Parasitic Plants In Orobanchaceae Infest Economically Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Background

The parasitic plants in Orobanchaceae infest economically important crops to rob them water and nutrients. Despite their agricultural importance, the molecular mechanism involving the parasitism is poorly understood.

Results

We developed transient and stable transformation systems for the facultative parasitic plant Phtheirospermum japonicum using the hairy-root-inducing bacteria, Agrobacterium rhizogenes. The protocol was established by combination of sonication, vacuum and acetosyringone treatment using young seedlings as starting materials. Transgenic hairy roots of P. japonicum had visibly emerged from cotyledons 2-3 weeks after A. rhizogenes inoculation. The bacterial strains AR1193 and LAB 1334 showed higher efficiency compare with ATCC 15834. The presence and the expression of the transgene in P. japonicum were verified using genomic PCR, Southern blot and RT-PCR. Transgenic roots derived from A. rhizogenes-mediated transformation were able to develop haustoria on rice and maize roots. Transgenic roots also remained competent to form haustoria in response to DMBQ, a haustorium inducing chemical. Furthermore, the transformation protocol described here allowed us to visualize the cell division during the haustorium formation through Cyclin B1 promoter fused to a gene reporter construct.

Conclusions

We provide an easy and efficient method for hairy-root transformation of the parasitic plant P. japonicum. The transformation described here will allow functional analysis of genes involved in plant parasitism.

Background

Parasitic plants in Orobanchaceae are considered the most devastating agriculture pests [1]. They parasitize many important crops to rob them of nutrients and water, resulting in severe growth inhibition and yield losses [2]. The genus Striga infects 20 to 40 million hectares in sub-Saharan Africa, directly affecting the livelihoods of more than 300 million famers in over 25 countries with estimated losses of yield exceeding 7 billion USD annually [1, 3]. Similarly Orobanche infestations in the Mediterranean and West Asia, cause yearly crop losses valued at hundreds of millions of USD [4].

Parasitic plants invade their host via a specialized root structure, haustorium (plural: haustoria) [5]. Haustoria are initiated through a combination of contact with host root and chemicals haustorium inducing factors (HIF) [6, 7]. Recently was reported that quinone oxidoreductase (QR1) involved in single-electron reduction of NADPH is one of the earliest induced genes on the haustorium signal transduction pathway in parasite Triphysaria vesicolor [8]. In roots silenced for QR1 there was a significant decrease in haustorium development, showing that rapid ROS accumulation catalyzed by QR1 plays a crucial role in haustorium initiation [8]. Morphological features described on early haustorium ontogeny include rapid cessation of root elongation and the expansion and differentiation of epidermal cells into haustorial hairs. Thereafter the cortical cells begin an isodiametric expansion that leads to a visible swelling generally near to root tip. Epidermal cells near the apex of the bulge and the cortical cells comprising the swollen area begin to divide after the bulk of the haustorium is formed [9][41]

temporary cessation of root elongation, rapid cortical cell division and haustorial hair proliferation in T. versicolor [7, 11, 12]. The discovery of new genes involved in haustorium development will provide insights into how parasitic plants control the interaction with their host. Moreover, they represent potential intervention targets for engineering genetic resistance to parasitic weeds. With this propose Unlike Striga and Orobanche, most of facultative parasitic members in Orobanchaceae are not recognized as agricultural pests. However, these species are potentially suitable for research models, since their autotrophic life style and less threat for spreading seeds in environments make them easy to handle in laboratories. Triphysaria spp have been served as a model for studying the mechanisms of haustorium formation and evolution of parasitic plants [13] [11] [9, 10, 14, 15]. The other excellent model is the Asian-native Phtheirospermum japonicum because its short life-cycle (~ 3months) and its ability to parasite broad range of hosts [16]. Molecular knowledge of parasitic plants began to accumulate in recent years. Llarge-scale expressed sequence tag (EST) projects were carried out in Triphysaria [10][17] and Striga hermonthica [11][18]. Currently, Triphysaria, together with Striga hermonthica and Orobanche (Phelipanche) aegyptiaca, is the subject of a massive transcriptome sequencing and gene discovery project (http://ppgp.huck.psu.edu), which aims to clarify the genome-wide transcriptional changes that lead to parasitic lifestyle. Furthermore, Furthermore, tthe recent progress of next generation sequencing technologies has have dramatically accelerated the speed of large-scale sequencing and it will pushed forward sequence-based gene discovery projects. However, the lack of an easy and efficient genetic transformation protocols of parasitic plants represent will be a bottleneck to find functional genes from accumulated sequence pools. Currently, among parasitic angiosperm only Triphysaria is successful to be transformed [23].

