potato leaf roll polerovirus (PLRV)

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Among all the potato viruses, potato leaf roll polerovirus (PLRV) is most common and serious and causes significant losses in yield. It is associated with phloem necrosis and degeneration of seed-tubers and resulting in frequent replacement of seed stocks. ds. Meristem culture in combination with thermo and chemotherapy was successfully applied to eliminate PLRV in four potato varieties; Desiree, Diamant, Cardinal and Sante. The plants were indexed by DAS-ELISA and RT-PCR. Nodal cuttings were cultured and incubated in MS-media. Meristem culture alone gave upto 31% and thermotherapy at 37±2ºC for 40 days upto 51.9% PLRV elimination. Chemotherapy was undertaken with Ribavirin (RBV) and 5-Azacytidine (AZA) at concentrations of 20-40mg/L. The RBV eradicated virus to the highest extent of 45% as compared to 42.9% by AZA used at 40mg/l concentration. Combined effect of thermo- and chemotherapy was found better for PLRV elimination, which gave upto 64% with RBV and 58.0% with AZA. Best results were achieved with meristem culture coupled with thermo-and chemotherapy which showed 90% virus eradication with RBV and 80.6 % with AZA at 40mg/L concentration.

Potato (Solanum tuberosum L.) is one of the important and leading cash crops in Pakistan. It is grown on about 1.1 million hectares with an annual production of 1.93 million tones yielding about 18 tons/ha (Anonymous, 2005). The national yield is very low as compared to that in many European and other countries which harvest 40-100 ton/ha (Williams et al., 1994). The low yields and heavy losses inflicted in potato may be attributed, among other factors, to poor seed quality caused by three viruses i.e. potato leaf roll polerovirus (PLRV), potato potexvirus X (PVX) and potato potyvirus Y (PLRV) In Vitro Elimination of Potato Leaf Roll Polerovirus from Potato Varieties 156 High virulence of these viruses, continuous introductions of the viruses through imported seeds, recurrent occurrence of the carrier/vector of some of these diseases, non-availability of chemical substances are the main impediments in directly controlling viral diseases in the field (Ahmad and Ahmad, 1995). None of the available high yielding commercial varieties or advance lines in Pakistan has shown durable resistance against these diseases (Qamar et al., 2003). PLRV is the type member of the genus Polerovirus and belongs to the family Luteoviridae, has a monopartite, non-polyadenylated RNA genome of ~6 KB. Some basic properties of a field isolate of PLRV in Pakistan were studied by (Arif et al., 1995). The virus has been spreading very fast in Pakistan, Mirza (1978) and now prevalent throughout the country reaching an incidence of 15-65% (Mughal et al., 1988).which was confirmed in frequent surveys by Jan & Khan 1995. Apart from causing degeneration of seed stock and poor productivity, it also decreases the vigour and predisposes potato plants to other diseases (Silberschmidt, 1937; Sanger et al., 1988). Therefore, increasing demand for high-quality virus-free seed potato remains one of the challenges and costly aspects of potato production. Elimination of plant viruses has been successfully achieved owing to their mode of replication and mechanism of movement within the plant. Three methods are currently in use, thermo therapy, chemotherapy and tissue culture. Although heat therapy has been widely used in the elimination of plant pathogens, it was not until 1949 that the first successful heat treatment of a virus infected plant was reported (Kassanis 1949). However, only during the late 1960's, more than 70 viruses were reported to have been inactivated in plants by heat treatment (Nyland and Gohen 1969). The effect of heat on viruses is not well understood but it is believed to be effective in inhibiting viral replication and synthesis of movement proteins mainly by blocking transcription (Mink, et al., 1998). Virus elimination in the infected propagative material is best achieved from thermo- and chemotherapy coupled with meristem culture especially when meristem culture alone fails (Kartha, 1986; Mellor and Stace-Smith, 1977). These methodologies allow quick propagation of plant material, producing healthy plants from a single individual in a short period of time, regardless of location or season of the year. Thermotherapy can be carried out on mother plants before meristem excision, or directly on in vitro meristem cultures. Recently, some antiviral agents alone (Klein and Livingston 1983, Toussaint et al., 1993) or in combination with meristem culture (Cassels, 1987; Klein and Levington 1982) have been effectively used in the elimination of a number of viruses (Klein and Livingston 1983, Toussaint et al., 1993). These compounds were initially administered to humans and animals. However, because of their broad-spectrum activity, their use has been extended to plant viruses as well. They can be directly sprayed on the crop or included in tissue culture medium and upon uptake by the plant; they inhibit virus replication. Compounds such as Ribavirin (Hansen and Lane, 1985; Griffiths et al., 1990; Chen and Sherwood, 1991; Toussaint et al., 1993; Prasada Rao et al., 1995), 5-Azacytidine (AZA) and 3-Deazauridine (DZD) (Dunbar et al., 1993) have been successfully utilized for virus elimination in economically important crops, such as potato, peanut, apple and prunus spp. The success of the meristem-tip culture is judged by the percentage of plantlet regeneration and eradication of viruses (Mellor and Stace-Smith, 1977). In order to obtain a high yield of virus-free plantlets, factors such as meristem size, culture media, effect of thermotherapy and/or chemotherapy, and in vitro growing conditions have to be considered. The combination of meristem-tip culture with a strong certification program creates high standards, which result in healthy plant material. The experiments described in this study were aimed to eliminate potato viruses from the in-vitro plantlet stock and to boost production of virus-free seed.

