Sense Of Taste On Human Tongue Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

There are five senses of taste; sour, salt, umami, sweet and bitter. Bitter taste perception world wide have significant attention. As most studies around the world study population and their sensitivity towards bitter food. Bitter taste test is done usually by placing paper which has been impregnated with phenylthiocarbamide compound and observe the reaction. There are two possibilities; either you might taste bitterness of the compound or not. Later, scientist added medium tasters for those who can taste bitterness mildly in comparison with strong taster's sensitivity. The discovery of this compound was by mistake and observation of Fox in 1931. Further research revealed that the dominant allele for PTC taste is T. PTC gene is an inherited trait could be either two dominants alleles TT (strong tasters), or two recessive dominant alleles tt (non-tasters), or one dominant allele Tt (heterozygous medium tasters). Almost 75% of individuals are PTC tasters. This review was done to find out class of students (57 students) their PTC genotype. And discuss how being tasters or non-tasters may interfere with your food choice and subsequently your health.

Introduction

Human sense of taste consists of five types; sour, sweet, bitter, salt and umami. Of which, bitter perception plays a crucial role in protecting human body from toxic substances. It protects us from ingesting toxic substances which typically are bitter in taste.

Bitter taste receptors are located in taste cells in the surface of tongue. These receptors are encoded by G-protein-coupled receptors TAS2Rs (previously referred to as T2Rs). The data bases of genome screening identified about 30 different member of this gene family in human. Scientists believe that, due to different wide range of chemicals size, shape, and functionalities, it is destined to be identified by these receptors.

There are many evidences which found to support this assumption. Worldwide studies have shown that about 75% of individuals are sensitive to the bitterness taste of thiocarbomide (PTC), while others show tasteless. The studies have shown the variation of individual's difference in sensitivity to this compound. As a result, many studies in human taste use PTC for their research and over the years these studies revealed so much insight of human physiology.

PTC is an organic compound which either tastes bitter or basically tasteless depending on the taster genetic make-up. Arthur Fox in 1931 discovered the genetic linkage with PTC, as PTC dust was released in the air; he observed that his colleague experienced bitterness taste while he did not. After that, Arthur started to conduct experiments involved taste buds of individuals which is later became the base-work for genetics. There are few factors which might interfere with test result like consumed food or drink prior to the test, and dry mouth. PTC gene exists in seven different of allelic forms. However, two forms are designated for taster and non-taster. Studies have shown that the sensitivity to PTC is an inherited trait which is believed to be determined by a dominant gene (T). PTC exihibit simple Mendel Ian pattern of inheritance, in other words an in-between experience medium taste for bitterness. So, three taster categories have been identified; super taster, medium taster and non-taster. Super taster has two dominants allele (TT), medium taster is heterozygous with one dominant allele (Tt) and non-taster has two recessive dominants allele (tt).

As a result of continuous research on PTC gene for more than 70-years and the project of Human Genome, a lot of data about the specific gene became known. There are three single nucleotides polymorphisms (SNPs) associated with the ability to taste PTC or not they are located at nucleotide position in the 145, 785, and 886 in the gene in chromosomal 7 and surrounded by other taste receptors gene.

We aim through this review to find out our class PTC genotypes, whether we are tasters or non-tasters. And then correlate the class findings (57 students) with Europe and other population

Method:

DNA extraction

For the aim of the practical we used our cells. First, by sterile wooden splint each scraped the inner area of the cheek. Then, by sterile loop we scraped the wooden splint and placed the extract in 1.5 ml eppendorf tube containing 350ul 5% chelex suspension. After that, 4ul of proteinase K was added to chelex/cells mix and incubated for 30 minutes at 56oC.

Proteinase K is an enzyme used in bio- molecular technique to digest protein and remove contaminant. Moreover, it inhibits nuclease from degrading DNA or RNA during purification. After incubation, the tube was vortexed for about 10 seconds and centrifuged for 20 seconds at speed 13,000 rpm.

Polymerase chain reaction (PCR)

The following step was to extract template by placing the chelex/cells mix in hot water bath (98oC). This step is important for PCR (polymerase chain reaction). By heating, templates can be separated allowing for further step to amplify the required template.

After heating, tube was vortexed again for about 10 seconds and then centrifuged for 3 minutes at maximum speed. Then, supernatant was transferred to a sterile 1.5 eppendorf tube and kept on ice to preserve DNA. Then 44ul of sterile deionised water and 6ul of template DNA prepared were added to one Pharmacia PCR bead. After dissolve, the tuba was placed in thermal cycler to amplify DNA template which was for almost 2hrs.

