Regulation Of Reelin By Oestrogens In The Brain Biology Essay

Published:

Autism is defined as a neuropsychiatric and behavioural disorder which has an unclear aetiology but an extremely strong genetic basis. The heritability of autism is around 90% (2), and studies of monozygotic twins have shown a concordance of 82-92% for autism spectrum disorders (2,4). As the heritability of autism is less than 100%, environmental and epigenetic factors are suggested to also play a role, allowing for the definition of autism as a complex disease (2). Environmental risk factors are generally associated with neonatal exposure to teratogens and toxins, which are varied but include ethanol, thalidomide, valproic acid, misoprostol and maternal rubella infection (2,4). Childhood exposure to live virus and the toxic mercury compound thimerosal in vaccines has been previously implicated in the aetiology of autism (2), but at this stage no causal relationship between ethyl mercury and autism has been found (11). Casein and gluten intolerance have also both been associated with the severity of autistic traits (2). The male:female ratio of autistic traits is approximately 4:1 (4), implicating sex hormones in its aetiology. Several chromosomal regions and gene polymorphisms have been identified as possible candidates for the development of autistic spectrum disorders, supporting the theory of a complex multigenic aetiology (4).

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Morphology

The common presentation of autistic patients is of impaired social function and abberant interactions, deficits in communication skills and speech, and obsessive, repetitive behaviours with restricted interests (2,4). As such, failure in language development and poor communication skills are fundamental to diagnosis of autism (4). Associated behavioural features of autistic individuals includes reduced eye contact, lack of gesturing, language delays, inability to empathise and interpret emotions, reduced attention, hypersensitivity to sensory stimuli, stereotyped hand flapping and resistance and emotional distress at changes in routine (4). Mental retardation, seizures, self-injury, anxiety, sleep disturbances, gastrointestinal disturbances and large brain volume at young ages are also present in some cases (4). Diagnostic criteria -

Pathogenesis

The pathogenesis of autism remains unclear due to the complexity of its aetiology. A central pathogenic feature of autism is that the regulation of synaptic plasticity in the brain is impaired, with dysfunction particularly of long term potentiation. LTP is defined as a long lasting enhancement in communication between two neurons and is considered to be the major cellular mechanism of learning and memory processes (2). Synaptic protein synthesis and degradation are dysfunctional in autism, and synaptic transmission is impaired as such (2).

Treatment & Outcomes

REELINS

Overview

Reelin is an extracellular-matrix protein encoded by the RELN gene of the chromosomal location 7q22 (2), involved in the plasticity of dendritic spines and synaptic transmission (14) as well as playing a major role in neurodevelopment (2). It has decreased levels in the serum, frontal and cerebellar cortices of autistic patients (2).

Role in brain development

Reelin is secreted into the circulation by Cajal-Retzius cells located in the hippocampal cortex and plays a major role in neuronal migration and prenatal development of neuronal connections during neurodevelopment (2). Reelin is considered to mainly act during neurodevelopment as Cajal-Retzius neurones degenerate within the first 3 weeks after birth, but also participates in regulation of synaptic plasticity and memory processes in the adult brain (2). Expression of reelin in adult brains is localised to GABAergic neurons in the cerebral cortex, hippocampus and cerebellum, and granule cells in the cerebellum (2). Reelin enhances LTP by binding to the ApoER2 and VLDLR receptors, regulating long lasting synaptic plasticity involved in learning and memory retention. (2)

Signalling pathways

Reelin exhibits two functional roles as a serin protease and via receptor-dependent signalling. Proteolytic actions of reelin including the lysis of extracellular matrix proteins, crucial in neurodevelopment for migrating neurons, and also contributing postnatally to the development of the neuromuscular junction, motor end plate maturation and nerve-muscle connectivity (2). The binding of reelin to its receptors, VLDLR, Apoe-R2 and a3b1 integrins, on migrating neurons activates intracellular signalling cascades. (2)

Reelin knockout phenotype

A RELN knockout phenotype has been produced in mice which shows altered neuronal migration and cytoarchitectonics as the migrating neurons in neurodevelopment cannot acquire the signal for proper layer positioning, normally instigated by reelin (2). The reeler phenotype displays impaired neuronal migration, disrupted organisation of cerebellar and frontal cerebral cortices, impaired brain lamination, aberrant striatal LTP and hyperphosphorylation of Tau protein leading to impaired axonal growth and synaptic plasticity (2). Impairments in the reelin pathway via receptors and terminal molecules of reelin signalling also result in a similar phenotype to reeler mice (2).

