Protein is a central component of the Inflammasome complex

Published:

Abstract

The NALP3 protein is a central component of the Inflammasome complex, Immune response and apoptosis process. NALP3 gene codes a pyrin-like protein that is associated with the functioning of inflammatory signaling pathways and its structure. It interacts with the activation of caspase 1 by the association of apoptosis speck like adaptor protein (ASC). Mutations in NALP3 gene by point mutation results in the activation of caspase 1 that leads over expression of IL-1β. This mutation causes auto-somal dominant inflammatory diseases like Familial Cold Auto Inflammatory Syndrome (FCAS), Muckle-Wells Syndrome (MWS) and Chronological Infantile Neurological Cutaneous and Articular Syndrome (CINCA). Mutation was created in NALP3 gene at 598th position from Valine to Methionine (V198M) by using efficient site-directed mutagenesis during Applied Biotechnology laboration. In this laboration, this mutant NALP3 gene was cloned and ligated into recombinant vector pEXP5CT/TOPO by TA cloning. It was transformed into competent cell BL21 (DE3) pLYSE expression system by heat shock to over express NALP3 gene and induced with IPTG to stimulate NALP3 protein production. The harvesting and analysis of NALP3 protein was held by SDS-PAGE and Western blotting. In SDS-PAGE, the protein bands are separated based on size and visualized by Commassie blue stain. To detect the protein bands on nitrocellulose membrane in Western blotting, it was blocked and incubated with specific antibody with substrate and observed for color change on the membrane. However no mutated NALP3 protein bands were observed on the membrane and the mutant NALP3 protein expression analysis was unsuccessful.

Introduction

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

The distribution and development of disease or inflammation caused by Pathogen Associated Molecular Patterns (PAMPs) by creating mutation in its genetic sequence or molecular level is a fundamental entity in molecular biology research. It has inferences extending from the genetic basis of complex diseases to the constancy of the molecular clock. This distribution of pathogenicity had been studied by two different approaches: mutagenesis experiments and the analysis of mutated amino acid sequence data (Eyre-Walker et al., 2007). The recognition of PAMPs and immune system occurred by particular recognition receptors called pathogen recognition receptors (PRRs). These are belongs to intra cellular caterpillar proteins called NLRs (Nod like receptors). In human genome, 22 different genes with carboxy terminal domain encode these NLRs. At N- terminal, a pyrin like domains structured with NLRs in humans also denoted as NALPs. These NALPs categorized into different forms- NALP1 and NALP2/3.

In all forms, NALP3 is an essential gene that plays important role in cellular defense mechanism. The NALP3 gene is interacts with apoptosis-associated speck like protein (ASC) or PYCARD - which contains a caspase recruitment domain and a member of NALP3 inflammasome complex. This inflammasome complex plays very important role in regulation of inflammation, the immune response and apoptosis (Bostanci et al., 2004). NALP3 gene encodes a pyrin-like protein containing pyrin domain, a nucleotide-binding site (NBS) domain and a leucine rich repeat (LRR) motif. NALP3 gene has been comprises into different forms - pyrin domain, NACHT domain and leucine rich repeat domain (LCC) and homologous to NALP1 that stimulates the caspase 1 and caspase -5. This stimulation leads to convert the inactive IL-1β into active IL-1β. It also involves in the production of other cytokines by the activation of transcription factor NFkB.

A mutation in NALP3/cryopyrin/CIAS1 gene is associated with 3 auto somal dominant inflammatory disorders - Familial cold auto inflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), and Chronic infantile neurological cutaneous and articular (CINCA) syndrome and neonatal-onset multisystem inflammatory disease (NOMID) (Hoffman et al., 2001) (Sutterwala et al., 2006). These autoimmune diseases caused by the changes in the amino acid sequence of NALP3 protein and observed many mutated sites by sequencing of NALP3 gene. During Genetic Engineering laboration, by using site-directed mutagenesis in NALP3 gene nucleotide sequence mutation was generated at position 592 i.e. from guanine to adenine. It results in change of amino acid sequence from V198M. This base substitution leads autoimmune inflammatory diseases - Muckle-Wells syndrome (MWS), Familial cold auto inflammatory syndrome (FCAS) and Recurrent fever in humans.