Considering Considering the methods for gene insertion into plant genome available until now, the DNA transference via Agrobacteirum shows clear advantages, including reduction in transgene copy number, the stable integration and fewer rearrangements of long DNA molecules [12][19] [13][20]. Agrobacterium rhizogenes, a soil-borne bacterium carrying an agropine type root-inducing (Ri) plasmid, leads to the production of a transgenic hairy roots [14][21]. A. rhizogenes-mediated transformation allows co-transformation of plant cells with the gene of interest from the T-DNA in a disarmed binary vector and the root locus (rol) genes for rapid hairy root proliferation from the resident A. rhizogenes Ri T-DNA region [14][21]. The hairy roots with rol genes have a unique property of being able to grow in vitro in the absence of exogenous plant growth regulators [22]. These growth characteristics and the high transformation frequency of A. rhizogenes provides an ideal tool to test gene functions in roots [15][22].

Asian-native Phtheirospermum are facultative parasites closely related to agricultural pest Striga and Orobache. They are classified as facultative parasites, characterized by ability to grown until maturity without host plants, but they will readily parasitize host specie when available. In this manuscript we established a transformation protocol of the parasitic plant P. japonicum using A. rhizogenes. Since P. japonicum roots showed strong oxidative response upon injuries, we employed the method using sonication and vacuum infiltration to inoculate the bacteria into plant tissues. The transgenic roots derived from A. rhizogenes are able to attach the host plants and remain competent to form haustoria in response to an HIF. Using this system, we were able to monitored for the first time the cell division behaviour during the early haustorium development through the expression of a reporter protein driven by CyclinB1 promoter., the marker for mitosis. THIS REVEALS?

Results and discussion

Wounding responses may interfere with A. rhizogenes-based transformation methods using hypocotyl-dip or needle inoculation.

To develop an efficient P. japonicum transformation method, we first tested the protocol established for Lotus japonicus [16][23] , Triphysaria [17][24] or Phaseoulus ssp [18][25]. Briefly, the root-removed hypocotyls of XX 5 day-old P. japonicum seedlings were inoculation with A. rhizogenes suspension, or alternatively the A. rhizogenes was inoculated directly into intact plant plant?? (root removed or intact?) with a needle. The transformation was evaluated by the detection of green fluorescence protein (GFP) driven by the Cauliflower Mosaic Virus 35S promoter (CaMV 35S). We did not find any hairy roots emerged with detectable GFP with those previously published protocols. Instead we noticed that the wounded sites accumulated black substance(s), most likely oxidized phenolics [19] [20]REF? (Fig., 1A). A similar reaction was also observed in cut roots without A. rhizogenes inoculation, suggesting that this is the typical wounding response in P japonicum.

Sonication assists A. rhizogenes-based transformation of P. japonicum

To overcome this problem, we applied a sonication strategy, because the ultrasound sonication causes only minor injuries but allows internal plant tissues to be exposed to bacteria [21] [26]. The sonication-assisted Agrobacterium transformation (SAAT) protocols have been applied with success in several other non- model plants including citrus, soybeans, cowpea, papaya, and kidney beans [22][27] [23][28] [21][26] [24][29] [25][30]. However, as the previous transformation protocols utilized A. tumefaciens, we needed to adapt the method for the hairy root transformation using A. rhizogenes. The intact 3 day-old P. japonicum seedlings were sonicated in the A. rhizogenes suspension, followed by vacuum treatment and co-incubation (Fig. 2). We found that hairy roots emerged from P. japonicum cotyledons after 2-3 weeks (Fig 1B NEED AN ARROW IN THE FIGURE). GFP fluorescence was detected in the entire new emerging roots, indicating that stable hairy root transformation was established (Fig.1C, D). In some cases, we detected GFP fluorescence appeared as multiple spots in a cotyledon (Fig.1E, F), but the cotyledon was not able to produce fluorescent roots in 4-5 weeks after the inoculation. Thus this method can also result in transient transformation. When the stably transformed hairy roots were excised and cultured in a hormone-free media (Fig. 1G), these roots accumulated black substance(s) and subsequently died after 3-4 weeks. This phenotype was not observed in the transformed roots which were kept connected to the main plant. As the non-excised roots were grown faster and healthier, thus root cultures were maintained in this way. Using the A. rhizogenes -based method described above, we are able to obtain transgenic roots in 5 weeks (Fig. 2), whereas conventional A. tumefaciens transformation protocols require more time-consuming hormone treatments for root induction.

