Real Time Polymerase Chain Reaction Assay Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Over the last thirty years, reported incidents of harmful algal blooms have been increasing worldwide. Species of dinoflagellate genus Alexandrium have come to the attention of the international community as they produce paralytic shellfish poisons, which have a detrimental impact on aquaculture industries, fish stocks, coastal tourism and can be fatal to humans. Identification and monitoring of Alexandrium species in coastal regions is carried out by microscopic examination, which is time consuming and expensive. New rapid and more sensitive molecular based techniques are required to detect the presence of Alexandrium species in the environment. In this study, species-specific oligonucleotide primers were designed in order to develop a real-time PCR assay for the detection of Alexandrium ostenfeldii strains in sediment samples. Primers were developed to amplify a region from the D1-D2 larger subunit (LSU-28s) rDNA. The Basic Local Alignment Search Tool confirmed the specificity of the designed primers to A. ostenfeldii. Primer species-specificity was determined by performing PCR and real-time PCR assays with other species of the Alexandrium genus. Although the primers amplified a product of expected length from A. ostenfeldii strain UW516, unfortunately species-specificity could not be determined. Issues that arose during the study and future recommendations are analysed in the discussions section.

The last 50 years has seen major increases in the consumption of seafood around the world. Global populations, which now comprise 70% of coastal regions (Diaz and Hu, 2009) and changing trends in eating habits has seen seafood become a major global commodity with sales over $60 billion (US) in 2003 (Mansfield, 2003). To meet the consumer requirements for seafood and with marine stocks no longer sustainable; aquaculture is now growing in importance and supplies around 25 % of fish and shellfish markets (Davidson and Bresnan, 2009). Over the last 30 years greater attention has been paid by the international community to study the impacts of microalgae on marine ecosystems. Microalgae play a crucial role in marine biodiversity and are an important part of the marine food web, being a source of food for a number of organisms such as bivalve molluscs, planktonic and benthos copepods, krill and planktivorous fish (Camacho et al., 2007).

Algal blooms

Algal blooms are a natural phenomenon, occurring in marine and freshwater ecosystems. Under favourable environmental conditions microalgae rapidly proliferate forming dense populations of cells known as blooms. Around 300 of the 4000 microalgal species identified as being capable of generating blooms (Maso´and Garce´s, 2006). Blooms mostly occur during spring and summer and although the exact environmental mechanisms are not known, it evident that warm temperatures, high light levels, inorganic nitrates, phosphates and trace metals manganese, iron and zinc cause this. Stable weather conditions also enhance algal blooms such as low winds, which increase light penetration to the water column and reduce algal dispersion (Camacho et al., 2007).

Algal blooms are often visible due to sea surface discoloration. Blooms can appear red, brown, green or blue-green (Wessells et al., 1995) and may be of cloudy consistency or appear as a thick scum on the surface of the water (Sellner et al., 2003). Around 90 microalgal species have been identified as being toxic (Camacho et al., 2007) and can form harmful (toxic or noxious) algal blooms (HABs) and are commonly known as 'red tides' due to a red discolouration in the sea. Toxic species belong to five main algal groups, which include dinoflagellates, cyanophytes, haptophytes, raphidophytes and pelagophytes (Maso´and Garce´s, 2006). Dinoflagellates make up around 75% of the total toxic algal species (Camacho et al., 2007).AH

Incidents of HABs over the last thirty years have been increasing worldwide. HABs have a detrimental effect on marine ecosystems through the accumulation of phycotoxins in marine food webs, deadly to both humans and marine wildlife and also have an impact economically, affecting aquaculture industries, fish stocks and coastal tourism (Galluzzi et al., 2004). Annually there are around 60,000 reported cases of seafood poisoning in humans worldwide, with a mortality rate of 1.5 percent (Camacho et al., 2007). Five toxic syndromes are associated with the human consumption of phycotoxins from contaminated seafood; paralytic shellfish poisoning (PSP), diarrhetic shellfish poisoning (DSP), neurotoxic shellfish poisoning (NSP), amnesic shellfish poisoning (ASP) (Maso´and Garce´s, 2006) and ciguatera shellfish poisoning (CSP) (Camacho et al., 2007).

Dinoflagellates

Dinoflagellates are unicellular algae-like protists, dating back several hundred million years (Smayda, 2007). Dinoflagellates can inhabit a wide variety of environments and exist as either motile free living cells, non-motile endosymbionts of marine invertebrates or ecto and endo parasites. They have two dissimilar flagella (biflagellated), a large nucleus (often dikaryotic) containing condensed chromosomes and organelles such as a Golgi body, chloroplasts in photosynthetic species and mitochondria (Hackett, 2004). Mode of nutrition is either autotrophic through photosynthesis, heterotrophic obtaining carbon and other compounds by ingesting (phagotrophy) plankton or mixotrophic using both modes.