So this laboration is continuation to the GE lab and in this laboration the work has been distributed into two portions - Applied Biotechnology (AB) & Protein Biochemistry (PB). In AB lab, Cloning and Expression of mutated NALP3 gene was done where as in PB lab, the analysis of mutated NALP3 gene expression was done at protein level. Due to the modest sequencing results of GE lab, the cloning into TOPO vector by TA cloning and expression studies at protein level were carried by using mutated gene provided by lab supervisors.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

In AB lab, cloning of mutated NALP3 gene was done in Pexp5-CT/TOPO vector by TA cloning. It contains T7 promoter that involves in transcription by the help of T7 RNA polymerase and the translation is began by the RBS (ribosomal binding site) to harvest the protein. It also contains CAG (CMV/actin/globin) that allows 6X His-tagged protein expression in mammalian and bacterial cells and this protein also helps to identify the protein by using the enzyme labeled with anti His-tagged protein. Then the cloned mutant NALP3 gene was transformed into competent BL21 E. coli expression system. T7 promoter of TOPO vector is accepted by E. coli T7 RNA polymerase and lac promoter. In general, this promoter is not transcribed because the lac operator sequence that binds to lac repressor and i.e. important in promoter-operator induction. So these factors give pledge for the repression of T7 promoter in E. coli system. So to increase the recombinant protein production, added Isopropyl β-D-1-thiogalactopyranoside (IPTG) as an inducer to lac promoter and it induces lac promoter to release the enzyme T7 RNA polymerase. This helps in transcription and tranlation of T7 promoter and finally produces mutated NALP3 protein.

In PB lab, the expression of transformed mutant NALP3 protein was analyzed depends on the protein band size by using SDS-PAGE and confirmed the desired NALP3 protein by Western blotting.

The main objective of this laboration was the cloning of mutant NALP3 gene into TOPO vector, transformation of this recombinant TOPO vector into competent BL21 E. coli cells, induction by IPTG in BL21 cells and the analysis of mutated NALP3 protein production by SDS-PAGE and Western blotting.

Material and Methods

A plasmid pEXP5CT/TOPO vector containing desired mutated NALP3 gene (V198M) (provided by lab supervisors) was transformed into competent BL21 E. coli cells. Transformation procedure was carried by the protocol "Invitrogen One Shot® BL21 (DE3) Competent Cells (C6060-03)" (Invitrogen, 2010). BL21 E. coli cells were having chloramphenicol resistance and they were prepared by growing in 10ml LB broth containing chloramphenicol (34µg/ml) and incubated overnight at 370 C. From the overnight incubated BL21 E. coli broth, 1ml cells were taken into 50ml of pre-warmed LB medium with chloramphenicol (34µg/ml) incubated on rotary shaker until mid-log phase i.e. O.D. reaches 0.5 at 600nm measured by spectrophotometer. After incubation, cells were separated by Sorvall Super T21 Cold centrifuge for 5 min at 7200RPM. Then the cells were made competent by using the protocol "The QIA Expressionist" (Qiagen, 2003) and aliquoted into 200 µl of competent cells and stored finally at -700 C.

To get desired gene expression and protein NALP3 production, the recombinantly produced TOPO vector containing mutated NALP3 gene was transformed into prepared competent BL21 E. coli cells. After transformation, to select the positively transformed cells, they were allowed to grow in 50ml of pre-warmed LB broth having both Ampicillin (100µg/ml) and Chloramphenicol (34µg/ml). The media was incubated on rotary shaker at 200-250 rpm until mid-log phase that means O.D. reaches to 0.3 at 600 nm. After reaching optimal O.D. to get desired protein production, the media was induced by adding 1mM IPTG (Isopropyl β-D-1-thiogalactopyranoside) followed by the protocol "pEXP5-CT/TOPO® TA Expression Kit" (Invitrogen, 2006). To observe the protein production and growth, protein samples were collected at different time periods 0, 1 and 2 hr. and also collected one un-induced sample. Then they were centrifuged collected pellets and stored at -200 C for further protein analysis.

