temperatures (e.g. from 65 ⁰C to 95 ⁰C). At the specific melting temperature of the amplicon the two strands of DNA will separate and their fluorescence will rapidly decrease, because the SYBR® Green dye is no longer bound to dsDNA. The computer's software will calculate the change in fluorescence at each temperature and plot a melting curve. The presence of a single peak represents that only the specific PCR product of the designed primers is present. The presence of other peaks indicates non-specific products or primer dimers. (The provision of melt curve analysis as discussed above is for informational purposes only, the analysis of real-time data is beyond the scope of this paper, and will not be discussed further.)

1.2. Basics of primer design. During a PCR reaction dsDNA is denatured into ssDNA (occurs during the denaturing cycle, usually set at 94 ⁰C), primers then anneal to the template (annealing cycle, temperature varies) and are extended by taq polymerase (extension cycle, normally carried out at 72 ⁰C). The success of a conventional PCR to carry out these cycles at a maximum is dependent on having a good starting template, a taq polymerase and buffer solution that are good quality and designing primers which are well-balanced between two parameters: specificity and efficiency. Specificity is important because mispriming will occur when primers are poorly designed. This leads to non-specific amplification of sequences found in the template pool. Efficiency is also important in primer design. An efficient primer pair will produce a twofold increase in amplicon for each cycle of the PCR. Most primer design software programs will be preset with default parameters for conventional PCR. This allows for the selection of primer pairs that would produce a respectable balance between specificity to the target sequence and maximum efficiency when used with a conventional PCR assay, but are not necessarily the best primers for a qPCR.

In a SYBR® Green based qPCR application, specificity is very important. To understand this, it is important to remember how SYBR® Green works. Remember that SYBR® Green dye will bind to any dsDNA present in the reaction mix, so the presence of non-specific products produces data that is invalid. The only solution is to redesign primers which do not produce secondary products. Another factor to consider is the formation of primer dimers. These are formed when poorly designed primers have the ability to self-anneal (hybridize to themselves), produce hairpins (when the oligionucleotide folds over and binds to itself), or hybridize with another primer (when the forward and reverse primer hybridize to each other). Efficiency of a qPCR should be high as well (90-100%). Factors that affect the efficiency of a qPCR include the amplicon length and primer quality. In short, the key to developing good SYBR® Green based primers is to find a pair of primers which are very specific, don't produce primer dimers, produce short amplicons and are efficient enough to produce results which are consistent and reproducible. Knowing the common parameters, which can be adjusted in most primer design software, can aid in achieving this.

2.0. Common parameters of primer design.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

2.1. Primer length. The optimal length of primers is generally accepted as 18 - 24 bp in length. Longer primers will take longer to hybridize, longer to extend and longer to remove thus produces less amplicon.

2.2. Primer melting temperature (Tm). This is the temperature at which 50% of the primer and its complement are hybridized. To optimize for qPCR find primers of minimal length which have melting temperatures (Tm) that are between 59⁰C and 68⁰C, with an optimal Tm of 63-64⁰C. Also, the Tm of the primer pair should be within 1⁰C of each other. The primers should also have a Tm which is higher than the Tm of any template secondary structures (these are found using mFOLD software, discussed later).

2.3. Annealing temperature. Optimal real-time PCR annealing temperatures are 59⁰C or 60⁰C.

2.4. Product size. An ideal amplicon should be between 80-150 bp. If multiple genes are used, (i.e. comparing the relative expression of several genes) then the size of all amplicons should be close in length. SYBR® Green detection will produce a more intense fluorescence in larger products than smaller (so keep multiple products close in length).

2.5. Mg++ concentration. The default is set to zero on most primer design software. SYBR® Green buffer mixes contain 3 to 6 mM of MgCl2.

2.6. Repeats. A repeat is a nucleotide sequence (a di-nucleotide) which is repeated (e.g. TCTCTCTCTC). These should be avoided because they promote mispriming. If unavoidable, the maximum number should be 4 di-nucleotides.

2.7. Runs. Runs are repeated nucleotides (e.g. TAAAAAGC has a 5 bp run of Adenine). Runs should also be avoided because they are prone to mispriming. The maximum run should be no more than 3-4 bp.