Alexandrium ostenfeldii

Alexandrium ostenfeldii is a large thecate gonyaulacoid dinoflagellate ranging from 40-60 µm in length and 40-50 µm in diameter (Kremp et al., 2009).

A. ostenfeldii was first identified in Iceland in 1904 by Paulsen (Gribble et al., 2005). To date A. ostenfeldii has been found in numerous cold and temperate ocean and estuary environments all around the world (Kremp et al., 2009). A. ostenfeldii has been reported in several countries such as Iceland, Scotland, Faroe Islands, Scandinavia and Spain. A. ostenfeldii has also occurred in the USA (Washington and British Columbia), New Zealand, Russia and Egypt. Very little is known about blooming in A. ostenfeldii due to its low cell levels and occurrence with other blooming Alexandrium species such as A. tamarense (Kremp et al., 2009). Outbreaks of A. ostenfeldii blooms have also been recorded in Scotland, Norway, Spain and the Northern Baltic Sea (Kremp et al., 2009).

A. ostenfeldii along with other Alexandrium species produce PSP. PSP from A. ostenfeldii has been found in a few locations around Europe such Denmark, Germany and Ireland and also found in the Gulf of Maine, USA (Gribble et al., 2005).

Spirolides are biotoxins which are unique to A. ostenfeldii. To date there are no recordings of spirolides produced by other Alexandrium species. Spirolides form part of a chemical compound group known as the cyclic imines. Although the affects of spirolide toxins are still unknown it has been suggested that they may possibly inhibit acetylcholine receptors of the nervous system (Meilert and Brimble, 2006).

Spirolides were first identified in Nova Scotia Canada, with further recordings in New Zealand, Spain (Gonzalez et al., 2006) and France (Amzil et al., 2007).

Detection of Alexandrium species

Currently, the identification and monitoring of Alexandrium species in coastal regions is carried out by microscopic analysis (Diercks et al., 2008). Microscopic examination looks at differences in cell morphology such as size, shape and thecal plate arrangement between the Alexandrium species. The process is however time consuming and expensive as it requires trained laboratory personnel with taxonomic experience and specialised laboratories (Godhe et al., 2007). Alexandrium species can be difficult to discriminate due to similarities in cell morphology. A. ostenfeldii exhibits similar cell characteristics to that of A. tamarense and A. peruvianum with the only distinguishable cell morphologies being thecal plate tabulation. Alexandrium species may also be present in low cell concentrations in the water column and can be found with other toxic and non-toxic blooms, thus making it difficult to obtain samples for microscopic analysis.

Alexandrium species form benthic resting cysts during the sexual phase of the heteromorphic life cycle. When environmental conditions are favourable, the resting cysts through the process of excystment form motile Alexandrium cells (Erdner et al., 2010). The identification of cyst species in sediment samples through microscopic examination is important in determining the outcome of future HAB's in coastal regions.

New rapid and more sensitive molecular based techniques such as whole cell fluorescent in situ hybridization, species-specific PCR/ real-time PCR assays and DNA probe assays are required to detect individual Alexandrium species/ strains (Diercks et al., 2008).

Aim

The aim of the study is to design a real-time PCR assay for the detection of dinoflagellate Alexandrium ostenfeldii in sediment samples.

The design of the real-time PCR assay will be carried out in two stages:

Primer Design

DNA primers will be designed to be species-specific to A. ostenfeldii.

Molecular Methods

Once the primers have been designed, a normal PCR will be carried out to check if the primers will anneal to the DNA extracted from cultures of A. ostenfeldii. The specificity of the primers to A. ostenfeldii will then be checked by carrying out a PCR with the DNA extracted from other Alexandrium species.

The methods carried out in the normal PCR will then be performed using a real-time PCR assay. The assay will have to be fully optimised to detect A. ostenfeldii in sediment samples.

Materials and Methods

Primer design

Species-specific A. ostenfeldii primers were designed to amplify a section of the D1-D2 region of the large subunit (LSU-28s) rDNA.