The stored protein sample pellets were analyzed by SDS-PAGE. To perform SDS-PAGE, 4% and 8% stacking and resolving gels were prepared by suitable reagents. Gel liquids were poured into gel slide chambers and wait for its solidification then placed in SDS-PAGE unit (Bio-RAD, USA) and loaded with running buffer. To denature the pellet, added 50µl of sample buffer containing SDS and heat incubated for 10 min. at 950 C. Then centrifuged at maximum speed for 3 mins and prepared 20 µl aliquots of supernatant and lamli buffer. Then loaded 10 µl of 250KDa standard ladder into each side and 20 µl of protein samples in an order 3hr, 2hr, 1 hr and un-induced. Protein samples were loaded in duplicates into 4% stacking gel containing SDS-PAGE wells. Then run the unit at 200V for 45 mins according to the protocol "Mini-PROTEAN® 3 Cell Instruction Manual" (Bio-RAD, USA) provided by lab supervisors. After running the gel, the stacking gel was removed and the running gel was cut into 2 equal parts containing all protein samples with ladder on each part. One is for Commassie blue staining and the other one is for Western blotting.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

One half of the gel was washed initially with water and incubated in Commassie blue staining solution on shaker for 1 hr. After incubation, washed the gel with water twice and observed the protein bands. In Western blot, the other part of the gel was blotted onto nitro cellulose membrane and covered the gel with filter papers and placed in blotting unit. Then run the unit at 70V for 1 hr. After running the blot, the membrane was blocked with 10ml of blocking solution containing 5% non-fat milk and incubated overnight. To this overnight incubated membrane, added 6ml of anti His C-terminal antibody (diluted 2500X) along with HRP conjugate that binds to His-tag at the end as chromogenic substrate according to the protocol "Novex Chromogenic Substrates" (Invitrogen, 2008).

Results and Discussion

In order to produce desired mutant NALP3 protein, mutation was created in NALP3 gene sequence at 592nd nucleotide position (V198M) by using mutagenic primer and site-directed mutagenesis. It was confirmed by PCR Sequencing and the sequence of mutated NALP3 gene is shown below. But unfortunately, sequencing results has discovered many other point mutated sites and not the desired mutation site.

ANGNNCACCGGNNNCCGCAGGNANAGGGAGCAGGNAGCTTCTGGCCATCGGCAAGNACCAAGACGTGTGAGAGCCCCATGAGTCCCATTAAGATGGAGTTGCTGTTTGACCCCGATGATGAGCATTCTGAGCCTGTGCACACTGTGGTGTTCCAGGGGGCGGCAGGGATTGGGAAAACAATCCTGGCCGGAAGATGATGTTGGACTGGGCGTCGGGGACACTCTACCAAGACAGGTTTGACTATCTGTTCTATATCCACTGTCGGGAGGTGAGCCTTGTGACACAGAGGAGCCTGGGGGACCTGATCATGAGCTGCTGCCCCGACCCAAACCCACCCATCCACAAGATCGTGAGAAAACCCTCCAGAATCCTCTTCCTCATGGACGGCTTCGATGAGCTGCAAGGTGCCTTTGACGAGCACATAGGACCGCTCTGCACTGACTGGCAGAAGGCCGAGCGGGGAGACATTCTCCTGAGCAGCCTCATCAGAAAGAAGCTGCTTCCCGAGGCCTCTCTGCTCATCACCACGAGACCTGTGGCCCTGGAGAAACTGCAGCACTTGCTGGACCATCCTCGGCATGTGGAGATCCTGGGTTTCTCCGAGGCCAAAAGGAAAGAGTACTTCTTCAAGTACTTCTCTGATGAGGCCCAAGCCAGGGCAGCCTTCAGTCTGATTCAGGAGAACGAGGTCCTCTTCACCATGTGCTTCATCCCCCTGGTCTGCTGGATCGTGTGCACTGGACTGAAACAGCAGATGGAGAGTGGCAAGAGCCTTGCCCAGACATNCAAAACCACCACCGCGGNGTACGTCTTCTTCCTTTCCAGTTTGNTGCANCCCCNGGGGAGGGAGCCNGGAGCCC

