0115 966 7955 Today's Opening Times 10:00 - 20:00 (BST)
Place an Order
Instant price

Struggling with your work?

Get it right the first time & learn smarter today

Place an Order
Banner ad for Viper plagiarism checker

Optimizing US/MB-mediates Gene Transfer to Treg

Disclaimer: This work has been submitted by a student. This is not an example of the work written by our professional academic writers. You can view samples of our professional work here.

Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of UK Essays.

Published: Fri, 01 Jun 2018

Title: Research on effect of ultrasound/SonoVue microbubble on Treg cell viability and optimized parameters for its transfection

Running title: optimizing US/MB-mediates gene transfer to Treg

Highlights:

  1. US promoted proliferation of Treg cells;
  2. Increasing of MB inhibited proliferation of Treg cells;
  3. Offered optimized parameters for transfection of Treg cells.

Abstract

The purpose of this study was to investigate the effect of ultrasound (US) and SonoVue microbubble (MB) on Treg cells proliferation and to explore the appropriate acoustic parameters for thetransfection of Treg cells. Previous studies have demonstrated transfection using a combination of ultrasound and microbubble but failed to provide the parameters that suitable for Treg cells. Here in this study, Treg cells seeded in 96-well plates were treated under different conditions of ultrasound and SonoVue microbubble, proliferation investigations of Treg cells were performed; and the efficiency of plasmid transfer was determined by detection of luciferase activity on microscopy. Cell viability decreased with increasing ultrasound exposure time and microbubble concentration. The optimal concentration of microbubble is 10%, and ultrasound MI (mechanical index) is 1.4, IT (irradiation time) is 150s or 180s. The results indicate that ultrasound/microbubble could affect the Treg cell viability and the parameters could and should be optimized for plasmid transfection of Treg cells.

Key words: Ultrasound, Microbubble, Treg, Gene therapy, hepatocarcinoma

Introduction

Ultrasound has been widely utilized in in vivo imaging and treatment of many diseases, such as renal calculus and fibroids in the uterus. Besides, ultrasound increases the permeability of the membrance of cells and facilitates the entry of drugs or genes into cells. In addition, the combination of therapeutic ultrasound and microbubble echo contrast agents enhances gene transfection efficiency. Ultrasound microbubble-mediated delivery, compared with the virus, gene transfection reagents or drug delivery system, has advantages such as being safe, effective, noninvasive and good targeting [1-5]. This technology has shown promising gene delivery tool for hepatocarcinoma gene therapy [6-11]. HCC is the fifth most common solid tumor in the world with the highest incidence seen in China [12, 13]. CD4+CD25high Treg cell prevents anti-tumor immunity by the suppression of self-reactive T cell and may also suppress the immune response against cancer cells [14]. It has been suggested that the excessive presence of Treg cells can explain the poor clinical efficacy of immunotherapeutic effects in human tumors [15]. Targeting on Treg cells therefore provides an attractive therapeutic strategy to support anti-tumor therapy [16].

Foxp3 as a member of the transcription factor family controls the development and function of CD4+CD25+regulatory T cells [17]. It is worth mentioning that vaccination against Foxp3 enhances tumor immunity [18].Gene transfer of siRNA has obstacles such as nuclease degradation. Therefore, siRNA-entrapping type, for example constructed into plasmid is a better option [19]. As previously mentioned, ultrasound increases permeability of the membrane, on the other hand, ultrasound also causes irreversible cell membrane damage and eventually causes cell death. In consideration of the potential harmful impact of ultrasound and microbubble to the target cell, this study was designed to explore the optimal conditions for transfection, including microbubble concentration and ultrasound irradiation parameters to achieve good gene delivery, with minimum cell injury. The ultimate aim is to provide an objective basis for future gene therapy research in microbubble/ultrasound-mediated Foxp3siRNA delivery in vivo.

Materials and Methods

Treg cells

Treg cells were separated from venous blood of patients with HCC obtained at Harbin Medical University first affiliated hospital (Harbin, China) during October 2013 and March 2014. All the patients had not received adjuvant treatment. Besides lesions in the liver itself, no other body parts have pathological changes.