Partial sequences (D1-D2 region) of A. ostenfeldii and genus Alexandrium (Appendix 1) were obtained from the National Center for Biotechnology (NCBI) database (http://www.ncbi.nlm.nih.gov/). Sequences were downloaded in a FASTA format and viewed using Microsoft® Windows® notepad.exe text editor. The Alexandrium and A. ostenfeldii FASTA sequences were aligned using the EMBL-EBI CLUSTALW2 multiple sequence alignment (MSA) programme (http://www.ebi.ac.uk/Tools/clustalw2/index.html). The MSA was analysed in eBioX ver. 1.5.1 (http://www.ebioinformatics.org/ebiox/) and Jalview ver. 2.4.0.b2 (http://www.jalview.org/). Primers were designed to complement a region of the A. ostenfeldii sequence and not the other Alexandrium species. The specificity of the chosen primers to Alexandrium was checked using the NCBI Basic Local Alignment Search Tool (BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi). The GC content and melting temperatures of the selected primers were calculated using OligoCalc (http://www.basic.northwestern.edu/biotools/oligocalc.html). The primers were ordered from Invitrogen (http://www.invitrogen.com/site/us/en/home.html).

Alexandrium multiple sequence alignment and primer design.

Figure 1 continued on page 9.

Figure 1. Multiple sequence alignments of the large subunit (28s) rDNA gene (D1-D2 region) of Alexandrium species/strains using CLUSTALW2. The coloured areas indicate Alexandrium ostenfeldii strains. See Appendix 1 for Alexandrium species/strains used in the MSA.

Target area of forward and reverse primer

Forward Primer: 5'GTCCACTTGTGGGYGCAATGGTTCT3'  site 432 - 475bp on MSA

Reverse Primer: 5'GGCTCTCCTCCCTGGGCACT3'    site 636 - 654bp on MSA

3'CCGAGAGGAGGGACCCGTGA5'

Table 1. Species-specific oligonucleotide primers designed to amplify 222bp region of A. ostenfeldii large subunit (28s) rDNA gene.

Gene

Forward primer sequence (5' - 3')

Primer length (bases)

Tm (°Ϲ)

Alexandrium ostenfeldii

GTCCACTTGTGGGYGCAATGGTTCT

25

61

Reverse primer sequence (5' - 3')

Primer length (bases)

Tm (°Ϲ)

Alexandrium ostenfeldii

AGTGCCCAGGGAGGAGAGCC

20

60

Y = C OR T

Tm (°Ϲ) = Melting temperature

Culturing of Alexandrium

Alexandrium species (Table 2) were sub cultured from previous cultures into individual 50 ml Falcon cell culture flasks with a blue vented screw cap containing F/2 growth media. Cell culture flasks were stored at 15-16°Ϲ in a walk-in illuminated incubator with a light dark cycle of 14hours light and 10 hours dark.

F/2 medium was prepared in a 2 litre bottle according to the protocol of culturing algae by Guillard & Ryther 1962.

Table 2. Alexandrium species cultured in F/2 media.

Species

Strain

Origin

Alexandrium ostenfeldii

Bahme 136

New Zealand

Alexandrium ostenfeldii

FAL50

Fal Estuary

Alexandrium ostenfeldii

UW516

Salcombe Estuary

Alexandrium minutum

FAL18

Fal Estuary

Alexandrium tamarense

UW475 Type III Western European

Belfast Harbour

Alexandrium tamarense

UW457 North America

Belfast Harbour

Alexandrium minutum

UW529

Fal Estuary

Alexandrium tamutum

UW506

Holy Island

DNA extraction and amplification

DNA was extracted from Alexandrium species/strains using two different techniques.

Qiagen Generation Capture Column Kit.

DNA was extracted from cultured cells of A. ostenfeldii Bahme136, A. ostenfeldii FAL50 and A. ostenfeldii UW516. A 2 mL eppendorf tube containing 1.5 mL of A. ostenfeldii strain was centrifuged at 10,500 rpm for 5 minutes (eppendorf® centrifuge). The supernatant was removed and the pellet was resuspended. The sample was then vortexed and DNA extraction was carried out according to the Generation Capture Column kit protocol. The extraction was carried out in duplicate for each strain. The concentration and purification of the extracted DNA was analysed using a NanoDrop spectrophotometer at a wavelength of 260 and 280nm. Extracted DNA was stored in a freezer at -20°Ϲ.

Qiagen DNeasy blood and tissue kit.