Electrophoresis

Then, the preparation for placing the template product in electrophoresis gel started. First, after completion of thermal cycle, 5ul of loading buffer to the tube and mixed. Then, agarose gel was submerged in TBE buffer and 10ul of PCR was loaded into the well of agarose gel. It is worthy to note that the whole class was divided into groups. Each group had either three or four -depending on the used gel- individuals. For each group one set of agarose gel was used. The agarose gel had six lanes. The first lane was used as a control to check our technique and compare control bands against ours. Anyway, as mentioned earlier that each student had one lane. After filling the wells the gel was exposed to electric current to electrophoresis (for 60 minutes 70 v). after electrophoresis, the gel was stained with ethidium bromide for 10-15 minutes. Finally, the gel was destained by running tap water for 5 minutes and then it was photographed under UV trans-illumination.

Result:

The results can be one of the followings:

Non taster (tt) : Homozygous recessive with a single band in the same position with undigested, or Taster ( TT): Homozygous dominant with two bands, orTaster ( Tt ): Heterozygous with three bands.

As illustrated in figure out of the three students; two are heterozygous taster (Tt) and one is non- taster (tt).

By measuring the distance of each bands from the gel image with the known fragments size and applying it on excel, calibration curve was drawn.

Table 1:

Distance in mm

bp fragments

Log bp

3.2

23.130

1.375

3.9

9.416

0.976

4.3

6.577

0.829

4.8

4.361

0.629

6.8

2.322

0.354

7.3

1.027

0.297

By measuring the distance (in mm) of the experimental bands migrated on the gel , and apply it with below equation. An estimated size of the experimental fragment was obtained.

y = -0.0234x + 1.9249 (Where y = size in base pairs and x = distance in mm.)

Fragment 1:- Fragment 2:-

y = (-0.0234 x 34) + 1.9249 y = (-0.0234x 47) + 1.9249

y = -0.7488 + 1.9249 y = -0.9126+ 1.9249

y = anti log -1.1761 y = anti log -1.0123

y = 13,4679bp y = 6.6849 bp

Fragment 3:- Fragments 4:-

y = (-0.0234x 59) + 1.9249 y= (-0.0234x 64) + 1.9249

y= -1.3806+ 1.9249 y= -1.4976 + 1.9249

y= anti log -0.5443 y= anti log - 0.4273

y= 3,5018bp y= 2,6748 bp

Fragment 5:- Fragments 6:-

y= (-0.0234x 69) + 1.9249 y= (-0.0234x 71) + 1.9249

y= -1.6146 + 1.9249 y= -1.6614 + 19.249

y= anti log -0.3107 y= antilog -0.2635

y= 2,0431bp y= 1,8344 bp

Table 2:

The Band

Distance in mm

Log bp

Approximately Fragment size in bp

1

34

1.12

13,4679

2

47

0.82

6,6749

3

59

0.54

3,5018

4

64

0.43

2,6748

5

69

0.31

2,0431

6

71

0.26

1,8344

Table 2: shows the distances and estimated size of each fragment of cheeck cell DNA

Fnu4H1 Restriction Site

5'-GCNGC-3'

3'-CGNCG-5"

N can be any of the 4 bases

CCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGAATAGCCAATT

AGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCT

GTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGsAATTTTTG

GATGTAGTGAAGAGGCAGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTT

TCCTGCATGGACTGCTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAA

CCACAGCTACCAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGC

CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGG

TCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGCATCTGCACTGTCCTCTGTGT

TTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACTGTGCTATTCATGAATAACAATACAAGGCTC

AACTGGCAGATTAAAGATCTCAATTTATTTTATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTT

TCCTATTGTTTCTGGTTTCTTCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGT

CTATACCAGAAACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT

TTCTGCTTCTTTGTGATATCATCCTGTGTTGCCTTCATCTCTGTGCCCCTACTGATTCTGTGGCGCGACA

CAAATAGGGGTGATGGTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGGCATGCAGCCATCCTGATCTC

AGGCAATGCCAAGTTGAGGAGAGCTGTGATGACCATTCTGCTCTGGGCTCAGAGCAGCCTGAAGGTAAGA

GCCGACCACAAGGCAGATTCCCGGACACTGTGCTGAGAATGGACATGAAATGAGCTCTTCATTAATACGC

CTGTGAGTCTTCATAAATATGCC

Figure 4.The sequence of non-taster allele of the PTC gene.the forward and reverse primers are shown in green color. The position of taster and non taster are highlighted in yellow respectively. And the site of restriction enzyme is underlined between the primers

Polymorphic sites in the PTC taster and non-taster gene

phenotype

Taster

Nontaster

Codon

GTC

GCA

Amino Acid

Valine

Alanine

Nucleotide position

950

225

Table 3: illustrate the results obtained from the class (57) and the ratio of each genotypes.

PTC Genotype

Frequency

Taster homozygote (TT)

5

Taster heterozygote (Tt)

32

Non taster homozygote (tt)

20

Discussion

According to our class results, out of 57 students, 8.77% show two dominant PTC alleles (TT), 56.14% are heterozygous showing one dominant PTC allele (Tt), and 35% are showing two recessive dominant PTC alleles (tt).