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

Reelins and autism

Reelins have been linked to autism due to the decreased expression of reelin protein and mRNA in the serum, frontal and cerebellar cortices of autistic patients, with long variants of (GGC)ⁿ RELN repeats in 5'UTR identified as the cause and a higher frequency of these repeats observed in autistic patients (2). Disruption of the cortical GABAergic interneurons which normally express reelin and create inhibitory synpatic contacts is an identified feature of RELN mutation and is linked to the overreactivity to external stimuli expressed in autistic patients (2). Reelin expression is regulated by epigenetic methylation or histone deacetylation of the RELN gene promoter (2) and events such as exposure to neuropeptides during development and differing levels of maternal care may influence reelin expression (2). Low levels of maternal care have been shown to induce a decrease in reelin expression, whilst high levels do the opposite (2), and have been reversed in adulthood by treatment with histone deacetylase inhibitor and L-methionin treatments to epigenetically regulate the RELN gene promoter (2).

ANIMAL MODELS OF AUTISM

Experimental models

Comparison of effectiveness with human model

Socially/behaviourally

Biochemically

Treatment outcomes

Animal models of autism are designed to replicate the human model and are constructed around likeness to human morphology (face validity), pathogenesis (construct validity) and the predicted response to treatments which are effective in treating the human disease (predictive validity) (4). Mus musculus is a species closely genetically related to humans (4,10) and highly social, engaging in high levels of social interaction and communication (4), which allows for effective targeted experimental models to be built. Several approaches to experimental models of autism have been attempted, including the gene mutation of neurotransmitters and developmental genes and the generation of defects in neurotransmitters or brain regions analogous to neurochemical or anatomical abnormalities seen in autism (4). Treatment of animals with neurotoxic substances has also created autistic-like traits in these animals (2). Mice display various social traits which allows scientists to target and qualify social deficits, and normal habits include social investigation of unfamiliar mice, communal nesting, aggressive behaviour towards intruders, sexual approach and mating behaviour patterns, parental care of pups and juvenile play (4). A common quantitative analysis of social deficits in mice is through the measurement of ultrasonic vocalization of pups (2,14), where deviant patterns have been determined in various behavioural phenotypes of mouse models of human neurodevelopmental and psychiatric disorders of which communication deficits are a primary symptom (14). The development of sound spectrographic analysis has allowed additional insights into environmental and genetic factors which shape ultrasonic vocalization responses (14). The observation of behaviour is crucial to developing experimental models of autism and the monitoring of social behaviours such as sniffing, following and social grooming, as well as self grooming, to indicate repetitive or obsessive behaviour, have all been useful for determining effectiveness of the models (4).

Neurotoxic substances

Treatment of pregnant rats with valproic acid during the fetal developmental stage of neural tube closure showed diminished motor neuron numbers in the cranial nerves III, V, VI and XII in addition to reductions in cerebellar volume and Purkinje cell numbers. (2)

Reeler mice

The RELN gene in mice is a paralog to the human RELN gene and has been targeted for the modelling of autistic traits between species (4). Reeler mice, deficient in the RELN gene, are an example of an autism animal model and exhibit behavioural patterns similar to autism in humans. Motor impairments, tremors, dystonia and ataxic gait as well as increased anxiety, deficits in memory and learning (2) and higher levels of social dominance, related to abnormal response inhibition (4), have all been displayed in this model. A notable feature of the reeler mice is decreased ultrasonic vocalization in male reeler pups, expressing social deficits after maternal separation (2,14) but these were affiliated with body weight decreases and reversed by prenatal exposure to acetylcholine (14). Additionally, repeated maternal separations counteracted the deficiency of ultrasonic vocalizations due to stimulation of hypothalamic-pitituary axis activation and release of corticosteroids (14). Reeler mice also have abnormal GABAergic and serotonergic connections (2). However, lack of reelin in humans leads to lissencephaly and severe mental retardation, which has no resemblance to the reeler mouse model nor human autism (2).