Alexandrium cells were harvested from cultures (Table) and added to 15 mL Falcon centrifuge tubes. The cells were centrifuged at 3,000 rpm for 10 minutes (MSE Centaur) and most of the supernatant was removed. The pellet was then resuspended and transferred to a 2 mL microcentrifuge tube with O ring screw cap. Further centrifugation at 14,500 rpm for 5 minutes (eppendorf® centrifuge) and all of the supernatant was removed. DNA extraction was carried out using DNeasy blood and tissue kit, Qiagen. Following the DNeasy kit protocol, 180 µL of ATL lysis buffer was pipetted into the 2 mL microcentrifuge tube. Glass beads were added to the tube and bead beated (BioSpec inc Mini-Beadbeater) for 1 minute to disrupt the cells. A small hole was made in the bottom of the tube using a red hot needle. The ATL lysis buffer was then removed through the hole by placing in a 15 mL Falcon centrifuge tube, which has had the conical end removed. An empty 2 mL microcentrifuge tube with O ring screw cap was placed underneath microcentrifuge tube containing the ATL lysis buffer. The 15 mL Falcon centrifuge tube containing the two microcentrifuge tubes was then centrifuged at 3000 rpm for 10 minutes. The ATL lysis buffer was collected in the empty 2 mL microcentrifuge tube. Next 20 µL of Proteinase K was pipetted into the microcentrifuge tube and incubated in the heat block at 56°Ϲ for 1 hour. The sample was further purified according to the DNeasy kit protocol. DNA was eluted from the mini spin column by pipetting 200 µL of AE (elution) buffer and centrifuged at 8000 rpm for 1 minute. The concentration and purification of the extracted DNA was analysed using a NanoDrop spectrophotometer at a wavelength of 260 and 280nm. Extracted DNA was stored in a freezer at -20°Ϲ.

Polymerase chain reaction (PCR)

PCR preparation was carried out in a UV PCR cabinet. Gloves, pipettes, pipette tips, microcentrifuge tubes and PCR tubes were decontaminated for 5 minutes prior to use.

PCR Master Mix (Taq PCR core Kit, Qiagen) was prepared by pipetting 2.5 µL of 10Ã- buffer, 0.5 µL of dNTP, 0.5 µL of forward primer FAost (5'GTCCACTTGTGGGYGCAATGGTTCT3') (10 μM), 0.5 µL of reverse primer RAost (5'AGTGCCCAGGGAGGAGAGCC3') (10 μM), 0.125 µL of Taq polymerase and 15.875 µL of molecular grade water into a 1.5 mL microcentrifuge tube. Master Mix was then vortexed. Next 20 µL of Master Mix and 5 µL of extracted template DNA were pipetted into 1.5 mL PCR tubes (final reaction volume 25 µL). PCR was performed in an eppendorf® thermo cycler. PCR cycle parameters used were an initial start at 95°Ϲ for 5 minutes, followed by 40 cycles of denaturation at 94° for 45 seconds, annealing at 50°Ϲ for 45 seconds and an extension at 72°Ϲ for 1 minute. After the 40 cycles a final extension at 72°Ϲ for 7 minutes.

PCR products were analysed by separating on an agarose gel electrophoresis. A 2% gel was prepared by dissolving 2 g of agarose powder (UltraPureâ„¢, Invitrogen) in a conical flask with 100 mL of 1Ã- TBE buffer (UltraPureâ„¢, Invitrogen). The gel was poured into a casting tray, with comb and allowed to set. The casting tray was then placed in a horizontal electrophoresis chamber and submerged with 1Ã- TBE buffer. Next 10 µL of PCR product was mixed with 2 µL of DNA loading buffer (supplied with Hyperladder V) and pipetted into a submerged well on the agarose gel. The gel was stained in Ethidium bromide (Sigma-Aldrich) and visualised in a UV transilluminator.

Real-time PCR

Real-time PCR preparation was carried out in a UV PCR cabinet. Gloves, pipettes, pipette tips, microcentrifuge tubes and PCR tubes were decontaminated for 5 minutes prior to use. Real-time Master Mix was prepared by pipetting 12.5 µL of Rotor-gene SYBR Green RT-PCR Master Mix (Qiagen), 2.5 µL of forward primer FAost (10 μM), 2.5 µL of reverse primer RAost (10 μM), and 2.5 µL of RNase-Free molecular grade water into a 1.5 mL microcentrifuge tube and vortexed. Next 20 µL of Master Mix and 5 µL of extracted template DNA were pipetted into 1.5 mL PCR tubes (final reaction volume 25 µL). PCR tubes labelled on the top and not on the side of the tubes. Real-time PCR was performed in a Rotor-Gene Q real-time cycler, QIAGEN. Real-time cycling conditions were set at an initial HotSarTaq™Plus DNA polymerase activation step at 95°Ϲ for 5 minutes, then a two-step cycling at 95°Ϲ for 5 seconds and 60°Ϲ for 10 seconds for 40 cycles. PCR tubes were loaded into the rotor spin and cycling programme started.

