Primers Used For HCV Structural Genes Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

For the purpose of amplification of HCV structural genes Core and E1 the following forward and reverse primers were ordered (OligoTM, Macrogen) for HCV genotype 3a structural genes.

Table 3.1: Primers used for Cloning of HCV 3a structural genes Core and E1

Serial No.

Primer Name

Sequence

Primer Length

Temperature/Celsius

1

Core Forward

GGATCCAGGAGGATGAGCACACTTCCTAAACCTCA

35

76.6

2

Core Reverse

GCGGCCGCACTAGCTGCAGGATGAACTA

28

74.5

3

E1 Forward

GGATCCAGGAGGATGCTAGAGTGGCGGAATACGTCTG

37

80

4

E1 Reverse

GCGGCCGCGGCATCGACCCCTGAAAA

26

75.8

3.2 AMPLIFICATION OF HCV 3a STRUCTURAL GENES CORE AND E1

Polymerase Chain Reaction (PCR) was used to amplify HCV genotype 3a structural genes Core and E1.The reaction mixture contained 0.5 µL of DNA template, along with 2µL of gene specific forward and reverse primers for both core and E1 structural genes (10 pmol), 1µL of dNTP's (2.5 mM), 0.5 µL of Phusion Taq Polymerase (0.02U/µL) (Fermentas, USA) along with 10µL of Phusion HF Buffer (5X) and 35µL of nuclease free water, making a total reaction of 50µL individually for Core and E1. The PCR reaction mixture was then placed in a thermocycler. The following conditions were used for amplification.

PCR PROGRAM PROFILE FOR HCV 3a SRUCTURAL GENES CORE AND E1

Figure: Polymerase Chain Reaction (PCR) profile for amplification of HCV genotype 3a structural genes Core and E1

3.3 ANALYSIS OF PCR PRODUCT BY AGAROSE GEL ELECTROPHORESIS

To analyze the PCR products, 0.8% agarose gel was prepared and run in 1X Tris acetate EDTA (TAE) buffer. 50X TAE buffer (pH 8.3) was prepared initially as a stock solution by dissolving 18.6 g of EDTA (0.5M) pH 8.0, 28.5 ml of glacial acetic acid and 121 g of Tris base in 300 ml of distilled water and then the final volume was adjusted to 500 ml with distilled water. Working solution of TAE was prepared by diluting the stock solution. In order to achieve 1X TAE as the working solution 980 ml of distilled water was added to 20 ml of 50 X TAE stock solutions in a separate 1L bottle. For gel preparation, 0.8 g of agarose was dissolved in 100 ml of 1X TAE and heated in a microwave oven to dissolve agarose. The gel mixture was cooled to the degree that it could be held easily in a human hand and upon cooling 5 µL of ethidium bromide (10mg/mL) was added for detecting DNA. The entire 50 µL PCR reaction product was loaded into the well and run, along with 6X loading dyes (Fermentas, USA). This gel was run at a constant voltage of 90V for 50 minutes after which, it was visualized under ultra-violet light and photographed by gel documentation system.

3.4 GEL ELUTION OF PCR PRODUCT

DNA fragments obtained on the gel were excised and eluted using USB PrepEase Gel Extraction Kit (Catalog # 78756, Affymetrix,USA ). The fragments obtained were excised from the gel under UV light and transferred to a labeled eppendorf tube. The weight of the empty eppendorf tube was measured on a weighing balance. After transfer of excised gel fragments into the tubes, measurements were made again on the weighing balance. For every 100 mg of agarose gel slice 200 µL of the binding buffer was added after which the tube was given a 60 second spin in a micro centrifuge (Eppendorf, Minispin). The eppendorf tube was incubated at 50°C for 7 minutes and simultaneously vortexed at 11,000 rpm in a thermocycler in order to facilitate the melting process of gel. On completion of the melting process in the two separate eppendorf tubes, containing amplified fragments of the structural genes Core and E1, two PrepEase cleanup Columns were placed on top of two 2mL PrepEase Collecting tube. The mixture in the two tubes (melted gel + 200µL of binding buffer) for Core and E1 was loaded directly into the centre of the Cleanup Column. Samples were centrifuged for 1 minute at 11,000 rpm in the micro centrifuge. Flow through was discarded and PrepEase Cleanup Column was placed back onto collecting tube after which 600 µL of wash buffer was added directly into both the Cleanup columns separately. The samples were again centrifuged for 60 seconds at 11,000 rpm. The flow through discarded and the Cleanup Column placed back on top of the collecting tube. To remove excess of washing buffer, centrifugation of both the samples Core and E1 was carried out for an additional 2 minutes at 11,000 rpm in a micro centrifuge in order to ensure removal of all liquid. The flow through was discarded and cleanup columns were placed back on top of two new clean eppendorf tubes. 20-25µL of Elution buffer was added into each of the tubes separately. Both the samples were incubated at 37°C for 10 minutes, after which they were centrifuged for 2 minutes. The flow through obtained was added again to the PrepEase Column and spun down again for an additional 2 minutes, to ensure complete elution of the sample. The eluted product obtained was stored at -20°C until further processing.