Genetic manipulation: Fmr1 -/-, MeCP2 -/-, UBE3A -/-

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Other gene knockouts and alterations that are associated with autistic traits include Fmr1, associated with fragile X syndrome, MeCP2, regulating the transcription of synaptic genes, and UBE3a, responsible for synaptic protein degradation (2). Fmr1 knockout mice cause the loss of FMRP, leading to enhanced LTD in the hippocampus and decreased LTP in the cortical regions. MeCP2 and UBE3A are both associated with deficits in LTP (2). Separate experiments have been carried out on heterozygous Lurcher mice to examine the cerebellar abnormalities associated with autism, where mild motor defects were associated with minimal loss of cerebellar Purkinje cells and significant deficits in spacial learning were detected (2).

Serotonin manipulation: neurotoxin, SERT -/-, HTR2A -/- and HTR7 -/- and link to sex hormones

A highly suspected pathway that is abnormal in autism is the serotonergic system, with increased blood serotonin levels a common finding in autistic patients (2). As the serotonin plays a morphogenetic role during neurodevelopment, mice with altered genetic serotonin targets present with altered cortical layer thickness and neuronal cell density (2,4). A different animal model of autism is based around the manipulation of 5-HT, where newborn rats whose mothers were treated with the 5-HT receptor agonist 5MT presented with brain metabolic and behavioural patterns mimicking the human autistic phenotype (2). Serotonergic receptor (HTR2A and HTR7) and transporter (SERT) knockout mice display depression, axiety, aggression, reduced social interaction, altered spatial learning and memory deficits (2). The serotonin receptors HTR1A and HTR2A show region-specific expression patterns and are also differentially expressed in the brains of male of female rats, providing a link of sex hormones having an effect on serotonin receptor expression (2). Testosterone has been found to result in masculinization of the serotonin nerve fibre distribution and as such increased disinhibitory behaviour such as aggression (2). 5HT1B -/- mice also display fever ultrasonic vocalizations after neonatal social isolation than wildtype littermates (14).

Contradictions within literature

SEX HORMONES/OXYTOCIN

Overview

The high male to female ratio of autism is highly suggestive of sex hormones playing a large role in its pathogenesis.

Figure 1. - the conversion of sex hormones via aromatase

Testosterone

Androgens are understood to play both degenerative and neuroprotective roles in development and sexual differentiation (3). DHEA, a testosterone precursor secreted by the adrenal glands, gonads and brain, has been found to enhance neuronal and glial cell survival (3). Testosterone increases neuronal numbers and survival and the receptive field of neurite processes and neurotransmitter output, as well as enhancing neurite length, angiogenesis and neurogenesis (3). Testosterone and DHEA also mitigate neural cell death caused by excitotoxicity, chemotoxicity, serum deprivation, oxidative stress and amyloid beta misexpression (3). Castration of adult male rats in vivo has shown to result in decreased hippocampal cell survival and hormone replacement therapy with tesoterone or DHT leads to increased neurogenesis (3). However, it is unknown if testosterone and its precursors are directly neuroprotective, or if the neuroprotective effects are due to the conversion to oestrogens by aromatase (3). The neuroprotective effects of P5 and DHEA have been shown to be eliminated when aromatase activity is blocked, suggesting that the formation of estrogens, particularly estradiol, mediates the neuroprotection by these steroids, rather than being directly neuroprotective themselves (3).

Oestrogen

Oestrogens are potent neuromodulators which are highly implicit in regulating reproductive, endocrine and skeletal functions as well as developmental control and functional maintenance of the central nervous system (3). The neuroprotective capabilities of estrogenic precursors are due to their aromatization to neuroactive oestrogens and subsequent modulation of apoptotic cell death, antioxidant activities, neuronal and glial cell proliferation, synaptogenesis and elevated neurotrophic factors (3). The expression of aromatase elevates oestrogen levels to the point of interfering with apoptotic pathways, decreasing secondary degeneration and lessening the extent of damage and hence contributing to neuroplasticity (3). Estrous females are more protected from brain injury than proestrous females (3).