Results

Experiments were carried out according to the protocols outlined in the methods section and the following results were obtained.

DNA extractions

Using the Qiagen Generation Capture Column Kit resulted in low yield of DNA in A. ostenfeldii strains FAL50 and UW516. In comparison extraction of Bahme 136 yielded slightly higher concentrations of DNA table. Extracted DNA from A. ostenfeldii Bahme 136 showed high levels of purity in both samples, determined by the ratio A260/280, in which case a ratio of 1.8 to 2.0 implies that there are no contaminants in the DNA sample. The purity of the DNA extracts in all other A. ostenfeldii strains was low.

Table 3. NanoDrop quantification and quality of the DNA extracted from A. ostenfeldii strains using Qiagen Generation Capture Column Kit.

Species/ strain

DNA concentration (ng/µL)

Purity of DNA (A260/280)

A. ostenfeldii Bahme 136 (1)

9.63

1.94

A. ostenfeldii Bahme 136 (2)

10.07

2.00

A. ostenfeldii FAL50 (1)

5.51

3.87

A. ostenfeldii FAL50 (2)

3.45

2.23

A. ostenfeldii UW516 (1)

4.99

2.00

A. ostenfeldii UW516 (2)

6.35

1.48

To try and improve the concentrations and purities of DNA recovered a different DNA extraction method, was used, in this case, a Qiagen DNeasy blood and tissue kit. High concentrations of DNA were recovered for A. minutum FAL18, A. tamarense UW475 and A. ostenfeldii UW516. Low DNA concentrations were retrieved for the other Alexandrium species/strains. High levels of purity were also only found in A. ostenfeldii UW516 and A. minutum FAL18.

Table 4. NanoDrop quantification and quality of the DNA extracted from Alexandrium species/strains using Qiagen DNeasy blood and tissue kit.

Species/ strain

DNA concentration (ng/µL)

Purity of DNA (A260/280)

A. ostenfeldii Bahme 136

4.73

2.63

A. ostenfeldii FAL50

2.66

1.60

A. ostenfeldii UW516

9.41

1.78

A. minutum FAL18

22.93

1.83

A. tamarense UW475

12.62

1.36

A. tamarense UW457

2.65

-1.65

A. minutum UW529

3.42

1.65

The extraction was repeated using the Qiagen DNeasy blood and tissue kit on a number of Alexandrium species in (table). The concentration and purity of the DNA extracted from A. ostenfeldii Bahme 136 and A. tamarense UW457 was high, but was significantly lower for the other two species.

Table 5. NanoDrop quantification and quality of the DNA extracted from Alexandrium species/strains using Qiagen DNeasy blood and tissue kit.

Species/ strain

DNA concentration (ng/µL)

Purity of DNA (A260/280)

A. ostenfeldii Bahme 136

16.93

1.91

A. ostenfeldii FAL50

4.53

1.29

A. tamarense UW457

21.30

2.01

A. minutum UW529

3.30

1.40

Results of polymerase chain reactions

The first PCR assay performed was to check if the designed primer would anneal to A. ostenfeldii.

In this case, a PCR product of approx 220bp in length was obtained for A. ostenfeldii UW516 figure. An absent band on the gel for A. ostenfeldii Bahme 136 shows that no PCR product was obtained. A clear blank shows that there was no DNA contamination.

10

9

8

7

6

5

4

2

1

3

Figure 2. The image shows the breakdown of the Hyperladder V DNA ladder on an agarose gel.

Hyperladder V band size 200bp

Size of PCR product approx 220bp

Figure 3. Gel image of the PCR assay carried out on A. ostenfeldii strains Bahme 136 and UW516. Lane 1, Hyperladder V DNA ladder; Lane 3, Alexandrium ostenfeldii Bahme 136; Lane 4, Alexandrium ostenfeldii UW516; Lane 6, Blank.

In the second PCR assay, the species specificity of the designed primers was analysed. A. ostenfeldii UW516 (positive control) produced a PCR product of approx 220bp in length. No PCR products were obtained for the other two A. ostenfeldii strains. For the other Alexandrium species/strains (lanes 6-9), there was also no product obtained. A clear blank showed that there was no DNA contamination.

4

10

9

8

7

6

5

3

2

1

Size of PCR product approx 220bp

Hyperladder V band size 200bp

Figure 4. Gel image of the PCR assay carried out on Alexandrium species/strains. Lane 1, Hyperladder V DNA ladder; Lane 3, Alexandrium ostenfeldii Bahme 136; Lane 4, Alexandrium ostenfeldii FAL50; Lane 5, Alexandrium ostenfeldii UW516 (POSITIVE CONTROL); Lane 6, Alexandrium minutum FAL18; Lane 7, Alexandrium tamarense UW475 Type III Western European; Lane 8, Alexandrium tamarense UW457 North America; Lane 9, Alexandrium minutum UW529; Lane 10, Blank.