3.5 CLONING INTO ZERO BLUNT® TOPO® PCR CLONING KIT:

3.5.1 Ligation into pCR -Blunt II-TOPO Vector:

Ligation of PCR amplified fragment was done in pCR -Blunt II-TOPO vector supplied with the Zero blunt TOPO PCR cloning kit (InvitrogenTM) according to the instructions supplied. For ligation the following mixture below was prepared to carry out the TOPO Cloning reaction.

Serial #

Reagent

Amount /µL for Core

Amount/µL for

E1

1

Fresh eluted PCR product

3

2

2

Salt Solution

1

1

3

pCR II-Blunt- TOPO

0.5

0.5

4

Water

1.5

2.5

5

Final volume

6

6

The amount of fresh eluted PCR product added to the ligation mixture varies as it depends on the quality of the gel elution performed. The ligation reaction was mixed gently and incubated at room temperature (22-23°C) for a period of 5 minutes.

3.5.2 Preparation of Competent Cells E.coli

For inoculation of bacterial cells, Luria-Bertani (LB) media was first prepared. The media was formulated such that it contained 1% tryptone, 0.5% yeast extract and 0.5% NaCl in 1L of distilled water. The pH was adjusted to 7.5 using NaOH, and the media sterilized by autoclaving. A single colony of Top-10 cells (Escherichia coli strain) was picked from a nutrient agar plate and inoculated in 10 mL Luria-Bertani (LB) medium overnight at 37°C with constant shaking at 250 rpm in a shaking incubator. After 16 hours of incubation, 1.5mL of the culture was refreshed in 50mL LB medium and placed again in the shaking incubator at 37°C at 250 rpm for a minimum of 2 hours. The incubation time was confirmed until the optical density (OD600) was 0.4. When the desired OD600 was achieved, the culture was transferred into 50 mL centrifuge tubes and the tube placed on ice for a period of 30 minutes. Cells were then centrifuged at 4000 rpm for 15 minutes at 4°C in centrifuge 5810R (Eppendorf, Germany). The supernatant was discarded and pellet resuspended in 10mL of 1M MgCl2. Centrifugation for 10 minutes at 4°C was carried out again in order to pellet down the cells. Supernatant was discarded. Cells were resusupended in 10mL of 0.1M CaCl2 and again centrifuged at 4000 rpm for 10 minutes at 4°C. Supernatant was discarded and cells were resuspended in 10mL of 0.1M CaCl2, after which they were incubated on ice for 30 minutes. Cells were pelleted at 4000 rpm for 10 minutes at 4°C. Supernatant was discarded and the pellet resuspended in a solution comprising of 100 ml 0.1M Cacl2 with 10% glycerol. Then 100 µL of the cell suspension was dispensed into 3mL eppendorf tubes for single transformation reactions. The competent cells were stored at -80°C until needed.

3.5.3 Transformation of Ligated Product

Transformation was carried out using heat shock method (Woodcock et al. 1989). The entire 6µL ligation mixture (as described in section 3.5.1) was mixed with 50µL of competent cells under sterile conditions and incubated on ice for 30 minutes. Cells were heat shocked for 2 minutes at 42°C and then immediately transferred to ice for 5 minutes. 250µL of Super Optimal Broth (SOC) media (InvitrogenTM) was added to cells which were then placed horizontally at 37°C for an hour in a shaking incubator. The cells were then spun down for 2-3 minutes at 1000. 150 µL of supernatant was discarded and cells were resuspended in the remaining 100µL. The 100 µL which were spread under sterile conditions on a pre-warmed Kanamycin plate (50µg/mL) .Plate was left overnight in a 37°C incubator.