Aromatase

Cytochrome P450 aromatase is a enzyme product of the gene CYP19A and converts C19 androgens into C18 oestrogens (3,14). It is expressed in the gonads and adrenal glands as well as bone, adipose, fetal liver, placenta, skin, breast cancers and in the brain (3). Aromatase expression has been found to be induced in many brain areas including hippocampus, striatum, cortex and corpus collsum following brain damage via excitotoxicity or mechanical injury, as well as being localized to reactive astrocytes, and is suggested to be a significant regulatory pathway in brain repair (3).

Oxytocin

Oxytocin and vasopressin are hypothalamic neuropeptics with sexually dimorphic effects on the brain and behaviour, particularly during in utero development (2,4). Oxytocin has receptors localized particularly in the brainstem and as such contributes to reproductive, pair-bonding and social affiliation behaviours (2,4). Polymorphisms of the gene encoding the oxytocin receptor are associated with autism spectrum disorders and oxytocin has an important role in the neurodevelopment and modulation of synaptic plasticity, allowing neurones the capability to change their shape and form new synaptic connections, particularly in early life (2). Reelin protein is also involved in the oxytocin pathway, with oxytocin receptor expression decreased in the piriform cortex, neocortex, retrosplenial cortex and hippocampus of reeler mice, and there is thought to be recriprocal regulation of reelin by neuropeptides such as oxytocin (3). Reeler mice show behavioural deficiencies similar to oxytocin-deficient mice and the downregulation of reelin expression together with decreased oxytocin receptor expression has been proposed as a possible contributor to the development of autistic disorders (3). Exogenous administration of oxytocin has been found to reduce the rate of ultrasonic vocalizations emitted by neonatal rats which had been socially isolated whilst null mutant pups displayed deficits in social recognition and memory, and fewer vocalizations than the wildtype controls, suggesting that in the absence of oxytocin, social separation is not perceived as distressing (4,14).

Effect on reelins: testosterone

Testosterone binds to androgen receptors present in brain regions which house processes associated with memory and learning such as the hippocampus, amygdala and prefrontal cortex (2). The binding of testosterone to these receptors results in a receptor complex formation, which acts as a transcription factor in the nucleus and controlling expression of target genes involved in processes pertaining to neurodevelopment and regulation (2). This includes neurotransmitter production and release, synapse conformational changes, regulation of neuronal apoptosis and alteration of neurochemical profiles (2). Previous studies have indicated that testosterone is positively correlated with spatial abilities in women and negatively correlated in men, suggesting that optimal testosterone levels contribute to optimal spatial performance (2).

Aromatase knockout phenotype

The aromatase knockout (ArKO) mouse is particularly vulnerable to excitotoxic brain damage relative to wild-type mice, with hippocampal neurons more susceptible in the presence of non-aromatizble androgens, suggesting that the conversion of C19 androgens to C18 estrogens is an important part of rodent neuroprotection (3). Excitotoxicity was also excaberated by peripheral and central inhibition of aromatase (3).

Aromatase knockout and autism

Spatial cognitive effects of testosterone have been shown to be mediated by its conversion to estradiol and it has been suggested that autism is a form of an exaggerated male brain pattern due to exposure to high levels of prenatal testosterone, resulting in masculinized social behaviour in areas of spatial performance and cognitive ability (2). Additionally, studies have suggested that there is a negative correlation between fetal testosterone levels and social relationships, and children with high fetal testosterone in their amniotic fluid exhibit strong autistic traits with strong systemizing and deficits in empathy (2). Testosterone was also found to influence the expression of reelin in male brains with testosterone adminsitration sharply decreasing reelin expression in songbirds (2). Thus there is also a strong implication that testosterone and reelin are connected, with reelin and testosterone levels both altered in autistic children.

INTRO TO HYPOTHESIS AND EXPERIMENTAL PROTOCOL

Due to the implications of testosterone and reelin being altered in autistic children, we have structured the experiment around measuring the levels of reelin in fetal male and female mice and comparing wild-types to aromatase knockout mice. Firstly, we will undertake extraction of mRNA from mouse cerebellums and prepare cDNA to measure the expression of the reelin gene. Gel electrophoresis will be used to qualitate the gene products and qPCR will be used to quantitate them.