In the third PCR assay, newly extracted DNA from Alexandrium species was analysed.

No PCR product was obtained for either of the Alexandrium samples. On the gel a large band can be observed in lane 8, which shows DNA contamination in the blank.

10

9

8

7

6

5

4

3

2

1

DNA contamination in the blank

Hyperladder V band size 200bp

Figure 5. Gel image of the PCR assay carried out on Alexandrium strains in the table. Lane 2, Hyperladder V DNA ladder; Lane 4, Alexandrium ostenfeldii Bahme 136; Lane 5, Alexandrium ostenfeldii UW516; Lane 6, Alexandrium tamarense UW457 North America; Lane 7, Alexandrium minutum UW529; Lane 8, Blank.

Results of Real-time PCR

A two-step real-time PCR was performed on the extracted DNA from A. ostenfeldii strains Bahme 136, UW516 and FAL50. Five ten-fold dilutions of UW516 were used to construct a standard curve to measure the efficiency off the assay reaction. Full strength and 1 in 10 dilutions were carried out for A. ostenfeldii strains Bahme 136 and FAL50. All samples in the assay were carried out in duplicate (Table 6).

Figure 6. Amplification graph of the two-step real-time PCR carried out on A. ostenfeldii strains Bahme 136, UW516 and FAL50. The graph shows that the intensity of the SYBR green fluorescence signal increases with increasing RT cycle number forming characteristic sigmoid shaped curves. As an increase in fluorescence is proportional to an increase in the amount of PCR product, it shows that the DNA samples used in the real-time assay have all been successfully amplified using the species-specific primers.

Table 6. A. ostenfeldii strains and dilutions used in the real-time assay, calculated Ct values and the percentage difference between the given DNA concentration and the calculated concentration.

Real-time PCR standard curve

Figure 7. Real-time PCR standard curve of Ct values obtained from the serial dilutions against the Log serial dilution. Five 10 fold dilutions used to construct the standard curve as shown on the x - axis. R^2 Value: 0.94679; Slope: -2.5995; calculated percentage reaction efficiency: [10(1/-Slope)-1] Ã- 100 = 142.6%.

Figure 8. Real-time PCR standard curve of Ct Values against Log base 10 of serial dilutions.

A two-step real-time PCR was performed on the extracted DNA from A. ostenfeldii strains Bahme 136, UW516 and FAL50 and the other Alexandrium species/strains. Five ten-fold dilutions of UW516, Bahme136 and FAL50 were used to construct a standard curve to measure the efficiency off the assay reaction. Full strength and 1 in 10 dilutions were carried out for other Alexandrium species/strains. All samples in the assay were carried out in duplicate.

Figure 9. Amplification graph of the two-step real-time PCR carried out on A. ostenfeldii strains Bahme 136, UW516 and FAL50 and other Alexandrium species/strains. The graph shows that the DNA samples used in the real-time assay have all been amplified including the no template control due to DNA contamination.

Discussion

Alexandrium DNA extractions

The failure of a number of PCR reactions highlights the necessity to have DNA of good quality DNA (Wilson, 1997). From using two different commercial kits it was found that DNA concentration and quality varied between kit used, Alexandrium species and the volume of the culture used. High concentrations of extracted DNA were achieved when using the Qiagen DNeasy blood and tissue kit with 15 mL of harvested cells. This was probably due to the use of beads in the protocol, which disrupt and lyse the thecae (multiple membranes) of the Alexandrium species (Lilly et al., 2005).

Low recovery of DNA was found in all three extractions carried out for A. ostenfeldii FAL50. The likely cause is low FAL50 cell numbers in the F/2 culture.

For future work it is recommended that a cell count should be undertaken to establish the cell density of the culture and what affect this has on DNA recovery and yield.

Variations in the DNA purity ratios indicate the presence of proteins and purification contaminants from the extraction. The quality of DNA was improved by using Proteinase K in the Qiagen DNeasy blood and tissue kit. The Proteinase K digests proteins resulting in cell lysis, which are then removed from the extracted DNA during the purification process. For future work it is recommended that different extraction methods should be tested to determine the best method to use. Research carried out by Galluzzi et al. (2004), found similar variability in the concentration and quality of DNA extracted from commercial Qiagen kits. The duration of cell lysis with Proteinase K and bead beating should also be investigated. Dyhrman et al. (2005) achieved good results when cell lysis was carried out for four hours at a lower temperature and bead beated for three minutes.

