Pcr And Impedance Methods Used In Food Safety Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Food safety, satisfaction and quality have always been an important concern of consumers. Several pathogens such as E. coli Shiga toxin and verocytotoxin-producers, S. aureus, etc are known as major human pathogens that are accountable of many diseases such as for mastitis, UTI, bloody diarrhea, haemorrhagic colitis and haemolytic uraemic syndrome in humans and constitute the most important causes of food-borne disease and therefore is a major health concern and is the most economically important disease of dairy industries around the world (Settanni et al, 2007). To detect these harmful pathogens, microbiological culture methods are used which are time consuming and species identification require more than 48 hours. Therefore many rapid methods to detect, differentiate, and identify pathogens in food have been developed which are safe, reliable, standardized, and above all achieve rapid results for safe food production within hours. Such methods include, PCR, microcalorimetry, impedance, turbidimetry, fluorimetry, reflectometry, and radiometry.

This essay will focus on two rapid microbiological methods namely PCR and impedance methods used in food safety and quality analysis, to monitor the microorganisms present in the food which are important for food industry.

PCR rapid method

Infectious diseases such as mastitis in cattle are caused by pathogen Staphylococcus aureus (S.aureus) which produces toxins. Due to the rise of this concern dairy products are diagnosed for prevention of pathogens in food. The commonly used standard methods for

detection of microorganism in food is biological culture method which has many disadvantages, one of the main one is it is time consuming and may take up to days to produce results and may not give accurate result of bacterial count yield and is unable to detect pathogens in presence of other residues (such as antibiotics, milk preservatives, etc). Therefore, PCR has been successfully used to identify various pathogens. PCR is a rapid method for detecting pathogens even in the presence of other residues and preservatives and are supposed to combat problems associated with selective cultivation and isolation of microorganisms from natural samples and are generally characterized by their simplicity, speed, cost-effectiveness , reliability, high species output, accurate results within hours rather than days (Settanni et al ,2007). In many performed experiments it has been shown that PCR is more sensitive and specific for pathogen and better than standard biological culture method (Ghorbanpoor, et al, 2007; Ahmadi et al, 2010 ).

Samples of milk were collected from cows in industrial dairy and transported to laboratory for detection of pathogen in milk by PCR method. First the DNA extracted from sample was centrifuged for 3-4 minutes and the supernatant was discarded and the pallet was re-suspended (Lampel et al, 2000) and washes with PCR buffer couple of times (Tris-EDTA buffer) until a clear solution was obtained. Lysozyme and proteinase K were added to the sample and the sample was then incubated at room temperature. The final DNA pallet was dissolved in 100ml of distilled water for using in PCR. PCR amplification was the next step carried out were specific primers (e.g. prfA- derived primers, PRFA1 and PRFA2, were applied for identification of Listeria monocytogenes, or S. aureus primers as shown in table 1) were used to detect the genes and proteins in bacteria that are responsible for causing the infection (Holko et al, 2002). One major concern when applying PCR for the detection of pathogens in foods is the false negative results i.e. the failure to detect a pathogen when present. This can occur as a result of interference with target-cell lysis during nucleic acid extraction, nucleic acid degradation, or direct inhibition of the PCR. Therefore a set of control primers are used to provide correct interpretation of PCR results ( Murphy et al, 2007). The PCR mixture comprising of DNA polymerase, MdNTPs, PCR buffer, extracted DNA, MGCL2 and sterile water were mixed in a 0.2 PCR microtube and the reaction was carried out in a PCR thermo cycler. Amplification was performed. The PCR products were electrophoreses in agarose gel and visualized by ultraviolet light transillumination (Ahmadi et al, 2010; Ghorbanpoor et al, 2007; Liming et al, 2004; Murphy et al 2007)).

Target

oligonucleotide

Sequence (5 - 3 )

Mgcl2 (Mm)

PCR product size (bp)

S. aureus

STAA- AUI

STAA-AUII

TCTTCAGAAGATGCGGAATA

TAAGTCAAACGTTAACATACG

2.0

420

Cytochrome B

BMC I

BMCII

CGATACATACACGCAAACG

TGTTGGGTTGTTGGAGCC

1.5

389

Table.1. Sequence of positive set of primers for identification of S. aureus (Ghorbanpoor et al, 2007).

Impedance rapid method

Impedance is the most successful rapid physiochemical methods used to detect food pathogens within 24 hours. Impedance method is not only used to detect bacteria but can also be used for monitoring the bacterial growth behaviour. It relies on electrical impedance measurement of a medium or a reaction solution resulting from the bacterial growth (electrolyte impedance and interface impedance) (Palchetti et al, 2008). Milk and dairy products can be easily contaminated with salmonella and other pathogens and so samples collected from dairy farms are tested for the presence of such harmful pathogens (Yang et al, 2003).One of the most studied pathogen is salmonella which is most prevalent in recent years and has been a major health concern as it causes many food borne illnesses in humans. To detect such pathogens in food samples various methods are used to detect these bacterial cell counts but not all methods are rapid neither accurate and most have detection limitations (low cell number).

Impedance method is the known rapid method that not only detects bacterial growth but also distinguishes between viable and dead cells, and can be performed direct or indirect using pair of microelectrodes. IM-6 impedance analyzer, water-jacketed glass vial (15 ml) containing 4.5 ml of broth is used as an incubator for Salmonella growth. In direct technique

the electrodes used are immersed in the reactant solution containing the bacteria which is to be tested (e.g. Salmonella) to directly measure the impedance change in the growth of bacteria. Bacteria cells attach to the electrode surface, and the live bacterial cells release ionic metabolites such as carbon dioxide and organic acids which causes an increase in the resistance. The effects of electrode materials and configurations on the impedance measurement suggested a significant role of electrode impedance in response to the bacterial growth. In indirect technique the electrodes are immersed in a separate solution (potassium hydroxide ( Yang et al, 2008). It can be expected that electrode (including its size, shape, materials, etc.) could be a significant factor for the performance of impedance measurement in the detection of bacterial growth. Over the years impedance method has received great attention in the area of electro analytical chemistry. Impedance showed higher sensitivities than conventional electrodes in electrochemical measurement of neurotransmitter .These research results indicate that electrode impedance is an important component in the total impedance and showed higher sensitivities than conventional electrodes in electrochemical measurement of neurotransmitter (Kleiss et al , 1995).

Conclusion

PCR method used identified and detected multiple microorganisms present in milk and dairy products in a single reaction and showed to have high sensitivity. Several specific primer sets are combined into a single PCR assay. Therefore, PCR is undeniably useful method to rapidly identify several isolates and it enables the selection of various species and represents the fastest culture-independent approach for strain-specific detection in complex matrices. It has been applied successfully in many fields of microbiology for faster identification, direct detection and differentiation of microorganisms with or without previous isolation and cultivation. Impedance method is the known rapid method that not only detects bacterial growth but also distinguishes between viable and dead cells, and can be performed direct or indirect using pair of microelectrodes. Since the impedance sensor was based on the detection of an electrical signal, it offers the advantage over optical detection for food samples, usually murky solutions. As compared to other methods it detects the pathogen bacteria without any need of pre treatment of food samples.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.