Gel electrophoresis separates DNA or RNA fragments through the migration of charged fragments in an electric field and is commonly used analytically to visualise and separate fragments, as well as detecting degree of purity (10). It is carried out in gels made up of cross-linked polymers, in this case Agarose, which acts as a molecular sieve and slows migration of fragments in proportion to the charge-to-mass ratios, and dye is added to visualise the fragments under UV light (10).

PCR is used to amplify DNA segments which can then be cloned or used for analytical procedures (10). Two synthetic oligonucleotides are prepared which are complementary to sequences on opposite strands of target DNA at positions which define which ends of the segment are to be amplified (10). These oligonucleotides act as replication primers which can be extended by heat-stable DNA polymerase such as Taq, derived from a thermophile bacterium, with 3' ends of the hybridized probes oriented towards each other and positions to prime DNA synthesis across the desired segment (10). Isolated DNA containing the segment to be amplified is heated to denature it, then cooled in the presence of a large excess of oligonucleotide primers and four deoxynucleoside triphosphates are added and primed DNA segments replicated selectively (10). The cycle of heating, cooling and replication is repeated 25-30 times over a few hours (10). Careful design of primers can facilitate subsequent cloning of amplified DNA (10). PCR is highly sensitive and can detect and amplify as little as one DNA molecule in almost any type of sample (10).

DIAGRAM OF CENTRAL DOGMA - REVERSE TRANSCRIPTION (adapted from Principes of Biochemistry pg 1050)

DIAGRAM OF PCR (adapted from Principles of Biochemistry pg 318)

Restriction of identifying genes - genomic sequences give no information about three-dimensional structure of proteins or how proteins are modified after they are synthesized. (10)

Hypothesis:

Reelin protein is implicated in the development of autism. Oestrogens may modulate the development, onset and severity of autism. Aromatase knockout male mice, with high levels of testosterone, tend to exhibit autism-like tendencies and behavioural patterns whilst female aromatase knockout mice, with lower levels of testosterone, do not. Oestrogens may therefore play a role in neuronal development by interacting with reelin protein in the brain during neurogenesis.

Aims:

To isolate RNA from the cerebellums of fetal mice, identify the presence of the RELN gene with RT-PCR and then to quantify and compare the expression of the RELN gene in aromatase knockout (ArKO) male and female mice with qPCR.

Materials & Methods:

Part 1: RNA Extraction from Mouse Brain

Adapted from Applied Biosciences PARIS Kit User Protocol.

Materials:

PARIS Kit:

Cell Disruption Buffer stored at 4°C

2X Lysis/Binding Solution stored at 4°C

Wash Solution 1 stored at 4°C

Wash Solution 2/3 Concentrate stored at 4°C, 64mL 100% ethanol added

Filter Cartridges

Collection Tubes

Elution solution

Other:

100% Ethanol

Tissue homogenizer

Method:

Lab bench and equipment was cleaned with RNase decontamination solution

Kit components were brought to appropriate temperatures

Cell Disruption buffer on ice

2x Lysis/Binding solution and Wash Solution 1 brought to room temp

Elution solution at 50μL per sample in an RNase-free microfuge tube in a heat block set to 95-100°C

Preparation of Total Cell Lysate

Obtained 1mg tissue sample, mouse cerebellum

Aliquotted 150μL of ice-cold Cell Disruption buffer into homogenization vessel on ice

Disrupted the tissue in Cell Disruption buffer using motorized rotor-stator homogenizor.

Splitting of Lysate for RNA isolation and protein analysis

Mixed the lysate with 50μL per sample of 2X Lysis/Binding solution at room temp, mixing thoroughly by pipetting 3-4 times

RNA Isolation

Add 50μL of ACS grade 100% ethanol to sample, mixing thoroughly but gently by pipetting 3-4 times

Drew the sample mixture through Filter cartridge assembled in collection tube and washed

Centrifuge for 0.5-1 min or until lysate/ethanol mixture is through the filter

Discarded flow-through

Washed once with 700μL Wash Solution 1, centrifuging for 1min and discarding flow through

Washed with 500μL 2/3 Wash Solution, centrifuging for 1 min and discarding flow through

Washed twice with 500μL 2/3 Wash solution, centrifuging for 1 min and discarding flow through

Continued centrifugation for 30 secs to remove last traces of Wash Solution 2/3

Elute RNA with 40μL of 95 degree Elution Solution

Put filter cartridge into fresh collection tube

Apply preheated elution solution in 40μL aliquot

Recover RNA by centrifugation for 30 sec

Apply second aliquot of preheated elution solution of 10μL

Respin in centrifuge for 30 sec

Trace DNA may need to be removed by treating RNA with DNase.