Polymerase chain reaction

PCR assays were performed to test the species-specificity of the designed primers to A. ostenfeldii.

The species-specificity of the primers to A. ostenfeldii could not be determined using the PCR assays. The failures of the reactions were most likely due to the low DNA yields, poor DNA quality and possible inhibition factors (Wilson, 1997).

In the first PCR, a product of around 220bp was obtained for A. ostenfeldii strain UW516. This implies that the primers have annealed to and amplified successfully a region of DNA in this strain. The primers however did not amplify A. ostenfeldii strain Bahme 136, which was probably due to the low concentrations and poor purity of the extracted DNA.

In the second PCR, the species-specificity of the primers was checked by comparing with DNA extracted from other Alexandrium species/strains. A PCR product was obtained for the positive control (A. ostenfeldii UW516), but was absent in A. ostenfeldii strains Bahme 136 and FAL50. The low amount of DNA extracted from the two strains, 4.73 ng/µL from Bahme 136 and 2.66 ng/µL from FAL50 compared to 9.41 ng/µL extracted from strain UW516, was identified as a possible explanation for why the primers were not annealing to the DNA. No bands were obtained for the other Alexandrium species/strains carried out in the assay. As there was no PCR product obtained for A. ostenfeldii strains Bahme 136 and FAL50, the species-specificity of the primers cannot be determined.

DNA was extracted again from A. ostenfeldii strains Bahme 136 and FAL50 and from Alexandrium tamarense UW457 North America and Alexandrium tamutum UW529. This was to try and improve the yield and purity of the DNA.

A third PCR assay was carried out, but was inconclusive. No PCR product was obtained for either of the A. ostenfeldii strains and there was DNA contamination in the negative control (blank). A band in the negative control was probably caused by DNA contamination in the molecular grade water, which was used to make up the PCR master mix. The primers annealed to and amplified the DNA contaminant, which was seen as a band on the electrophoresis gel. For future work it is recommended that the PCR is carried out using DNA with a higher concentration and better quality.

Real-time PCR

A real-time PCR assay was applied to check if the designed primers would amplify the two A. ostenfeldii strains, which had not been amplified in the normal PCR.

An amplified PCR product was obtained, which implies that the primers have annealed successfully to the DNA of the three A. ostenfeldii strains. However a melt-curve analysis was not run after the real-time PCR reaction and so the DNA products that have been amplified cannot be determined. A melt curve analysis is important as SYBR Green can amplify any DNA that is present in the reaction such as primer dimers and DNA contamination (Galluzzi et al., 2004). For future work it is recommended that the real-time PCR assay is repeated with a melt-curve analysis.

A standard curve was constructed to determine the overall efficiency of the Real-time PCR assay. The percentage efficiency of the real-time PCR was calculated at 142.6%, which is greater than ideal efficiency of 95-105% and so indicates the presence of inhibitors in the real-time assay and pipetting errors. The linear standard curve (R^2 Value) of 0.94679, which is less than 1 indicating pipetting errors in the construction of the standard curve. DNA was diluted in a 1:10 dilution to investigate if inhibition factors (Erdner et al., 2010), such as reagents from the extraction kit, were inhibiting the annealing of the primers to the template DNA (Wilson, 1997). The Ct value increased in the 1:10 dilution of strain UW516, which indicates inhibition factors in the reaction. For future work it is recommended that the cause of the inhibition is investigated.

A further real-time PCR assay was carried out with the DNA extracted from A. ostenfeldii and the other Alexandrium species/strains. The real-time assay however was inconclusive as there was DNA contamination in the no template control (NTC), which amplified all of the DNA samples in the assay. Contamination was caused by DNA in the real-time PCR master mix.

Conclusion

Unfortunately due to time constraints a real-time PCR assay for the detection of A. ostenfeldii in sediment samples could not be developed. Understanding the reasons for why the experimental methods were unsuccessful, will be crucial for future development in this field.

References

Amzil, Z., Sibat, M., Royer, F., Masson, N., Abadie, E. (2007).

Report on the First Detection of Pectenotoxin-2,

Spirolide-A and Their Derivatives in French Shellfish Mar. Drugs, 5: 168-179.

Camacho, F., Rodríguez, J., Mirón, A., García., M., Belarbi, E., Chisti. Y., Grima, E. (2007). Biotechnological significance of toxic marine dinoflagellates. Biotechnology Advances, 25: 176-194.