Transgene integration in hairy roots

The presence of transgenes in P. japonicum genome and its expression were confirmed by PCR, Southern blot and RT-PCR. The primer pairs specific to GFP or rolB gene were designed to confirm the presence of GFP gene and the TL region in the genome of transgenic roots, respectively. Both primer sets amplified the fragments with expected size in GFP-fluorescing transgenic roots but not in non-transformed roots (Fig. 72A). To check whether the hairy root samples retain contaminating bacteria, we designed PCR primers specific for the virD1 gene, a bacterial sequence which will not be integrated in plant genome. No specific amplification was achieved in any hairy root samples, but expected 450 pb fragment was obtained in a diluted bacterial suspension, used as a positive control in this experiment (Fig. 72B). Southern blot analysis was performed to confirm the T-DNA integration into P. japonicum genome. Genomic DNA of transgenic roots was digested with EcoRI, which does not cut within the T-DNA. The digested DNA was then blotted and hybridized with a 380 bp labelled GFP fragment. As shown in Figure 72C, the transgenic roots showed an integration event of the GFP gene, and no hybridization signal was observed in the control plant. To confirm the transgenes were indeed transcribed in plants, we performed RT-PCR using RNA extracted from hairy roots and non-transformed tissues. The rolB gene expression was detected in two independent transgenic lines (Fig. 72D).

Optimization of A. rhizogenes infectivity

To evaluate the effects of sonication periods and the vacuum in transformation efficiency of P. japonicum, seedlings were sonicated for variable periods with or without successive vacuum treatment. When the cotyledons were immersed in A. rhizogenes ATCC 15384 suspension without sonication, an average of less than 1% of transformed root could be detected. A significant enhancement of stable transformation events were observed when the sonication was applied along with A. rhizogenes (Fig. 3A). SAAT treatment ranging from 10 to 100 seconds increased in average 5 times more than no sonicated plantsThe frequency of stable transformation was higher in 10 s sonication than longer periods (50 s and 100 s), whereas the sonication treatment didn't show clear effect on transient transformation (Fig. 3A). Although P. japonicum cotyledon responded to a wide range of sonication duration, the tissue was often damage after the exposure to long sonication treatments and severe injuries caused detrimental effects on plant growth (Fig.4 A and B). Therefore the treatment of 10s yielded high frequency of transformed events with minimum damage in plant development and it was adopted in subsequent experiments.

To determine the damage intensity caused by sonication, P. japonicum cotyledon was examined microscopically after 0s, 10s, 50s and 100s sonication period. Scanning electron microscopy revealed the formation of a large numbers of micro-wounds on the surface of the sonicated-treated cotyledon (Fig. 4 C-F), while the surface of the non-treated tissue was smooth and intact (Fig. 4 C). Micro-wounds were observed on all treated tissue and became larger with the longer duration treatments. The micro-wounds created by sonication covered the surface of the treated tissue and ranged in size from less than 1m up to 1 mm with longer duration treatments [21]. The holes in the surface of the plant material are large enough for Agrobacterium to invade the wounded cells or tissues [21]. Thus the sonication allows the deep access of the bacteria into plant tissues, but the excess duration of that provokes irreversible injuries which prevent further plant development.