RNA stored at -80 degrees.

Part 2: Gel Electrophoresis

Materials:

Agarose I

1X TBE

SYBR safe stock in DMSO

Invitrogen 1kb DNA ladder

+6 Buffer Dye

RNase-free H20

Method:

Weighed 0.3g Agarose

Transferred agarose to suitably sized flask (min. 5Ã- vol gel) and added 30mL TBE

Melt agarose in microwave, heat and swirl to mix carefully until dissolved. Prepare gel tray with 2mm comb while waiting for liquid to cool slightly.

Add 2μL SYBR safe stock in DMSO to the molten gel in the flask. Swirl to mix until uniformly distributed. Avoid making bubbles.

Pour gel carefully into prepared tray, making sure there are no bubbles in the

lanes and the tray does not leak. Allow to set for at least 20 minutes.

Remove ends from gel cast tray and fill tank with 1Ã- TBE. Carefully remove

combs so as not to damage wells.

Create loading samples with 2μL buffer dye, 2μL water and 2μL sample RNA.

Load 6μL samples into wells and 1x 6μL DNA ladder.

Run gel at 95V for 20 minutes.

Part 3: cDNA synthesis

Adapted from Invitrogen SuperScript II First-Strand Synthesis System for RT-PCR product manual.

Combine in a 0.2 or 0.5ml tube:

2μL RNA

50 ng/μL (100ng) random hexamers

1μL 10 mM dNTP mix

to 10μL DEPC water

Incubate at 65°C for 5 min, then place on ice for at least 1 min.

Prepare the cDNA Synthesis Mix, adding each component in the indicated order:

10X RT buffer, 2μL per rxn

25mM MgCl2, 4μL per rxn

0.1M DTT, 2μL per rxn

RNaseOUT (40 U/μL), 1μL per rxn

SuperScript II RT (200 U/μL)

Add 10μL of cDNA Synthesis Mix to each RNA/primer mixture, mix gently, and collect by brief centrifugation.

Incubate for 10min at 25°C, followed by 50min at 50°C.

Terminate the reactions at 85°C for 5 min, chill on ice.

Collect the reactions by brief centrifugation, add 1μL of RNase H to each tube and incubate for 20min at 37°C.

cDNA synthesis reaction can be stored at -20°C or used for PCR immediately.

Part 4: RT-PCR

Adapted from Promega Hot Start Green Master Mix Product Manual.

Biometra T3 Thermocycler PCR machine

Thaw the GoTaq Hot Start Green Master Mix at room temperature, vortex and centrifuge it briefly in a microcentrifuge to collect the material at the bottom of the tube.

Prepare the reaction mix at room temperature:

For 25μL reaction volume -

GoTaq Hot Start Green Master Mix 2X, 12.5 μL for final concentration of 1X

upstream primer, 10μM, 0.25-2.5 μL for final concentration of 0.1-1.0μM

downstream primer, 10 μM, 0.25-2.5 μL for final concentration of 0.1-1.0μM

DNA template, 1-5 μL for final concentration of <250ng

Nuclease-free water to 25 μL

Run SODRAT PCR program:

95°C, 5 min

Repeat X30:

95°C, 45 sec (Denaturation)

55°C, 45 sec (Annealing)

72°C, 45 sec (Extension)

Finish with 72°C, 5 min

Part 5: DNA Decontamination

Added 0.1 volume 10X Dnase buffer and 1μL rDNase to each RNA sample and mixed gently

Incubated at 37C for 30 min

Add 0.1 volume Dnase Inactivation agent, resuspended.

Incubated for 2 minutes at room temp, mixing every 30 seconds

Centrifuged at 10,000rcf for 1.5 min and transferred RNA to fresh tube, leaving precipitate behind.