Sample Collection:

PLRV-infected potato tubers were collected from Jassoky Farms, Okara, Pakistan. The tubers were planted in the field to obtain material for in vitro isolation. After sprouting, plantlets were tested by DAS-ELISA and RT-PCR to confirm the occurrence of single infection of PLRV. Infected tissues was harvested, preserved and used as positive control. In ELISA test, the supplier's 157 A. R. Awan, S.M.Mughal, Y. Iftikhar, and H. Z. Khan protocol (BioReba) was followed, reaction was stopped by adding 70_L of 3M NaOH, and the results were read in an ELISA reader at 405 nm.

RT-PCR was performed using primers designed for Capsid protein gene of PLRV. RNA from infected leaf samples was isolated by using “Gentra RNA Isolation kit” according to manufacturer protocol. cDNA was synthesized by denaturing 5µl RNA solution, containing 1mM dNTPs, 10pmol antisense primer for (PLRV) and water, for 5 minutes at 65 oC. Samples were imediately placed on ice and add to it 5X 1st strand buffer, DDT & 1 unit of (M-MLV). RT mix was subjected to two cycling conditions at 37 oC 50 minutes and 70 oC 15 minutes.

Polymerase chain reaction (PCR) was performed for which conditions were already optimised. A total volume of 20l, containing 10X PCR buffer (1.2mM MgCl2, 10mM tris-HCl pH 8.0), 1mM of each deoxyribonucleoside triphosphate (dNTP), 10pmoles of each forward (5'CGCGCTAACAGAGTTCAGCC3') and reverse (5'GCAATGGGGGTCCAACTCAT 3') primer, 1 unit Taq DNA polymerase and cDNA template, was used. It was overlaid by 20_l light mineral oil on the reaction mixture. To amplify DNA fragments of 336 bp from the cDNA of potato leaf roll virus (PLRV), PCR conditions for PLRV are as follow: one cycle of 5 min at 94 °C and 35 cycles (45 sec at 94 °C, 45 sec at 58 °C, 45 sec at 72 °C, followed by 10 min final extension at 72 °C in a thermocycler. A PCR mix without template was used as negative control. PCR products were separated by electrophoresis on a 1% agarose gel together with molecular weight marker (Fermentas), stained with ethidium bromide and visualised under UV light.