Davidson, K., Bresnan, E. (2009). Shellfish toxicity in UK waters: a threat to human health? Environmental Health 2009, 8 (Suppl 1):S12. DOI:10.1186/1476-069X-8-S1-S12.

Diercks, S., Medlin, L., Metfies, K. (2008). Colorimetric detection of the toxic dinoflagellate Alexandrium minutum using sandwich hybridization in a microtiter plate assay. Harmful Algae, 7: 137-145

Dyhrman, S.T.,Erdner, D., Du, J.L., Galac, M., Anderson, D.M. (2006). Molecular quantification of toxic Alexandrium fundyense in the Gulf of Maine using real- time PCR. HarmfulAlgae, 5 (3): 242-250.

Erdner, D., Percy, L., Keafer, B., Lewis, J., Anderson, D. (2010). A quantitative realtimePCR assay for the identification and enumeration of Alexandrium cysts in marine sediments. Deep-Sea Research II, 57: 279-287

Galluzzi, L., Penna A., Bertozzini, E., Vila, M., Garcés, E., Magnani, M. (2004).

Development of a Real-Time PCR Assay for Rapid Detection and Quantification of Alexandrium minutum (a Dinoflagellate). Applied Environmental Microbiology, 70: 1199 - 1206.

Gas, F., Baus, B., Pinto, L., Compere, C., Tanchou, V., Quéméneur, E. (2010). One step immunochromatographic assay for the rapid detection of Alexandrium minutum. Biosensors and Bioelectronics, 25: 1235-1239. DOI:10.1016/j.bios.2009.09.033.

Godhe, A., Otta, S., Rehnstam-Holm, A., Karunasagar, I., Karunasagar, I. (200). Polymerase Chain Reaction in Detection of Gymnodinium mikimotoi and Alexandrium minutum in Field Samples from Southwest India. Mar. Biotechnol., 3: 152-162, DOI: 10.1007/s101260000052.

Gonza´ lez, A., Rodrı´guez-Velasco, M., Ben-Gigirey, B., Botana, L. (2006). First evidence of spirolides in Spanish shellfish. Toxicon, 48: 1068-1074.

Gribble, K., Keafer, B., Quilliam, M., Cembella, A., Kulis, D., Manahan, A., Anderson, D. (2005). Distribution and toxicity of Alexandrium ostenfeldii

(Dinophyceae) in the Gulf of Maine, USA. Deep-Sea Research II, 52: 2745-2763

Hackett, J., Erdner, D., Anderson, D.M., Bhattacharyta, D. (2004). Dinoflagellates: A Remarkable Evolutionary Experiment. American Journal of Botany, 91(10): 1523-1534.

Kremp, A.., Lindholm, T., Dreßler, N., Erler, K., Gerdts, G., Eirtovaara, S., Leskinen, S. (2009). Bloom forming Alexandrium ostenfeldii (Dinophyceae) in shallow waters

of the Aland Archipelago, Northern Baltic Sea. Harmful Algae, 8: 318-328.

Lilly, E.L., Halanych, K.M., Anderson, D.M. (2005). Phylogeny, biogeography, and species boundaries within the Alexandrium minutum group. Harmful Algae, 4: 1004-1020.

Mansfield, B. (2003). Spatializing Globalization: A "Geography of Quality" in the Seafood Industry. Economic Geography, 79: (1) 1-16

Maso´, M., Garce´s, E. (2006). Harmful microalgae blooms (HAB); problematic and conditions that induce them. Marine Pollution Bulletin, 53: 620-630

Meilert, K., Brimble, M. (2006). Synthesis of the bis-spiroacetal moiety of the shellfish toxins spirolides B and D using an iterative oxidative radical cyclization strategy. Org Biomol Chem, 4: 2184-2192.

Sellner, K., Doucette, G., Kirkpatrick, G. (2003). Harmful algal blooms: causes, impacts and detection. J Ind Microbiol Biotechnol, 30: 383-406. DOI 10.1007/s10295-003-0074-9.

Smayda, T. (1997). Harmful algal blooms: Their ecophysiology and general relevance to phytoplankton blooms in the sea. Limnol Oceanogr, 42 (5): 1137-1153.

Wessells, C., Miller, C., Brooks, P. Toxic Algae Contamination and Demand for Shellfish: A Case Study of Demand for Mussels in Montreal. Marine Resource Economics, 10: 143-159.

Wilson, I. (1997). Inhibition and Facilitation of Nucleic Acid Amplification Inhibition and Facilitation of Nucleic Acid Amplification. Applied Environmental Microbiology, 63 (10): 3741.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.