SonoVue microbubble

SonoVue microbubble (Bracco Co. Geneva, Switzerland), diameter of 2.5~6.0 μm, were dissolved in 5 ml normal saline(NS), well-distributed by inversion or oscillation before used. The density was kept within 2 x 108 ~ 5 x 108 / ml, and the concentration was 5mg/ml.

Foxp3 siSNA plasmid

Four Foxp3siRNA were synthesized by Invitrogen (Co., LTD Shanghai, China). The sequences were as follows:

SiRNA

sequences

NegativeF

5′-tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT – 3′

1F

5′-TGCTGTTCTGAAGAAGGCAAACATGCGTTTTGGCCACTGACTGACGCATGTTTCTTCTTCAGAA – 3′

2F

5′-TGCTGAAAGGGTGCTGTCCTTCCTGGGTTTTGGCCACTGACTGACCCAGGAAGCAGCACCCTTT – 3′

3F

5′-TGCTGAAGATGGTCCGCCTGGCAGTGGTTTTGGCCACTGACTGACCACTGCCACGGACCATCTT – 3′

4F

5′-TGCTGCACAGATGAAGCCTTGGTCAGGTTTTGGCCACTGACTGACCTGACCAACTTCATCTGTG – 3′

HCC patients CD4 + CD25 + T cells (Treg) separation

PBMC (peripheral blood mononuclear cells) were separated by density gradient centrifugation from 40~60 ml venous blood of patients with hepatocarcinoma. The CD4+CD25+T lymphocytes(Treg cell) were separated by magnetic cell sorting (MACS) and the purity was above 90%.

Treatment on Treg cells with different ultrasound parameter and SonoVue microbubble concentration

Treg cells were seeded in 96-well plates (5.0×105/well). Each well was added microbubble with 0, 10, 20,30,40,50 µl/100µl. The irradiation intensity was set to MI (mechanical index) of 1.2 or 1.4 and the insonation time was set to 0, 30, 60, 90, 120, 150, 180 secs.

After warming up for 30 min, the irradiation and bubble breaking started according to the methods above. Each condition was run in five wells, and each experiment was repeated at least 3 times. The ultrasound probe was laid under the 96-well plate at a distance of 3-5mm, with few ultrasonic coupling agents, and moved evenly under the plate.

CCK8 proliferation assay

The effects of ultrasound and microbubble on the proliferation of Treg cells were evaluated using CCK-8 Kit (Dojindo Laboratories, Kumamoto, Japan). The cells were seeded in 96-well plates and treated with different conditions above-mentioned for 24h. The reagents were added to each well and incubated at 37°C for 3.5~4h and then the absorbance was measured at 460nm with Model550 microplate reader (Bio-RadLaboratories, Hercules, CA, USA).

Plasmid

Bacterialtransformationwas carried out using library efficiencyE.coli DH5αfrozen competent cells. Extraction and purification of plasmid were according to the plasmid extraction kit. Plasmid concentration (typically 0.5 mg/mL) and purity (the ratio of optical densities at 260nm and 280nm >=1.8) were evaluated using spectrophotometry. The plasmid was stored at -20°C.

Preparation of plasmid/SonoVue microbubble suspension

Blended the Foxp3siRNA plasmid and SonoVue microbubble according to the proportion of 1:1, and the mixture was kept at 4ËšC for 2~3hrs.

Treg cells transfection in vitro

Before transfection, Treg cells were suspended in RPMI1640 medium without serum and seeded in 96-well culture plate with 2×104/well. 20μl plasmid/microbubble suspension was added to each well. (i) blank control, (ii) plasmid+lipofectamin 2000, (iii) plasmid+SonoVue microbubble+ lipofectamin 2000+ultrasound 150s(P+MB+L+US150s) (iiii) P+MB+L+US180s. With (i), 10µl blank plasmid and 90µl medium were added to each well. With (ii) (iii) (iiii), 20µl plasmid/SonoVue microbubble suspension mixture and 80µl medium were added to each well. Then the (iii) and (iiii) groups were treated with ultrasound for 150s or 180s. Each condition was run in five wells, and each experiment was repeated at least 3 times.