STABLE TRANSFORMATION LEFT, TRANSIENT RIGHT, ADD ASTERISKS FOR STATISTICAL SIGNIFICANCE, DO WE REALLY NEED TRANSIENT DATA?). Combination of sonication and vacuum significantly increased the hairy root transformation frequency, and the transient transformation occurred more frequently without vacuum treatment (I AM NOT SURE YOU CLAIM IS VALID WE NEED TO DISCUSS (Fig. 3). The different effects of sonication periods and vacuum on stable and transient transformation may reflect cell damage caused by those harsh treatments. Indeed, the cotyledon surfaces were more severely damaged after longer periods of sonication treatment (Fig. 4). NEED TO DESCRIBE MORE Thus the sonication although allows the deep access of the bacteria into plant tissues, excess duration of that provokes irreversible injuries which prevent further development including hairy root emergency (Fig. 4E). The different effects of sonication periods and vacuum on stable and transient transformation may reflect cell damage caused by those harsh treatments. Indeed, the cotyledon surfaces were more severely damaged after longer periods of sonication treatment (Fig. 4). NEED TO DESCRIBE MORE Thus the sonication although allows the deep access of the bacteria into plant tissues, excess duration of that provokes irreversible injuries which prevent further development including hairy root emergency (Fig. 4E). The Agrobacterium-mediated transformation efficiency often differs depending on bacterial strains. Therefore A. rhizogenes strains, ATCC 15834 [26][31], LBA1334 [27][32] and AR1193 [42] (Table 1), were tested for P. japonicum transformation. These bacterial strains have different growth rate and to investigate if the duration of co-incubation In this experiment we also investigated if the duration of co-incubation can affect transformation efficiency we tested two periods 2 and 7 days.. The highest transformation rate was obtained using the strains LBA1334 and AR1193 (Fig. 53B); both strains showed . DESCRIBE MORE HERE The 2 days of similar percentage of stable transformation co-cultivation efficiency when co-cultivated with P. japonicum for 2 or 7 days (Fig. 3B). However, 2 days is showed to be more appropriate than 7 days since a longer period caused overgrowth of A. rhizogenes on plant increasing the percentage of dead tissues. Furthermore no desirable outcomes were also observed, such as hairy root emerging from cotyledon without GFP fluorescence (data not shown). Hairy roots without fluorescence were not originated from cells expressing gfp gene and so were not co-transformed. Callus-like outgrowth at infection sites were also detected and can be caused by multiple T-DNA integration into plant genome causing an abnormal hormone balance.[28]. and plants with callus-like appearance (data not shown).

The bacteria-suspension media used in the SAAT- methods established in other plant species contain various additive compounds, such as hormones, the surfactant Silwet L-77 and/or acetosyringone [29][33], [30][34] [31][35], [21][26],[22, 24][27, 29]. To evaluate efficacy of these compounds in transformation of P. japonicum, we tested various suspension media based on MS salts or water associated with combination of Silwet L-77 and the auxin 1-naphthaleneacetic acid (NAA). Seedlings immersed in different bacterial suspension media showed almost similar transformation rates to those immersed in bacterial-suspended water (Table 2). Only acetosyringone showed clear effects on stable transformation of P. japonicum. This phenolic compound also significantly greatly increased the percentage of transient expression of GFP (Fig. 3C) (Fig. 6). Figure 3C shows a representative experiment using two different bacterial strains ATCC 15834 and LBA 1334. Acetosyringone has been shown to enhance the transformation in different species due to activation of the vir genes [32]. Our results indicate that the addition of acetosyringone during the infection process significantly Similar patterns with different values were obtained from two A. rhizogenes strains LBA1334 and ATCC15834.enhances the stable transformation event and the transient expression regardless the bacterial strain applied. The resume of the optimized transformation protocol is showed in flowchat (Fig. 5)