2.8. 3' Stability. This refers to the maximum ∆G of the 5 bases from the 3' end of the primers. (∆G is the Gibbs Free Energy, the energy required to break the bonds present at the 3' end) A higher 3' stability will improve the efficiency of the primer.

2.9. GC clamp. This refers to the maximum ∆G of the 5 bases from the 5' end of the primers. Often called a GC clamp, the 5' stability refers to how stable the 5' end is due to the amount of Gs or Cs present at the 5' end of the primer. Having 1 to 2 GC clamps are ideal as it allows the primer to bind strongly to the template strand, making it more specific, however, avoid more than 2 GC clamps.

3.0. Step-by-step example of primer design using Primer3 software.

One of the most commonly used primer design software programs is Primer3 [7] which was designed, and is maintained, by the Whitehead Institute for Biomedical Research. Primer3 can be used to design PCR primers, sequencing primers, and hybridization probes. It has many different input parameters which can be controlled to define characteristics that allow the software to design primers suitable for each goal. Since the software does not come with an online manual describing how to use it, it can be confusing to a novice. This section gives a step-by-step example of how to design primers using Primer3 and explains the functions of the most commonly used parameters. It also provides information on how to use other tools to check primer integrity.

Step 1: Obtain sequence in FASTA format. The Populus trichocarpa (Poplar) dehydroquinate dehydratase/ shikimate dehydrogenase (DHQD4) gene used in this example is NCBI accession number XM_002314438.1.

To obtain a copy of the DHQD4 gene sequence go to the National Center for Biotechnology Information (NCBI) website: http://www.ncbi.nlm.nih.gov/guide/.

From the dropdown menu (above the search box) select "Nucleotide".

In the search box enter: XM_002314438.1. Click on "Search".

When the results appear, click on "Display Settings" located at the top of the page (under the search bar, to the left, at the top of the page), select FASTA then click "apply". The following sequence should appear:

>gi|224107416|ref|XM_002314438.1| Populus trichocarpa dehydroquinate dehydratase/ shikimate dehydrogenase (DHQD4), mRNA


(Optional) Open a Word document and copy the FASTA format sequence onto a blank sheet. This makes it easier to check the template for secondary structures later on in the experiment.

Step 2: Using Primer3. It looks intimidating, but is easy to use once you become familiar with the search parameters.

Go to the Primer3 website at: http://frodo.wi.mit.edu/primer3/

Copy and paste the DHQD4 Fasta format sequence from the Word document into the box provided on the Primer3 primer design page (see Figure 2).

Specify parameters. Primer3 software is used to design primers for all types of PCR reactions, so it has a multitude of options. (Note: Since not all of the parameters are applicable to designing qPCR primers, an asterisk (*) is placed beside the options which are most important in designing SYBR® Green based qPCR primers.)

Pick left primer, or use left primer below. If this option is left blank, the Primer3 program will chose the left primer. If; however, a left (or forward) primer sequence is already known, and the user only needs to create a right (or reverse) primer the known sequence would be entered in this box.

For the Poplar example, leave it blank.

Pick hybridization probe. A probe (e.g. TaqMan®) is not required in SYBR® Green detection, so leave this blank. When using probe based fluorescent detection, a probe would be designed along with the primer set. Checking this option allows Primer3 to provide a list of suggested probes which would work with the primer set.

For the Poplar example, leave it blank.

Pick right primer, or use right primer below. If this option is left blank, the Primer3 program will chose the right primer. If; however, a right (or reverse) primer sequence is already known, and the user only needs to create a left (or forward) primer the known sequence would be entered in this box.

For the Poplar example, leave it blank.

*Sequence Id. A name for the primer set.

For the Poplar example enter the following name: Populus trichocarpa DHQD4.

Targets-If primers need to be designed for a "specific" location in the sequence, the user can use brackets to tell Primer3 where to design primers (e.g. AA[TAGC]ACC) would tell Primer3 to design primer around the TAGC base pairs). This choice is helpful if you want to design primers for a specific sequence area.

For the Poplar example, skip this option.