In Vitro Regeneration of Potato from Single Node Cuttings

The culture medium for maintaining PLRV positive stock was prepared with MS-basal medium (Murashige and Skoog, 1962) supplemented with 3% sucrose and 2.23gm/L agar, pH 5.7-5.8. Agar was added and melted by gentle heating, and poured into test tubes and autoclaved at 121ºC for 20 minutes at 15 psi. Single node cuttings about 1.0 cm in length having one bud, were taken from the PLRV- infected stock plants growing in greenhouse. These were immersed in 0.01% mercuric chloride (HgCl2) for a 10-minute period, followed by three washings with sterile distilled water. Explants were cultured individually and maintained at 252C under 16-hour photoperiod. The parameter studied were % Survival of the plantlet after being treated with antiviral Ribavirin; % virus elimination which was determined after analysis by ELISA and RT-PCR. The third visual parameter was plant health as phytotoxic effect of Ribavirin and thermotherapy. For each treatment a total of 32 plantlets were used. Control consisted of PLRV-infected plantlets of each cultivar, which were maintained and multiplied through single node cuttings. Virus titer was calculated by ELISA.

Meristem Culture

Apical meristem tips (domes with 1-2 leaf primordia) were excised in sterile conditions from in vitro plants and transferred to Petri plates on 10 ml of solid MS medium. Tubes were maintained in a growth cabinet (culture room) at 25 ± 2°C in dark conditions for 3 days, and then under standard illuminated conditions.

Chemotherapy

The Ribavirin (1--D-ribofurasonyl-1, 2,4 triazone-3-carboxamide; RBV) and 5-Azacytidine (4- amino-1--D- ribofuranosyl-5-triazin-21H-one; AZA) obtained from Sigma-Aldrich (St. Louis, In Vitro Elimination of Potato Leaf Roll Polerovirus from Potato Varieties 158 USA) were used in this study. Single nodal cuttings from PLRV-infected plants, replicated three times, were grown in culture medium set up as control and in a medium supplemented separately with RBV and AZA, at concentrations ranging form 20-40mg/L. Filter sterilized RBV and AZA were added in the autoclaved medium. A total 32 single node cuttings were utilized per treatment. After 2-months in antiviral containing medium, regenerated shoots were transferred to antiviral free medium. Regular MS medium was used as control. The phytotoxic effect was evaluated on the basis of plant growth and
mortality.

Thermotherapy

Thermotherapy was carried out in two cycles. First cycle contained 32 PLRV- ELISA and RT-PCR positive plantlets of each cultivar i.e; Desiree, Cardinal, Sante and Diamant, were submitted for 40 days to a continuous light and temperature regime of 37±2C. After heat treatment plantlets were subcultured and placed at 252C. Survived plantlets were graded according to stem size, number of leaves emerged i.e.; category-1 survived plantlets showing healthy growth habit. Plantlets attaining height of 6-8cm were analyzed for PLRV presence. Plants showing positive results for PLRV infection were given second thermotherapy treatment for another 40 days at 37±_C. Those plants showing negative results were separated and maintained through single node culturing at 252C.

Chemo- and Thermotherapies

Single node cuttings from PLRV-infected plants, transplanted in vitro, were grown in control medium and medium+ antiviral (RBV and AZA) sterilized by ultra filtration, and incubated at 37±2C, with a 16-hour photoperiod, where they remained for 30 days. 16 single node cuttings were utilized per treatment.

Meristem tip Culture Aided with Thermo- and Chemotherapy

Apical meristem culture was prepared in solid MS medium, as mentioned earlier (domes with 1-2 leaf primordia) supplemented with 20-40mg/l filter sterilized RBV and AZA. Meristems were also given heat treatments for 40 days at 37±°C until they were 2-3cm long.

Results

Detection of PLRV Infection

DAS-ELISA (Clarks and Adams, 1977) detected three potato viruses in the infected samples. From the total 21 samples tested 14 showed single infection of PLRV while remaining 7 showed mixed infections of PLRV, PVX and PVY, in different proportions. For molecular detection, total RNA was used in first-strand cDNA synthesis with the reverse primer. For PLRV, RT-PCR amplification of the Capsid Protein portion yielded a product with expected size of 336bp (Fig 1). This molecular test seems to be more sensitive than serological techniques as 88 91% of symptomatic collected samples were found to be infected by PLRV. In the in-vitro propagation from PLRV-positive plantlets, 150 plantlets were produced through single node cuttings. Out of 150 plantlets, 40 were of cv.Desiree; 35 of cv.Cardinal; 35 of cv. Diamant and 40 of cv. Sante. Percentage of virus (PLRV) titer found in control plantlets was 70, 65; 70 and 68% for Desiree, Cardinal, Diamant and Sante, respectively. Meristem culture alone gave 31%, 22%, 20.8% and 24% PLRV elimination as compared to control in Desiree, Cardinal, Diamont and Sante, respectively. PLRV, lanes 3 and 4= Amplified fragments of PLRV, and lane 5 as Negative PCR control and lane 6 as Negative control