3.6 CLONE CONFIRMATION

Clone confirmation was carried out by carrying out gene specific PCR, restriction digestion and DNA sequencing of the pCR -Blunt II-TOPO clones. Clones resistant to kanamycin and hence harboring the plasmid were picked and grown in media containing kanamycin.

3.6.1 Plasmid Isolation

Plasmid DNA was isolated initially using manually prepared mini-prep solutions. A single colony was picked from the transformant plate and inoculated in a test tube with 5 mL kanamycin (50µg/mL) containing LB media and incubated overnight at 37°C with constant shaking at 120 rpm in a shaking incubator. The pre-inoculums of Core and E1 from the test tubes were transferred to 3mL eppendorf tubes the next day. The bacterial culture was harvested at 3600 rpm for 10 minutes at 4°C, by placing the eppendorf tubes in a mini centrifuge machine. Supernantant was discarded and pellet re-suspended in 250 µL of re-suspension buffer. The mixture was vortexed to ensure that no cell clumps remained. Afterwards, 250µL of Lysis solution was added and mixed thoroughly by inverting the tube 4-6 times until a homogeneous suspension containing an off-white flocculate was formed. The suspension was left at room temperature for less than 5 minutes. This was followed by addition of 300µL of Neutralization Buffer solution into the eppendorf tube. The eppendorf tubes were inverted 4-6 times in order to ensure complete mixing and they were then placed on ice for at least 5 minutes. The tubes were then centrifuged at 13,000 rpm for 5 minutes at 4°C. The supernatant was transferred into a new clean autoclaved eppendorf tube. To this, 500 µL of isopropanol was added and the mixture centrifuged for 30 minutes at 13,000 rpm at 25°C. The supernantant was discarded and the DNA precipitated was washed with 500 µL of 70% ethanol and dried. The pellet was re-suspended in 20 µL of double distilled water and eppendorf tube stored at -20°C until use. Before storage, 1 µL of mini-prep DNA were loaded in separate wells, on 0.8% agarose gel to check the quality of the purified plasmid.

3.6.2 Restriction Digestion of Plasmid DNA

Purified plasmids were double digested with HindIII and XhoI (FastDigest® Restriction Enzymes, USA) as the vector contains these restriction sites on both sides of the cloned gene. The isolated plasmid (5 µL) of both Core and E1 gene separately, was treated with 10 units of enzyme Hind III (0.5 µL) and Xho I (0.5 µL), 1 X Buffer R (2 µL) and nuclease free water (12 µL). The entire 20 µL reaction for both Core and E1 placed in separate eppendorf tubes was incubated at 37°C for 1 hour and products revealed on 0.8% agarose gel which contained ethidium bromide for easy visualization of DNA under UV light.

3.6.3 Gene Specific PCR:

The insert was confirmed by carrying out gene specific PCR. Five separate reaction mixtures were prepared and contained the following:

CORE:

Serial #

Ingredients

Core positive control

Plasmid Isolated

Negative control

1

DNA template

0.5

1

_

2

Forward Primer

2

2

2

3

Reverse Primer

2

2

2

4

dNTP's

1

1

1

5

Taq. Polymerase (Fermentas, USA)

0.3

0.3

0.3

6

10X Buffer

2

2

2

7

MgCl2

2.4

2.4

2.4

8

Plasmid Isolated

_

1

_

9

Nuclease free water

9.8

8.3

10.3

10

Total volume

20

20

20

E1:

Serial #

Ingredients

E1 positive control

Plasmid Isolated

Negative control

1

DNA template

0.5

1

_

2

Forward Primer

2

2

2

3

Reverse Primer

2

2

2

4

dNTP's

1

1

1

5

Taq. Polymerase (Fermentas, USA)

0.3

0.3

0.3

6

10X Buffer

2

2

2

7

MgCl2

2.4

2.4

2.4

8

Plasmid Isolated

_

1

_

9

Nuclease free water

9.8

8.3

10.3

10

Total volume

20

20

20

Note: The negative control reaction mixture was made in order to check for contamination.