Excluded regions-This option is very helpful if a certain part of the sequence needs to be avoided. For instance, if oligodT primers are used to perform reverse transcription to create cDNA the 5' end of the mRNA (if it is very long sequence) could not be represented in the cDNA as the oligodT primer may fall off before reaching it. In this case it is necessary to avoid designing primers along the 5' end and instead target the 3' end of the sequence. Also, this option is very helpful if Primer3 software gives multiple primers from the same location (that aren't satisfactory), or gives primers that create an amplicon that has a lot of secondary structures (more about that later, when we discuss mFold values). To avoid an area, enter the values as a comma separated list (e.g: 81,6 where 81 is the bp position you want Primer3 to start this command and 6 is how many bp following the nucleotide at position 81 it should avoid).

For the Poplar example, leave blank.

*Product size ranges-This is the size of your amplicon. An optimal amplicon would be ~120 bp in length. Generally amplicons 80-200 bp are acceptable, however longer amplicons give less efficient qPCR results because more SYBR® Green is incorporated.

For the Poplar example:

Erase all numbers

Enter: 80-150 100-200 (this tells Primer3 to first look for primers which will produce amplicons between 80-150 bp, then look for primers which will produce amplicons between 100-200 bp.

Number to return-This is how many primer sets Primer3 will return. This number is up to the user's discretion.

For the Poplar example, enter 10.

*Max 3' stability- This refers to the maximum ∆G of the 5 bases from the 3' end of the primers. (∆G is the Gibbs Free Energy G-the energy required to break the bonds present at the 3' end) Higher 3' stability will improve the efficiency of the primer. The higher this number is, the more stable your 3' end is. (Note: the user may need to alter this number to obtain suitable primers.) Often the balance between efficiency and specificity is made more difficult due to secondary structure formation.

For the Poplar example leave value at 9 (to return more efficient primers).

*Max repeat mispriming. Repeats (e.g. ATATATATA) can cause mispriming (the result of a primer bonding to an unintended template). Some eukaryotes (human, drosophila and mouse for instance) have repeated segments which are notorious for mispriming. Because this is common, databases (called libraries) of sequences known to cause mispriming have been created. This option allows Primer3 to avoid areas of known mispriming when designing primers. If qPCR primers are being designed for human, mouse, or fruit fly sequences, a library should be chosen first. To chose a library, check which species is being used from the drop-down window (above the sequence input box at the top of the page). Then enter the maximum value in the "Max repeat mispriming" box. This value is the maximum allowed weighted similarity of the individual (forward or reverse) primer to all known repeated nucleotides which cause mispriming. To reduce the likelihood of mispriming leave the number at 12 or increase the number. Since this experiment uses a Poplar tree sequence Primer3 will not have a mispriming library to access, so leave the value at 12. Some computer savvy users create their own code to allow Primer3 to access mispriming data bases which they've created, but this technology is above the scope of this experiment and will not be discussed.

For the Poplar example, leave the value at 12.

*Pair max repeat mispriming. This value is the maximum allowed weighted similarity of the primer pair (both forward and reverse) to all known repeated nucleotides which cause mispriming. To reduce the likelihood of mispriming leave it at 24 or increase the number.

For the Poplar example, leave the value at 24.

*Max template mispriming. Mispriming is the result of a primer binding to an unintended template resulting in amplification. This option checks individual primers for the likelihood that they will misprime to another area on the sequence provided. Template mispriming should be avoided in qPCR otherwise an amplicon mixture of the intended product and a non-specific product will be produced during amplification. Leave the value at 12 or increase the number to reduce the likelihood of mispriming. (Note: when a SYBR® Green based qPCR is ran, a no template control (NTC) should be used and the thermocycler should be programmed to generate a melt curve to detect secondary products. If additional peaks are present in the melt curve, but no amplicon is detected in the NTC, primers should be redesigned as these peaks indicate that nonspecific products are being amplified).

For the Poplar example, leave the value at 12.

*Pair max template mispriming. This option checks primer pairs for the likelihood that they will misprime on the template provided. Leave it at 24 or increase the number to reduce the likelihood of mispriming.

For the Poplar example, leave the value at 24.

General primer picking conditions.

*Primer size. Specificity can be controlled by finding a balance between the length of the primer and the annealing temperature of the PCR reaction. The optimal length of primers is generally accepted as 18-28 bp in length. If using probes (e.g. TaqMan®) in a multiplex PCR increase this length up to 35 bp. To optimize for SYBR® Green qPCR find primers of minimal length which have melting temperatures (Tm) that are between 62⁰C and 67⁰C, with an optimal Tm of 63⁰C.