Transgene integration in hairy roots The presence of transgenes in P. japonicum genome and its expression were confirmed by PCR, Southern blot and RT-PCR. The primer pairs specific to GFP or rolB gene were designed to confirm the presence of GFP gene and the TL region in the genome of transgenic roots, respectively. Both primer sets amplified the fragments with expected size in GFP-fluorescing transgenic roots but not in non-transformed roots (Fig. 7A). To check whether the hairy root samples retain contaminating bacteria, we designed PCR primers specific for the virD1 gene, a bacterial sequence which will not be integrated in plant genome. No specific amplification was achieved in any hairy root samples, but expected 450 pb fragment was obtained in a diluted bacterial suspension, used as a positive control in this experiment (Fig. 7B). Southern blot analysis was performed to confirm the T-DNA integration into P. japonicum genome. Genomic DNA of transgenic roots was digested with EcoRI, which does not cut within the T-DNA. The digested DNA was then blotted and hybridized with a 380 bp labelled GFP fragment. As shown in Figure 7C, the transgenic roots showed an integration event of the GFP gene, and no hybridization signal was observed in the control plant. To confirm the transgenes were indeed transcribed in plants, we performed RT-PCR using RNA extracted from hairy roots and non-transformed tissues. The rolB gene expression was detected in two independent transgenic lines (Fig. 7D). Transgenic roots connect to the host via haustorium.

To confirm whether the transgenic roots emerged from cotyledons are able to form haustoria, the transgenic roots were placed in a media containing 10 M DMBQ for 3 2 days. We observed swollen root tips surrounded by hair-like structures, typical phenotype of early haustorium development. The haustoria formed in transgenic roots were morphologically indistinguishable from those formed on non-transgenic roots (Fig. 8A 6A and B). Transgenic P. japonicum roots were co-incubated with rice and maize in vitro or in non-aseptic condition, respectively. In both cases the haustoria developed and attached to the hosts (Fig. 8C 6C - F). The morphologically indistinguishable haustorial development in P. japonicum hairy roots indicates that the hormonal effects caused by insertion of rol genes [14][21] does not influence the parasitic competence of transformed roots. Similarly, the transgenic hairy roots of the parasitic plant Triphysaria also retained their ability to establish the vascular connection with their host through haustoria [17][24].

Visualization of cell division during haustorial development.

To verify that the transgenic roots generated by our protocol can be applied for plant parasitism studies, we generate transgenic P. japonicum roots carrying the Arabidopsis Cyclin B1 promoter drives a nuclear-localised reporter gene (YFP). The CyclinB1 promoter contains M-phase specific cis-elements widely-conserved in angiosperm [33][36], which make feasible its use as a cell-division marker in heterologous system. P. japonicum root transformed with. CycB1-YFP construct had the meristematic region under intense fluorescence, indicating high cell division rate (Fig.7 A and B). Analysis using con-focal microscopy showed that the fluorescence was restricted to nucleus (Fig. 7 C and D). Our data demonstrated that is possible to apply the Arabidopsis CyclinB1 promoter to study cell division in P. japonicum.

MOVE TO INTRODUCITON? The cell division are observed during early stages of haustorium formation in different root parasite, such as Striga asiatica, Agalinis purpurea and Triphysaria vesicolor [37-40] Initial events of haustorium formation in T. vesicolor are characterized by rapid cessation of root elongation, followed by the expansion and differentiation of epidermal cells into haustorial hairs. Thereafter the cortical cells begin an isodiametric expansion that leads to a visible swelling generally near to root tip. Epidermal cells and the cortical cells comprising the swollen area begin to divide after the bulk of the haustorium is formed [41]. In order to observedobserve the cell division during haustorial development, P japonicum seedlings were transformed with CycB1-YFP-nuc construct and were placed on DMBQ-containing agar. Without DMBQ-treatment, the fluorescence is was restricted to meristematic region, immediately behind the root cap (Fig. .79 A and B). However, 24 hours after the transference to DMBQ-agar,, haustorium was detected near to root tip. The DMBQ-treated root showed that beside root meristem, the haustorial region was also emitting fluorescence a fluorescent budge near to root tip was observed (Fig. .79 E and FB-C). Further analysis using con-focal microscopy showed that swollen area was rounded by root hairs and the was under cell division (Fig. 9D-G)?.cellular activity was not restricted to the cortex, but also detected in stele, inner to cortical cells (Fig. 7 G and H). Differently, in parasite Agalinis purpurea [34]and Triphysaria[9, 35] the periciclinal division happens only in cortex. The cell division was also identified during early haustorial development along the root (Fig. 9H-K). Our results showed that the process of haustorium formation induced by DMBQ in P japonicum is similar to T.vesicolor. In both plants the morphological changes occurs before the cell division including the expansion and differentiation of hair root and the initial of root bulge.