Effect of Ribavirin

Ribavirin at 20-40mg/L) were combined with thermotherapy and meristem culture (Table1). Antiviral Ribavirin caused significant elimination of PLRV when compared with control. Percent virus elimination was 41%-45% for Desiree; from 35.2% to 44.7% in Cardinal; from 31.5% to 41% in Diamant and from 36.5% to 41.5% in. Sante. This increase in virus elimination was accompanied by decrease in % survival of the plant and short stature of plantlets (Table1).

Heat treatment caused significant reduction in PLRV titer as compared to control. The percent virus elimination was 44.7, 51.6, 46.5 and 46.2 in Desiree, Cardinal, Diamant and Sante, respectively. This decrease in virus titer was accompanied by decrease in % survival of the plants. It was observed that in all cultivars, plantlets showed stunted and retarded growth but after removal from stringent conditions, the plantlets became phenotypically normal compared to control. It was further observed that when heat treatment was combined with Ribavirin (20-40mg/L), virus titer was reduced to a significant concentration (table 1). PLRV elimination ranged from 51%-61% from 53.5% to 62%; from 51 % to 64 % and from 49.4% to 59 % in cv. Desire, Cardinal, Diamant and Sante, respectively. With the increase of concentration of Ribavirin from 20mg/l to 40mg/l, combined with thermotherapy, survival rate was decreased in all cultivars. PLRV-elimination was enhanced by 23% in Desiree; 14% in Cardinal, 24% in Diamant and 17% in Sante after antiviral treatment. In Vitro Elimination of Potato Leaf Roll Polerovirus from Potato Varieties 160