PCR PROGRAM PROFILE FOR THE ABOVE REACTIONS

Figure: Polymerase Chain Reaction (PCR) profile for amplification of HCV genotype 3a structural genes Core and E1 in the plasmid isolated.

After PCR, each sample was loaded on a 0.8% TAE agarose gel to check if the gene of interest was amplified. Image was captured using the gel documentation system.

3.6.4 Sequencing

The plasmid isolated in 3.6.1 before being sent to MacrogenTM, USA for sequencing with universal M13 forward and reverse primers was column purified by following the protocol of ZR Mini-Prep Classic Kit (Catalog # D4015) mentioned in section 3.7.3 .

3.7 LIGATION OF HCV GENOTYPE 3a STRUCTURAL GENES CORE AND E1 IN EXPRESSION PLASMID OF T-REX SYSTEM (INVITROGEN):

3.7.1 Preparation of Competent Cells E.coli

The same protocol mentioned in section 3.5.2 was carried out.

3.7.2 Transformation of pcDNA 4/TO/myc-His C expression vector of the T-REX System:

Transformation was carried out using heat shock method (Woodcock et al. 1989). 10ng (0.2µL) of the expression vector, supplied with the T-REX System (InvitrogenTM) was mixed with 50µL of competent cells under sterile conditions using same protocol mentioned in section 3.5.3 was performed

3.7.3 Plasmid Isolation

Plasmid DNA was isolated using the protocol of ZR Mini-Prep Classic Kit (Catalog # D4015). A single colony was picked from the transformant plate and was inoculated in a test tube with 5 mL Ampicillin (50µg/mL) containing LB media and incubated overnight at 37°C with constant shaking at 120 rpm in a shaking incubator. The pre-inoculum of pcDNA 4/TO/myc-His C from the test tube was transferred to 3mL eppendorf tubes. The bacterial culture was harvested at 3600 rpm for 1-2 minutes at 37°C, by placi ng the eppendorf tubes in a minispin. The supernantant was discarded. The pellet was re-suspended 200 µL of P1 Buffer solution. The mixture was vortexed to ensure that no cell clumps remained. Afterwards 200 µL of P2 solution was added and mixed thoroughly by inverting the tube 4-6 times. Cells are completely lysed when the solution appears clear, purple and viscous. The suspension was left at room temperature for less than 5 minutes. This was followed by the addition of 400 µL of P3 solution into the eppendorf tube. The eppendorf tubes were inverted 4-6 times in order to ensure complete and thorough mixing. The solution turns yellow when neutralization is complete. Incubate the tubes at room temperature for 1-2 minutes. The tubes were then centrifuged in the minispin for 2-3 minutes at 3600 rpm. Afterwards a Zymo-Spin™ column was placed on a Collection tube and the supernatant obtained was transferred through the column. The Zymo-Spin™ IIN/Collection Tube assembly was centrifuged for 30 seconds. Flow-through obtained in the Collection Tube, is discarded and the Zymo-Spin™ IIN column is returned to the Collection Tube. Then 200 μl of Endo-Wash Buffer was added to the column and the column was spin down for 30 seconds. Afterwards 400 μl of Plasmid Wash Buffer was added to the column. Centrifuge for 1 minute. The column was transferred into a clean 3 ml eppendorf tube and then 15 μl of; DNA Elution Buffer was added to the column. Centrifuge for 30 seconds in order to elute the plasmid DNA. The eppendorf tube is afterwards stored at -20°C until further processing. Before storage, 1 µL of each mini-prep loaded on 0.8% agarose gel to check the quality of the plasmid isolation.