Conclusions

We have established an efficient A. rhizogenes-mediated transformation method for the facultative parasitic plant P. japonicum using sonication followed by vacuum treatment. This method has an advantage of rapid bacterial inoculation into plant tissue, avoiding the laborious hypocotyl cuttings. Transgenic roots can be obtained within a relatively short time (4-5 weeks) with efficiency around 20%. Furthermore, upon contact with host or the haustorium-inducing factor DMBQ, these roots are able to develop haustoria morphologically indistinguishable from non-transformed ones. The transgenic haustoria retain their ability to invade and parasitize host plants. Using this method, we are able to visualise the cell division activity d the Cyclin B1 promoter activity in cortex and stele regions during the haustorium formation through the CycB1-YFP-nuc construct. The results presented in this paper provide a powerful genetic tool to investigate genes that function in the host-parasite interaction.

Methods

Bacterial strains

Bacterial strains harbouring pBCR101[36] [ref] are listed in Table 1. The Agrobacterium strains were grown on LB media and cultured at 28oC for 2 days, except A. rhizogenes ATCC 15384 which was cultured for 1 week. For infection, bacteria were suspended in the MS salt solution supplemented with 2% (w/v) sucrose; 1 x B5 vitamins; 0.02 % (v/v) Silwet L-77, 100 ï­M Acetosyringone (AS) and 0.5 mg/l NAA (pH5.7), unless otherwise described. The O.D600 was adjusted to 1.0.

Plant materials and growth conditions

P. japonicum (Thumb.) Kanitz seeds were originally harvested in Okayama, Japan and propagated in the laboratory. P. japonicum seeds were surface-sterilized with 5% (v/v) commercial bleach solution (approx. 6% sodium hypochloride; Kao, Tokyo, Japan) with 0.1% (v/v) Triton X-100 (Wako Pure Chemical Industries, Ltd) for 5 minutes. After washed with excess water, the seeds were placed on the GM media, kept overnight in the dark at 4oC, and then transferred to at 25oC for 3 days in darkness. After germination, plants were grown in a chamber under a photoperiod of 16h light/8h dark at 25oC. The commercial maize (Zea mays) seeds were sow directly in moistened filter paper and incubated in growth chamber set up to 26oC under the photoperiod of 16h light/ 8h dark. And rice seeds (Oryza sativa) MAIZE and RICEwere washed in 70% ethanol for 30 s, sterilized in 20% sodium hypochlorite solution for 15 min, rinsed with sterile water, and then incubated in moistened filter paper at 26 °C under a photoperiod of 16h.

Plasmids

For constructing CYCB1;2 pro::YFP, we used the pBGYN binary vector which contains the GATEWAY cassette (Invitrogen) fused to the 5' end of YFP-NLS (Kubo et al., 2005, 43). We first amplified 5' upstream region of CYCB1;2 by PCR using a primer set, CACCATCGTGAAGGTAACATTTACAAC and TTCTCTTTCGTAAAGAGTCTCTGCG. The resulting 1.1-kb fragment containing CYCB1;2 promoter and a part of adjacent gene, was subcloned into a pENTR/D/TOPO vector (Invitrogen), and then integrated into pBGYN using LR clonase (Invitrogen).

A. rhizogenes-mediated transformation

3-day-old P. japonicum seedlings were transferred to 15 ml plastic tubes, containing 3-5 ml of A. rhizogenes suspension. Sonication treatment was carried out using the bath sonicator (Ultrasonic automatic washer, AS ONE, Japan) for 10 s unless otherwise indicated at room temperature. Seedlings were removed from the tubes and placed in Petri dishes containing filter paper moistened with bacterial suspension. The dishes were sealed with two turns of surgical tapes and then submitted to a continuous vacuum for 5 minutes. The seedlings were transferred to co-cultivation media (B5 media, 1% (w/v) sucrose, 100 M AS) and kept in the dark at 22oC for 7 days, unless other periods were described. After co-cultivation, plants were placed onto square Petri dishes containing B5 agar media supplemented with antibiotics cefotaxime (300 mg/l). The dishes were sealed with surgical tapes and were incubated at 25oC in vertical position for 3 weeks with the bottom half being covered with aluminium foil. The transformation efficiency was analyzed by counting of cotyledon leaves tissues (plants?) that showed GFP fluorescence under the stereomicroscope Leica MZ16FA.