For the Poplar example:

For minimum value, enter 20; for Optimum, enter 25, For Maximum, enter 28

*Primer Tm. This is the temperature at which 50% of the primer and its template complement are hybridized. Try to design primers with melting temperatures between 62⁰C and 67⁰C, with an optimal Tm of 62⁰C to 64⁰C. The Tm difference between the forward and reverse primers should be no more than 1-2⁰C.

For the Poplar example:

Minimum, enter 60, Optimum, enter 64, Maximum, enter 70

Maximum Tm Difference, enter 2

Table of thermodynamic parameters. Primer3 uses these formulas to calculate the melting temperature. The recommended value is SantaLucia1998.

For the Poplar example, set to SantaLucia1998.

Product Tm. This is the temperature at which 50% of the amplicon is ssDNA. The temperature varies depending upon the GC content of the template. Ideally a targeted area on the template would have a GC content of 50%.

For the Poplar example set optimal to 50.

Primer GC. This is the minimum and maxiumum percentage of guanine and cytosine (GC) allowed. The GC content of primers is used to determine the melting temperature of the primer, which can be used to predict the annealing temperature. The melting temperature of primers is generally 3 to 5 degrees below the annealing temperature. Ideally qPCR primers should anneal at 59-60⁰C. (Note: Most SYBR® Green master mix solutions contain specific amounts of buffer (salt) and MgCl2, which alter the primer melting temperature.)

For the Poplar example:

Minimum 35, Optimum 65, Maximum = 80.

Max self complimentary. Primers should not be self-complementary or complementary to each other. Primers which are self complementary form self-dimers or hairpin structures. Since SYBR® Green dye will interact with any double stranded DNA structure this value should be set as low as possible. Initially, set the value to 2. If Primer3 does not give primer sets, increase the value in increments of 1 and resubmit-repeat as necessary.

For the Poplar example set the value to 4.

Max 3' self-complimentary. Since polymerases add bases at the 3' end of the oligonucleotide, the 3'-ends of primers should not be complimentary to each other, as primer dimers will occur. Sometimes this cannot be avoided. However, pay particular attention to complementation between primers at 2 or more bases at the 3' ends of the primers as these tend to form primers more readily (See Figure 2.5). Set the value low (e.g. 2 or 3) and increase by increments of 1 if Primer3 does not supply a list of primers.

For the Poplar example set the value to 3.

Max #N. This is the maximum number of unknown bases which Primer3 could consider in making primers. Many genes, ESTs and cDNAs in NCBI's GeneBank contain unknown bases (N). The symbol N is given as a "place holder" when sequencing cannot determine the nucleotide (G,C,T or A) present at a certain location in the gene (or cDNA) sequence. To avoid nonspecific amplification, set this value to zero.

For the Poplar example, set to 0

Max Poly-X. The maximum number of mononucleotide repeats to allow in the primer. Long mononucleotide repeats (e.g. AAAAAAA) can promote mispriming and should be avoided. As a general rule, runs of 3 or more Cs or Gs at the 3' ends of primers should be avoided, as their presence may promote mispriming at C or C-rich sequences.

For the Poplar example set to this value to 3.

Inside Target Penalty and Outside Target penalty. Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include overlap with the target as a term in the objective function.

Default is ok.

First base index. The index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) In the WWW interface this parameter defaults to 1.

Default is fine.

GC clamp. Defines the specific numbers of Gs and Cs at the 3' end of both the left and right primers. Although you want to place Gs or Cs on the 3' ends of your primer, no more than 2-3 G's and C's should be in the last 5 bases at the 3' end of the primer.

Default of 0 is fine.

Conc. of monovalent cations. This is the millimolar concentration of salt (usually KCl) in the PCR. Leave at 50 µM, unless there is a reason you added more salt.

Default is ok.

Salt correction formula. Factors such as ∆G and Tm affect PCR performance and alter the efficiency of primer pairs. Since the Tm of a DNA sequence is dependent upon length, sequence, surrounding ionic environment, pH of the environment, etc., it is important to evaluate the thermodynamics of dissociation and association of the nucleotide strands during the PCR. Primer3 uses formulas that are based on the nearest neighbor model with salt correction. The SantaLucia 1998 salt formula is preferred by Primer3. This formula is designed to accommodate the salt correction independent of sequence, but dependent on oligonucleotide length.