3.7.4 Restriction Digestion of Plasmid DNA containing Structural Genes Core and E1 as well as T-REX System Expression Vector pcDNA 4/TO/myc-His C:

To produce sticky ends in order to ensure efficient ligation separately, of HCV 3a structural genes Core and E1 with the expression vector pcDNA 4/TO/myc-His C of the T-REX System, the plasmid DNA isolated in 3.6.1 and the plasmid DNA isolated in 3.7.3 were subjected independently to double digestion with BamHI (BioLabs.Inc) and NotI (BioLabs.Inc) as both the vectors contain the restriction sites for these enzymes. The following reaction mixtures were made:

Plasmid DNA Isolated in 3.6.1:

Serial #

Ingredients

Reaction for tube having Plasmid DNA containing Core as gene of interest

1

Isolated Plasmid DNA

18µL

2

Bam HI

1.5µL

3

Not I

1.5µL

4

Buffer 3 (10X)

2.5µL

5

Nuclease Free water

1.5µL

6

Final Volume

25µL

Serial #

Ingredients

Reaction for tube having Plasmid DNA containing E1 as gene of interest

1

Isolated Plasmid DNA

18µL

2

Bam HI

1.5µL

3

Not I

1.5µL

4

Buffer 3 (10X)

2.5µL

5

Nuclease Free water

1.5µL

6

Final Volume

25µL

Plasmid DNA Isolated in 3.7.3:

Serial #

Ingredients

Reaction for tube having Plasmid DNA containing pcDNA 4/TO/myc His-C

1

Isolated Plasmid DNA

20µL

2

Bam HI

1.5µL

3

Not I

1.5µL

4

Buffer 3 (10X)

3µL

5

Nuclease Free water

4µL

6

Final Volume

30µL

The entire reaction mixture for all three reactions placed in separate eppendorf tubes was incubated at 37°C for a period of 2 hours and later on confirmation was made by resolving the digested product on 0.8% agarose gel. The gel was stained with ethidium bromide and visualized on gel documentation system under UV light.

3.7.5 GEL ELUTION

DNA fragments obtained on the gel were excised and eluted using USB PrepEase Gel Extraction Kit (Catalog # 78756, Affymetrix,USA ) as mentioned in section 3.4.

3.7.6 Ligation of Eluted Products

Ligation of Core and E1 fragments obtained separately after elution was carried out with the T-REX System expression plasmid pcDNA 4/TO/myc His-C also obtained after elution. Both eluted products have ends for BamHI (BioLabs. Inc) and NotI (BioLabs.Inc). For ligation, the molar ratio for insert: vector was 3:1. The complete 20 µL reaction mixture listed in the table was prepared and left overnight in a water bath set at 14°C.

CORE

Serial #

Components

Ligation Reaction of Core gene with pcDNA 4/TO/myc His-C

1

Eluted Product (Core)

3µL

2

Eluted Product (pcDNA 4/TO/myc His-C)

6µL

3

T4 DNA Ligase (Fermentas)

1µL

4

Buffer (10 X)

2µL

5

Nuclease free water

8µL

6

TotalVolume

20µL

E1

Serial #

Components

Ligation Reaction of E1 gene with pcDNA 4/TO/myc His-C

1

Eluted Product (E1)

3µL

2

Eluted Product (pcDNA 4/TO/myc His-C)

11µL

3

T4 DNA Ligase (Fermentas)

1µL

4

Buffer (10 X)

2µL

5

Nuclease free water

3µL

6

Total Volume

20µL

Control

Serial #

Components

Control

2

Eluted Product (pcDNA 4/TO/myc His-C)

2µL

3

T4 DNA Ligase (Fermentas)

1µL

4

Buffer (10 X)

2µL

5

Nuclease free water

15µL

6

Total Volume

20µL

3.7.7 Transformation of Ligation Reaction

Transformation was carried out using heat shock method (Woodcock et al. 1989) using the same protocol mentioned in section 3.5.3

. 3.7.8 Plasmid Isolation

Plasmid DNA was isolated using the protocol of ZR Mini-Prep Classic Kit (Catalog # D4015) as mentioned in section 3.7.3.

3.7.9 Restriction Digestion of Plasmid DNA

Recombinant plasmids (i.e. those harboring the desired insert) were confirmed by restriction analysis BamHI (BioLabs.Inc) and NotI (BioLabs.Inc), as the vector contains these restriction sites on both sides of the cloned gene. The isolated plasmid (1 µL) of both Core and E1 gene separately, was treated with 10 units of enzyme Bam HI (0.5 µL) and Not I (0.5 µL), 1 X Buffer R (2 µL) and nuclease free water (16 µL). Reactions were incubated at 37°C for 2 hours and products were analyzed on 0.8% agarose gel containing ethidium bromide for easy visualization under UV light.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.