Genomic DNA extraction and PCR/ RT-PCR amplification.

Total genomic DNA was extracted from 100 mg hairy roots according to the instruction in the Illusta DNA extraction kit PHYTOPURE TM (RPN-8511 GE healthycare). The GFP fragment was amplified using the following primers GFP Fwd 5' - CTG ACC CTG AAG TTC ATC TGC-3' and GFP Rev 5'- TCT TCT GCT TGT CGG CCA TG-3'. The PCR was performed as follows; an initial hot start at 94oC 3min, then 35 cycles of denaturation (94oC 15 s), annealing (55oC 15 s), extension (72oC 30 s), and a final extension of 5 min at 72oC. The 310p0 ng WHICH? pBRC 101 plasmid was used as the positive control. The sequences of virD1 and rolB-specific primers and the amplification protocols are described in [37][42]. Briefly, the rolB primer amplifies a 780 bp fragment of the TL region from Ri plasmid of A. rhizogenes and the virD1 amplifies a fragment size of 450 bp. The PCR amplification products were analyzed by electrophoresis in 1% agarose gels containing ethidium bromide. For the positive control, a diluted A. rhizogenes (pBRC 101) suspension was used.

Southern blot analysis

Genomic DNA from transformed or non-transformed P. japonicum tissue was extracted with the Phytopure DNA extraction kit (GE healthcare, Little Chalfont, England), according to the manufacturer's instructions. Sixteen g of genomic DNA was digested with EcoRI. The 380 bp GFP fragment amplified using the primer pairs GFP Fwd and GFP Rev (see above) was labelled using the AlkPhos direct kit (GE healthcare). Pre-hybridization, hybridization and washing were performed according to the manufacturer's instructions.

Haustorium assays.

Haustorium development was monitored in P. japonicum transgenic roots following contact with rice (Oryza sativa) and maize (Zea mays) roots. The seed-coat-removed rice seeds were immersed in 70% ethanol for 1 min once and then in a 20% commercial hypochlorite solution for 20 min with agitation, followed by washing five times with sterile water. The rice seeds were then germinated in moistened filter paper for 1 week, transferred to 0.7% (w/v) agar in a square plate, positioned vertically and grown for 1 week at 25-C in 16-h light/8-h dark photo period. The P. japonicum plants were placed close to the host roots, and haustorium development was monitored. As for maize, one week after host germination on moistened filter papers, P. japonicum plants were placed in the rhizotron system as described previously [38][16]. For the DMBQ treatment, P. japonicum roots were transferred to 0.7% (w/v) agar containing 10 M DMBQ.

Microscopy

The cotyledons were visualized in natura using the microscope Hitachi Miniscope TM1000. In the con-focal microscopy analysis, P. japonicum seedlings carrying the CyclinB1::YPFnuc construct were treated with or without DBMQ as described above. The transformed roots were stained with 5 M propidium iodide solution (Wako, Japan) and immediately observed under the microscopy Zeiss LSM510 Meta.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

JKI, SY, and KS conceived the experiments. JKI performed the experiments with guidance from SY and KS. MI made CYCB1;2 pro::YFP construct. JKI, SY, and KS wrote the manuscript. SN and KS participated in the coordination of the study. All authors read and approved the final manuscript.

Acknowledgements

We thank to Dr. T. Enomoto from Okayama University (Japan) to kindly provide P. japonicum seeds. We gratefully acknowledge to Dr. Hikaru Seki and Prof. Toshiya Muranaka for providing pBCR101. Drs. Mayuko Sato, Kiminori ToyookaNOT as authors? and Kohki Yoshimoto for indispensable help with microscopic images. Research was supported by Ministry of Education, Culture, Sports, Science, and Technology (MEXT-Japan) and the RIKEN president fund. JKI is supported by the MEXT scholarship program.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.