Effect of Azacytidine

The results on the effect of Azacytidine, used as an antiviral in eliminating PLRV are summarized in Table 2. It was observed that Azacytidine used in a concentration range of 20-40 mg/, eliminated the virus 32-38% in Desiree, 35.2-43.8% in Cardinal, 29.7-37.5% in Diamant and 38.5-42.9% in Sante. It was further noted that the survival percentage was decreased and plant height was affected in all the treatments as compared to control. Although thermotherapy alone showed reduction of PLRV titre, but significant results were achieved when it was combined with Azacytidine. In this case percentage virus elimination ranged between 47.9-51.1 in Desiree, 50.8-56.2 in Cardinal, 48.4-55.8 in Diamant and 52.5-58.0 in Sante Combination of thermotherapy, chemotherapy and meristem culture significantly reduced virus titre and virus elimination was 78% in Desiree, 80.6% in Cardinal, 70.1 in Diamant and 69.8% in Sante. Meristem culture is regarded as a potential and reference tool for the eradication of virus diseases (Faccioli and Marani 1998). This technique takes advantage that some viruses are unable to infect this region because of inhibition of replication and restriction of virus movement (Faccioli and Marani 1998). In this study, it was observed that the virus free-state of plants was low (20.8-31%) among all cultivars when meristem culturing alone was used and it also took several months to get plantlets. Meristem-tip culture combined with thermotherapy has been used to eliminate potato viruses PVX and PVS with varying degrees of success (Brown et al. 1988; Kassins 1957; Mellor and Stace-Smith 1977, 1987). Heat treatments at 38±2ºC decreased virus concentration (Kassins 1957; Quak 1977). Carvalho et al. (2002) used thermotherapy in combination with meristem culture to completely eliminate citrus tristeza closterovirus (CTV) and citrus exocortis pospiviroid (CEVd). They reported 60% elimination of these viruses with meristem culture alone but 100 % when combined with thermotherapy. Similarly, Thomson (1956) and Leonhardt et al. (1998) were able to eliminate plant viruses from in vitro regenerated plants at temperatures between 35 and 40ºC. Hussain and Rashid (1991) obtained on average basis 60.5% and the highest of 80% virus-free plants in Cardinal variety, Cheng Xu, and Chen (2002) established virus-free taro plants (Colocasia esulenta cv. fenghuayunaitou), and Nascimento et al. (2003) reported significant elimination of potato virus Y. Through this study, it was confirmed that the virus free-state of plants was low (20.8-31%) among all cultivars when meristem culturing alone was used and it also took several months to get plantlets, thermotherapy alone gave maximum 51% reduction in virus concentration, but the combined effect was highly significant. There are different explanations for this phenomenon; first being the competition among the rapidly dividing host cells, location of virus particles, synthesis of nucleic acids and proteins and change in the balance between the synthesis and degradation of virus particles. Another explanation is that under high temperatures, the union of the protein subunits protecting nucleic acid of the virus becomes weaker and temporal fissures appear which inactivate the virus and reduces its concentration due to activity of nucleases. Chemotherapy is being used in potato as an alternative to thermotherapy. We used two antiviral agents; Ribavirin and Azacytidine. Ribavirin gave 45%virus elimination whereas Azacytidine gave maximum 42.9% elimination of PLRV. Thus Ribavirin appeared to be more effective as compared to 161 A. R. Awan, S.M.Mughal, Y. Iftikhar, and H. Z. Khan Azacytidine. It was also observed that the antiviral agents used at 40mg/L concentration lead to maximum virus elimination. This was accompanied with decrease in % survival of the plantlets (Table 1and 2). These results are in good agreement with Griffiths et al. (1990) who reported elimination of PVX, PVS and PLRV with Ribavirin. Nascimento et al. (2003) also reported the significant reduction in PLRV titer when Ribavirin and Azacytidine were used as antiviral agent. The efficiency of Ribavirin in the elimination of plant viruses is already well documented in the literature (Simpkins et al., 1981; Vicente and De Fazio, 1987; Chen and Sherwood, 1991; Lizarraga et al., 1991; Fletcher et al., 1998). It, however, depends on the concentration of the antiviral agent, host plant and type of infected tissue. This substance has a broad spectrum of action against DNA or RNA viruses infecting man, animals (Sidwell et al., 1972) and plants (Dawson, 1984). In vitro culture and application of antiviral agents such as RBV, 5-AZA and 3-DZD have been successfully utilized in freeing potatoes from PVX, PLRV, PVY and PVM (Brown et al., 1988; Kleinhempel et al., 1990), and PVS (Kleinhempel et al., 1990). Combined effects of thermo-and chemotherapy were highly significant in eliminating PLRV. Treatments that include Ribavirin and thermotherapy gave max. 64% PLRV elimination while 58.0% when Azacytidine was combined with thermotherapy. Nascimento et al. (2003) reported upto 83% PLRV elimination when both the treatments Dunbar et al. (1993) eliminated peanut potymottle virus (PeMoV) from 36.0; 50.0; and 24.0% of peanut plants with the three tested antiviral agents. The difference in the percent elimination of PLRV using thermo- and chemotherapy in our findings and that of Nascimento et al. (2003) might be due to the sensitivity of our virus detection techniques i.e. RT-PCR while they used only ELISA. Virus elimination indices further support the use of thermotherapy and the addition of antiviral agents to the growth medium which offered best results for virus elimination in potato (Fletcher et al., 1998; Dodds et al., 1989). Similar findings were reported by Griffiths et al. (1990) when the antiviral RBV was added to the medium and plants were submitted to thermotherapy which reduced the concentration of PVY, PVX and PVS in the plants. In our experiments highest percentage of PLRV elimination was achieved which was 90%, 81% 92.5% and 85.5% in Desiree, Cardinal, Diamant and Sante, respectively. It is concluded from the above findings that combination of meristem culture, chemotherapy and thermotherapy are efficient techniques for PLRV eradication from potato and can be employed successfully in a virus free seed production programme. This study also demonstrated the usefulness of RT-PCR for direct detection of PLRV from total RNAs extracted from infected potato leaves and the technique could be used as a rapid laboratory assay for detecting PLRV from field samples. Singh (1998, 1999) has described RT-PCR-based methods as a powerful and reliable diagnostic tool of detecting PLRV.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.