Hereby, majority of the class are taster for PTC bitterness. Worldwide studies strongly suggest that about 75-80% of individuals worldwide are tasters for PTC bitterness. Despite that, as most of the class are from different countries, the ability to taste PTC varies significantly from population to other. Additionally there are few factors which most scientists believe have an effect to bitterness taste ability.

By correlating the class findings with Europe and other population, in Europe almost 28% of individuals are non-taster. Most of Asia, Africa and Native American population are showing lower percentage of PTC non-taster (10-16%). On the other hand, Australian Aborigines show relatively high percentage almost half of the population who were tested for PTC are non-tasters (50%).

Scientists earlier thought that the ability to taste PTC follows Mendel Ian genetic role. In other words, it is an inherited trait. However, as researches continued for more than 70 years new lead were discovered and other suggestions came. Nowadays, it is believed that individuals diets and their consumption of bitter drinks e.g. coffee and alcohol have influence on their PTC or phenylcarbamide compound sensitivity.

As mentioned earlier PTC gene exists in seven different of allelic forms. However, two forms are designated for taster and non-taster. Studies have shown that the sensitivity to PTC is an inherited trait which is believed to be determined by a dominant gene (T). PTC exhibits simple Mendelian pattern of inheritance, in other words an in-between experience medium taste for bitterness. So, three taster categories have been identified; super taster, medium taster and non-taster. Super taster has two dominants allele (TT), medium taster is heterozygous with one dominant allele (Tt) and non-taster has two recessive dominants allele (tt). The gene is located in chromosome 7 and there three single nucleotides polymorphisms (SNPs) associated with the ability to taste PTC or not they are located at nucleotide position in the 145, 785, and 886.

As there are three categories for PTC taste sensitivity; super- tasters, non-tasters, and medium-tasters, scientists had a few queries about PTC gene. For instance, what is the benefits gained from either being PTC tasters or not. Additionally, what is the significance of being medium tasters carrying one dominant allele and how it might be implicated for personal health?

So being PTC tasters what differs you from PTC non-tasters. Earlier studies suggested that individuals who are sensitive to PTC bitterness have an advantage in developing habit of smoking and are less likely to develop diseases as the bitternes taste sensitivity prevent them from indigestion of toxins which are typically bitter in taste. As a result, it has been suggested that people who are PTC tasters have preference for sweet food.

As for PTC non-tasters, studies suggested that they might even have a better sensitivity over tasters and that they meant to taste more dangerous toxins than PTC tasters. As for food preference, they suggest that non-tasters like vegetables and citrus food. As medium tasters carry heterozygous alleles (Tt), then they have the advantage of both which mean the even could be better in their sensitivity to dangerous toxins than non-tasters. To note, that these earlier studies were based on check list of food and scaling them 1-9 on basis of like or not.

However, most of health and cancer prevention centres strongly advice with necessity of eating green and cruciferous vegetables. It is one of their cornerstone strategies to attract their attention towards such type of food and other fruit beverages such as grapefruit juice. These diets are natural and have anti-oxidants and anti-carcinogenic properties. Furthermore, cruciferous and green vegetables tend to be very bitter in taste for PTC sensitive individuals (PTC tasters), so PTC tasters are most likely to dislike these types of food, while non-tasters tend to prefer them. Yet, despite these facts earlier studies suggested that PTC tasters individuals are less likely to develop cancer.

Graves' disease is an autoimmune disease caused due to hyper thyroid gland function (over-activity). There are some pills or factors that might trigger and give rise to Graves' disease. Among such factors is high iodine content in diet pills. Iodine is bitter in taste, individuals with PTC sensitivity most probably will dislike such pills, and hence, they lower the risk of triggering Graves' disease. Additionally, PTU, or propythiouracil, is thioamide drug. It is also known as PROP (6-n-Propythiouracil) which falls in the same class as phenylthiocarbamide. This drug is used as an anti- thyroid drug for Graves' disease patients. It works by inhibiting the normal interactions of iodine and peroxidase with thyroglobulin to form T4 and T3.

There is no specific study which addressed genetic reasons for individuals with either PTC gene or those who can- not taste the bitterness in phenylthiocarbamide compounds with food consumption. A study was carried out in USA showed that there is no significant difference between PTC tasters and PTC non-tasters in their food choice. As there are different factors interfere with food choices among them mood. Even though, it is agreed that individuals with PTC gene tend to like sweet food and try to avoid bitter food like green vegetables, and PTC non-tasters individuals tend to like bitter food. Overall, cruciferous and green leaf vegetables carry high nutritional content which works as anti-cancer. Furthermore, bitter juices or beverages like grapefruit have anti-oxidant property which helps in inhibiting tumour growth. So it is logic to say yes genetic taste may interfere with food acceptance or rejection and this might alter individuals health.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.