For the Poplar sample, select SantaLucia 1998.

Conc. of divalent cations. This is the concentration of divalent salts (usually MgCl2+) present in the PCR mix. SYBR® Green mixes usually contain ~3 mM.

Change to 3.5 mM (to adjust for MgCl in SYBR Green Supermix)

Conc. of dNTPs. A dNTP concentration of 200 µM is usually recommended for Taq polymerase to function efficiently in a conventional PCR, where MgCl2 concentrations are 1.5 mM. Increases in dNTP concentrations can inhibit PCR reactions by trapping free Mg. Some SYBR® Green master mixes come prepared with taq, KCL, MgCl2 and dNTP already in the mix. These mixes have been laboratory tested to give maximum performance.

For the Poplar example use 0.20 mM

Annealing oligo concentration. Used to calculate the oligo melting temperature, this is the nanomolar concentration of annealing oliogos in the PCR. Since the value is dependent upon the amount of oligos and the amount of template, it is difficult to calculate this value (given cDNA is used as a template). Primer3 claims that the default (50 nM) works well for most applications.

For the Poplar example, default is ok.

Objective Function Penalty Weights for Primers.

The penalty weights section allows Primer3 users to modify the criteria that Primer3 uses to select the best sets of primers. If no penalty weights are assigned the program will use the information that the user provided to the "General Primer Picking" specifications and grade each set of primers based on those conditions. Using penalty weights the user tells Primer3, "this criteria is more important than another". Users enter penalty weights in values of 0, 1, 2, 3, etc. with 0 being less important. For instance, one might decide that primer dimers are a bigger concern than secondary amplicons. Then, the Self Complementary option could be set to 3 and Template Mispriming to 2. Some parameters have two boxes (Lt and Gt). This less than (Lt)/greater than (Gt) option allows for more flexibility in picking primers. For instance, if the user has specified under "General Primer Picking Conditions" that the primer size (Size) should be between 18 bp and 27 bp, any primers that are considered will be penalized if they are less than 18 bp, or greater than 27 bp. A user could give a penalty of 2 for primers shorter than 18 bp and a penalty of 0 for primers greater than 27 (if longer primers would be acceptable).

For the Poplar example, change the following penalty weights:

Objective Function Penalty Weights for Primers:

Tm Lt = 1 Gt = 1

Size Lt =1 Gt =1

Self Complementary = 3

3' Self Complementary = 3

#N's = 2

All other values = 0

Objective Function Penalty Weights for Primer Pairs:

Product Tm: Lt = 1; Gt =1

Tm Difference = 2

Any Complementary = 3

3' complementary = 3

Primer Penalty weight = 1

All other values = 0

Step 3: Analyzing primers. Once all of the Primer3 options have been set, press "Pick Primers". Primer3 Output will appear (Figure 3).

For the Poplar example, press "Pick Primers". The following primer set will be displayed:

Under the primer, the Poplar sequence is shown (Figure 3). The location of the primers within the sequence is indicated by >>>>>>> for the forward primer and <<<<<< for the reverse primer. The left primer starts at 282 bp, is 22 bp in length, has a melting temperature of 63.85⁰C, and a GC% content of 50%. The maximum weighted score for "any" complementation (hairpins or self-primers) is 2.0, and 3' complementary is 0.0. The amplicon (product) size is 105 bp, and the likelihood of the primer pairs forming complementation (primer dimers) is 3.0.

Scroll down the page; located underneath the sequence are additional oligonucleotides. These are alternative primers that meet the user specified requirements.

Located at the bottom of the page is a "Statistics" section. This information tells the user how many primers were considered and gives the number of primers rejected. In this case, there were 10989 left primers considered, 3592 did not meet the requirements for GC%; 2585 had a low Tm; and 858 formed complementary structures that were unsuitable. This information is useful in determining which parameters have been set too stiff. For instance, if Primer3 does not return any primers, and the statistics show that a lot of primers were rejected due to GC%, then the user could return to the Primer3 input page and change the GC% settings.

Beacon Designerâ„¢ Free Edition.

All software (commercial or freeware) will produce primers which may or may not be optimal for qPCR. It is important to analyze the primers using an additional software program like Beacon Designerâ„¢ Free Edition.