So, in this laboration, the desired mutated NALP3 gene present in the recombinant TOPO vector was provided by lab supervisors. Recombinant vector was produced by inserting desired mutated NALP3 gene at correct place and in correct direction recombinantly into the vector pEXP5CT/TOPO vector by TA cloning and the concentration 100ng/µl of plasmid was used for this TA cloning. To observe the mutated NALP3 gene expression, it was transformed into the Invitrogen One Shot® BL21 (DE3) Competent Cells.

To made BL21 (DE3) E. coli cells as competent, first they were cultivated in 10ml LB broth with the antibiotic chloramphenicol (34µg/ml) resistance and incubated overnight. Next day, immediately taken 1ml of BL21 E. coli cells into the 50ml of pre-warmed LB broth with chloramphenicol resistance then incubated continuously on rotary shaker until to reach the O.D. 0.5 at 600nm and taken readings for every 30 mins. Cell growth was stopped at mid-log phase; the O.D. is 0.3 and observed O.D. values are given in the following table 1. The growth curve was plotted below to the observed O.D. with respect to the time in hours.

Sr. No.

Time

in Hrs

Optical Density

1

0.5

0.01

2

1

0.03

3

1.5

0.07

4

2

0.08

5

2.5

0.09

6

3

0.09

7

3.5

0.13

8

4

0.19

9

4.5

0.23

10

5

0.32

Table 1: Competent cell Optical Density values with respect to Time.

Fig: 1 Plotted graph between O.D. (nm) and Time (hr). The graph depicts different optical density values were observed at different time intervals during the incubation of BL21 (DE3) pLYSE competent cell preparation. The graph is showing growth in cells until mid-log phase i.e. O.D. reaches 0.32 at 600nm. It is sufficient to prepare desired competent cell mass.

After incubation, cultivated BL21 E. coli cells were separated by cold centrifuger at 7200rpm for 5min and cells were made competent by adding the compound calcium chloride.

Then transformation procedure was followed according the protocol (Invitrogen, 2006) and transformed the mutant NALP3 gene containing TOPO vector into the competent BL21 E. coli expression system. To produce desired protein NALP3, the transformed cells were taken into 50ml of pre-warmed LB medium with both ampicillin (100µg/ml) and chloramphenicol (34µg/ml) resistance. The media was incubated on rotary shaker until the mid-log phase that means growth reaches to O.D. 0.3 at 600nm. At this phase, it shows numerous proteins were observed in the graph and was enough to the desired protein expression. So after reaching the O.D. 0.3, the media was induced by adding 1mM IPTG to the final concentration, observed the growth and taken the O.D. by spectrophotomer for the next 3 hours and plotted the graph between O.D. and time in hours are given below in Fig.2 and the O.D. values were shown in the following Table 2 & Table 3.

Sr. No.

Time

in Hrs

Optical Density

1

1

0.06

2

1.5

0.12

3

2

0.19

4

2.5

0.32

Table 2: Optical Density values with respect to Time before Induction with IPTG

Sr. No.

Time

in Hrs

Optical Density

1

3

0.65

2

4

0.99

3

5

1.17

Table 3: Optical Density values with respect to Time after Induction with IPTG

Fig 2: Depicts graph between O.D. (nm) and Time (hr). It shows different optical density values that were observed before and after induction with IPTG at different time intervals during the incubation of transformed mutant NALP3 gene containing BL21 (DE3) pLYSE E. coli expression system. The graph is showing well growth in cells and in production of protein after induction. The curve showing the attainment of exponential state before and after induction and it is sufficient to get minimum density protein expression.