Part 6: EtOH Precipitation of RNA

Added 0.1 volume 3M NaAc and 3x volume 100% ethanol

Put on dry ice for 10 minutes

spin at 13,000 rcf for 15 minutes

Vortex and extract EtOH, leaving RNA pellet in tube and let dry for 5 min

Add 20μL nuclease-free water

Dissolve at 65C for 5 min

Part 7: qPCR

RELN primer sequence used for experiment:

Forward - AACTGGAGGCGGGTCACGGT

Reverse - CCCCGGTCACACACACAGCG

Product length - 194bp

HPRT primer sequence used for experiment:

Forward - CTTTGCTGACCTGCTGGATT

Reverse - TATGTCCCCCGTTGACTGAT

Product length - 121bp

Materials for primer master mix:

10μL master mix per sample

1μL primer mix per sample

4μL DNase and RNase free H2O per sample

Method:

Immediately before each turn, dilute 5μL cDNA with 50μL H2O and mix well

Pipette 5μL diluted cDNA into qPCR tubes

Add 15μL master mix into each tube

Seal tubes and run on thermocycler, store primer master mix until next run

Repeat process for run 2-4 using same primer master mixes.

Results

Table 3.01: Mouse numbers and genotypes

Mouse number

Gene 1

Gene 2

CYP19

GFP

SRY

E92

-

-

E93

-

+

E123

-

-

E124

-

-

E125

-

+

E126

-

+

E128

-

-

E136

-

+

ArKO

KO/WT

SRY

e34

KO

+

e38

WT

-

e39

KO

-

e41

WT

-

e42

KO

+

e46

WT

-

e47

WT

+

e52

KO

-

e54

WT

-

e58

WT

-

e59

WT

-

e60

WT

+

Table 3.02 - Nanodrop Values of RNA Extraction pre-optimisation

Sample No

ng/μL RNA

260/280

260/230

CYP19

E92

93.2

2

1.78

e93

43.8

2.05

1.11

e123

43.9

1.55

0.72

e124

29.8

2.67

0.1

e125

38.45

2.51

0.09

e126

27.9

1.73

0.08

e128

8.25

1.99

0.45

e136

23.7

2.79

0.09

ArKO

e34

43

1.62

0.55

e38

99.2

1.46

0.26

e39

13.7

1.55

0.57

e41

10.9

1.48

0.46

e42

39.5

2.28

0.41

e46

23.9

2.2

0.09

e47

58.1

2.12

1.65

e52

14.8

2.33

0.18

e54

21.6

2.13

0.31

e58

11.4

2.44

0.25

e59

13.4

1.62

0.05

e60

9.7

2.44

0.02

Figure 3.01: Gel Electrophoresis of RNA extraction - CYP19 e92, e93

1% Agarose Gel, 2mm Comb, Invitrogen 1kb+ DNA ladder

Figure 3.02: Gel Electrophoresis of RT-PCR - CYP19 e92, e93

1% Agarose Gel, 5mm comb, Invitrogen 1kb+ DNA ladder

Figure 3.03: Gel Electrophoresis - CYP19 e123, e124, e125, e126, e128, e136

1% Agarose Gel, 2mm comb, Invitrogen 1kb+ DNA ladder

Figure 3.04: Gel Electrophoresis - ArKO e34, e38, e39, e41, e42, e46

1% Agarose Gel, 2mm comb, Invitrogen 1kb+ DNA ladder

Figure 3.05: Gel Electrophoresis - ArKO e47, e52, e54, e58, e59, e60

1% Agarose Gel, 2mm comb, Invitrogen 1kb+ ladder

Table 3.03: Nanodrop Values of RNA post-optimisation

Sample No

ng/μL RNA

260/280

260/230

CYP19

e92

58.4

2.01

1.97

e93

29.9

2.21

1.13

e123

37.1

1.91

1.18

e124

59

2

2.27

e125

84.8

1.97

1.41

e126

23.3

2.03

0.09

e128

41.1

2.02

0.81

e136

53.7

2.04

1.52

ArKO

e34

11.1

2.03

0.74

e38

10.7

2.38

0.44

e39

4.6

2.12

0.31

e41

24.3

2.15

1.32

e42

5.9

2.45

0.34

e46

21.5

2.16

1.22

e47

76.7

1.98

1.95

e52

25.4

1.92

1.47

e54

22.6

2.22

1.74

e58

16.9

1.87

0.25

e59

44.3

2

0.65

e60

-0.3

-0.62

0.08

Figure 3.06: qPCR melting points, HPRT and RELN

Figure 3.07: qPCR Cycling Graph, HPRT and RELN

Table 3.04: ΔCt Values of RELN gene

Sample ID

ΔCt

Discussion

electrophoresis results: presence of RNA bands in basic gels

RT-PCR: proves RELN is present in mouse cerebellums

qPCR: quantitates the amount of RELN present

presence of GFP in samples (all negative)