On the WWW, go to http://free.premierbiosoft.com. Click on "Beacon Designer [Free Edition]. Then click on "Launch Beacon Designerâ„¢ Free Edition". Create a user name and log in to start using.

Click the SYBR® Green option and enter the left primer sequence in the box for "Sense Primer". Enter the right primer sequence in the box for "Anti-sense Primer". (Figure 5). Click Analyze. (Useful tip: double click on the primer sequence, use ctrl+C to copy, use Ctrl+V to paste).

Beacon Designer Free Edition allows you to visualize the structures that can form between primers and primer pairs (Figure 6). Cross Dimers (∆G) are formed between primers (forward and reverse); self-dimers form between two primers of the same type (e.g. forward primer to forward primer); and hairpins form when primers fold back onto each other. As a rule of thumb, never accept primers where the 3' end has 3 bp matches, as these will tend to form primer dimers preferentially over hybridizing with the sequence (Figure 4). If self-dimers or cross dimers cannot be avoided, chose primers with the highest -∆G (meaning the least negative number-the one closest to zero). As a rule of thumb discard primers with ∆Gs more negative than -3.5 kcal/mol. If hairpins cannot be avoided, steer clear of hairpins which involve a 3' end, and use an mFold software to determine the melting temperature of the structure. It should not hold together at the annealing temperature (60⁰C).

Poplar example: Both the sense (left) and anti-sense (right) primer form cross dimers with a Gibbs free energy of -0.7 kcal/mol. Scroll down to see the structures. The first cross dimer has a 3 bp interaction on the 3' end of the antisense (right) primer. This primer could be problematic.

Using mFold software to check secondary structures.

Once the primers have been checked for secondary structures, it is important to also verify that the amplicon does not form secondary structures. This can be done using mFold software available online. Integrated DNA Technologies (IDT) has a free mFold software that works quite well. It can be found at: http://www.idtdna.com/Scitools/Applications/mFold/.

Find the location of your forward and reverse primer within the Poplar sequence (Figure 7). (Tip: To find reverse primer you will need to reverse the sequence and substitute complements, i.e. the primer AAGAGTGGGTAAAGGAGAGTGAAGA will match TCTTCACTCTCCTTTACCCACTCTT in the sequence)

Go to: http://www.idtdna.com/Scitools/Applications/mFold/. Copy the amplicon (include both forward and reverse primers) into the sequence box. Change the temperature to 60⁰C, and the magnesium concentration to 3 mM. Click "submit".

Any structures which will form are shown. All amplicon secondary structures should have a lower melting temperature (Tm) than the qPCR annealing temperature (normally 60⁰C). Notice that the Poplar amplicon forms a structure with a Tm of 62.9⁰C. This is unacceptable, evaluate other primers.

Evaluation of other primers. When evaluating primers, if any of the following occurs: (1) primer dimers or hairpins are found (which have very low -∆G values (e.g. -4.0, -5.0, -6.0, etc…), (2) 3' hairpins are found, (3) mFold results show secondary structures of the amplicon which are above the annealing temperature, it is necessary to analyze other primer sets. Primer3 software (by default) gives 5 sets of primers. If all 5 primers amplify the same section of DNA (they all start or end around the same bp in the sequence) and an mFold value was the problem, it is pointless to analyze these primers. Instead, Primer3 can be directed to exclude this area of the sequence (using the "exluded regions" parameter discussed above). If desirable primers are not found change Primer3 options and/or objective penalty weights.

For the Poplar example return to Primer3 input page (click the back arrow) and change the following:

Excluded regions: 237,6 280,6 (this tells Primer3 to avoid making primers around bp 237 and the next 6 base pairs, and 280 and the next 6 bp.

Primer picking conditions: Max Self Complementary Change 4 to 3.

Change the following objective function penalty weights: Product Tm: Lt = from 1 to 0; Gt =from 1 to 0

Click "Pick Primers". The following primer set is suggested:

Analyze the primers using Beacon Designer Free Edition. No significant primer dimers, self-dimers or hairpins exist. (Sense primer dimers are -1 or less than -1 kcal/mol and are do not form on 3' ends).

Analyze the amplicon and sense primer (it formed a hairpin) with mFold. Secondary structures have melting temperatures less than 60⁰C. These are good primers.

Step 4. Blast primers to check for specificity to non-specific sequences.