IPTG plays key role leads to produce desired mutant NALP3 protein and its expression by inducing the lac promoter T7 to produce T7 RNA polymerase.

During the incubation at different time periods un-induced, 0, 1, 2 and 3 hour collected 1ml sample, centrifuged and saved the pellets at -200 C for further protein analysis by using SDS-PAGE and Western blotting.

So in order to analyze the expression of mutated desired NALP3 protein, the stored NALP3 protein pellet was denatured by adding sample buffer containing SDS. Then the denatured protein sample was centrifuged and the supernatant was loaded to the SDS-PAGE wells along with lamli buffer and standard ladder (250kD). Then run the gel at 70V for 45mins. Proteins were separated based on its molecular weight and size. After running the gel, the gel was stained with Commassie blue and observed protein bands that were shown in the following fig. 3 along with standard ladder.

Fig 3: Above picture shows the bands obtained from SDS-PAGE. The mutant NALP3 proteins were separated based on size and charge. Gel showing the protein bands of induced samples 3hr, 2hr, Un-induced as negative control with standard protein marker 250kD. Clear bands are appearing in 3rd & 2nd hr samples compared to un-induced sample that means protein expression has been occurred on gel during SDS-PAGE.

In the above gel picture, protein bands were observed according to their size and molecular weight. The bands were present on the gel as 3rd hr, 2nd hr induced samples, un-induced sample as negative control and standard ladder (250kD). Thick and clear bands were observed in 3rd and 2nd hr induced samples compared to un-induced sample. The molecular weight of mutant NALP3 protein is approximately 118kD and clear bands were observed just above to 100kD in ladder and assume that the desired mutant NALP3 protein has been expressed by induction. To confirm the NALP3 protein production on SDS-PAGE gel and for further protein analysis used the technique Western blotting.

To confirm the mutant NALP3 protein bands on the SDS-PAGE gel performed Western blotting at 70V for 1hr. In Applied Biotech lab, during TA cloning 6X His tag was inserted into mutant sequence in TOPO vector. So, anti His C-terminal antibody (diluted 2500X) along with HRP conjugate was used as main antibody to identify protein bands. So to visualize the mutant NALP3 protein bands on the membrane used Novex® Chromogenic Substrate (Invitrogen, 2008). But no protein bands were present on membrane and were clearly seen in the following Fig. 4.

Fig 4: Western blot result showing no bands were appeared on nitrocellulose membrane but clear bands of standard marker (250kD) were observed on the membrane that means protein was not present due to improper running of blot unit or improper binding with antibody.

According to the expected size of mutant NALP3 protein bands should be appear between 100kD and 120kD that means our desired mutant protein NALP3 was not expressed during Western blot.

So that, the entire experiment indicates, the protein expression was occurred after induction during SDS-PAGE but mutant NALP3 protein was failed to express during Western blotting. It might be occurred due to other reasons like the less incubation period during Western blotting, due to improper transformation process, improper handling during cloning of mutant NALP3 gene and wrong insertion of gene sequence that prevents to express protein properly and the mutation that was created and used non-specific and the usage of same gene for further experiment will not give correct results. So to overcome these problems, studying of other protocols or changing of protocol, usage of compatible chemicals in correct measurements and finally the handling of apparatus will provides to get good results.

Future Aspects

Mutant NALP3 protein studies can be used to determine the effects of mutation at protein level through studying of its properties, functions and biological role and also used for in vivo studies. The analysis of mutated proteins like NALP3 and its structure can be studied by using X-ray Crystallography, NMR spectroscopy. So that the diseases that are caused by this type of mutated NALP3 protein can be solved by creating cDNA library with possible mutations that are assoicated with possible diseases and also helps to study its functional abnormalities.