CYP19 knockout genotype, consequent effects on males/females

behaviour

Usefulness of mouse-human model:

comparative genomics are utilised in this experiment. RELN gene in mice is a paralog to human RELN gene and can, as such, be used to tentatively assign gene function to the ortholog in second species. Humans and mice are closely related. Syntegy = conserved gene order, provides additional evidence for orthologous relationship between genes at identical locations within related segments. (10)

Since approximately 99% of human genes have ortholog counterparts in mice, many targeted gene mutations in mice may be forthcoming as potential models of autism-related genetic dysfunctions. (4)

- errors in experiment

Summary, conclusion and future directions

future direction -

other target genes

serotonin

microarrays to determine genes expressed at different stages of development of organism (10), could be useful in monitoring RELN mutations and also used to monitor other genes implicated in the development of autism.

Presence of combination of genes in particular genomes can hint at protein function - if genes always appear together, suggests proteins encoded by them may be functionally related. (10)

Bibliography

Muhle, R, Trentacoste, S & Rapin, I. 'The Genetics of Autism', Pediatrics, 113:472-86, 2004

Kelemenova, S, Ostatnikova, D. 'Neuroendocrine pathways altered in autism. Special role of reelin', Neuro Endocrinol Lett, 30(4):429-36, 2009

Saldanhal, C, Duncan, K & Walters, B. 'Neuroprotective Actions of Brain Aromatase', Front Neuroendocrinol. 30(2): 106-18, 2009

Crawley, JN. 'Mouse Behavioral Assays Relevant to the Symptoms of Autism', Brain Pathol., 17(4):448-59, 2007

Moy, S, Nadler, J et al. 'Sociability and Preference for Social Novelty in Five Inbred Strains: An Approach to Assess Autistic-Like Behaviour in Mice', Genes Brain Behav., 3(5): 287-302, 2004

Anderson BM, Schnetz-Boutaurd NC et al, 'Examination of Association of Genes in the Serotonin System to Autism', Neurogenetics, 10(3): 209 - 216, 2009

Hertz-Picciotto, I, Croen, LA, et al. 'The CHARGE Study: An Epidemiologic Investigation of Genetic and Environmental Factors Contributing to Autism', Environ Health Perspect., 114(7): 1119-125, 2006

Auyeung, B, Taylor, K et al, 'Foetal Testosterone and Autistic Traits in 18 to 24-Month-Old Children', Mol Autism., 1: 11, 2010

Knickmeyer, RC, Baron-Cohen, S, 'Fetal Testosterone and Sex Differences in Typical Social Development and in Autism', J Child Neurol, 21(10): 825-45, 2006

Nelson, D, & Cox, M, Lehninger Principles of Biochemistry, New York: W.H. Freeman, 2008

Kumar, Vinay, Abul K. Abbas, Nelson Fausto, Stanley L. Robbins, and Ramzi S. Cotran, Pathologic Basis of Disease, Philadelphia: Elsevier Saunders, 2010

Salinger W, Ladrow P, Wheller C, 'Behavioural Phenotype of the Reeler Mutant Mouse: Effects of RELN Gene Dosage and Social Isolation', Behav Neurosci, 117: 1257-1275, 2003

Toda K, Okada Y, Zubair M et al, 'Aromatase-Knockout Mouse Carrying an Estrogen-Inducible Enhanced Green Fluorescent Protein Gene Facilitates Detection of Estrogen Actions in Vivo', Endocrinology, 145(4): 1880-1888, 2004

Scattoni, M, Crawley, J & Ricceri, L, 'Ultrasonic vocalizations: a tool for behavioural phenotyping of mouse models of neurodevelopmental disorders', Neurosci Biobehav Rev. 2009 April ; 33(4): 508-515