Transfection efficiency observation

Twenty-four hours after transfection, the transfection efficiency was observed by fluorescence microscopy.

Apoptosis assay of Treg cells

Quantification of apoptosis cells were analyzed by flow cytometry (Beckman Coulter, Fullerton, CA, USA). Treg cells were collected and suspended in PBS, washed twice, then detected its apoptosis rate with FCM.

Statistical analyses

Data are expressed as the mean ± SD. SPSS 14.0 was used for statistical analysis and the comparison between groups using ANOVA, the comparison between groups using T test, P<0.05 as the difference is statistically significant.

Results

Ultrasound irradiation intensity and exposure time

Under the same irradiation intensity, Treg cell viability was decreased with extension of irradiation time. Compared with control, cell proliferation increased significantly when MI was set to 1.4 with irradiation time of 30~120s and MI was 1.2 with irradiation time of 30~180s. when MI was set to 1.4 and irradiation time was 150s, cell proliferation was not obvious. While when the irradiation time was 180s, cell viability decreased but not significant(p=0.526>0.05).

Microbubble concentration

The cell viability decreased with increasing concentration of microbubble. When added with 10μl/well microbubble, the survival rate of Treg cells was 91.3±8.72%. The difference was not significant compared with control (p=0.076>0.05). When the microbubble was 20, 30, 40, 50μl/100μl, the viability was significantly decreased, and the effect was similar between the four groups. The effect of microbubble on cell proliferation could be represented as the inhibition ratio % = (OD of control – OD of the experimental group)/ (OD of control) x 100%.

Combination of ultrasound and microbubble

With the same concentration of microbubble and irradiation intensity, cell viability decreased with extension of irradiation time. With the same concentration of microbubble and irradiation time, cell viability decreased with extension of irradiation intensity. No significant differences were identified with respect to cell viability when MI was set to 1.4, irradiation time (IT) was120s, and microbubble was 30, 40, 50μl/100μl; the same as when IT was150s or 180s, microbubble of 10μl/100μl. No significant differences were identified with respect to cell viability when MI was set to 1.2, IT (irradiation time) was 120s, microbubble of 30, 40; IT was 150s, microbubble of 20μl/100μl; IT was 180s, microbubble of 10μl/100μl. Comparing the group of MI=1.2 and MI=1.4, the difference was significant.

Together with the results above, the condition of MI was set to1.4, ITwas150s, microbubble of 10μl/well and IT was 180s, microbubble of 10μl/well is suitable for transfection of Treg cells.

Fluorescence microscope monitoring transfection efficiency

No fluorescence was observed in the control group (i); the fluorescence expression rate of (ii) only lipofectamine2000 was 27.85%; (iii) lipofectamine2000+SonoVue microbubble + ultrasound for 150s, the fluorescence expression rate was 45.78%; (iiii) lipofectamine2000+SonoVue microbubble + ultrasound for 180s, the fluorescence expression rate was 41.75%.

Flow cytometry instrument to detect cell apoptosis after transfection

Quantification of apoptosis cells were analyzed by flow cytometry (Beckman Coulter, Fullerton, CA, USA). The death rate of the control group (i) was 5.44%; the group of (ii) lipofectamine2000 was 10.64%; with the group of (iii) lipofectamine2000 + SonoVue microbubble + ultrasound for 150s, the death rate was 11.23%; (iiii) lipofectamine2000+SonoVue microbubble + ultrasound for 180s, the death rate was 13.95%.

Discussion

The success of gene therapy is largely dependent on the development of the gene delivery system that needs to be safe, easy to apply with and efficient transgene expression. Optimal gene transfection conditions used to enhance gene expression levels restricted cell death to 5% or less [20]. Previous studies have discussed the effect of ultrasound exposure and irradiation intensity on gene delivery [21, 22]. However, ultrasound causes apoptosis with minimal cell lysis and free radical formation was observed in many cancers [23, 24] and the damage on cell membrane may results in cell death [25]. Determining how to choose these parameters to achieve optimal conditions and cause little cell injury is critical for the improvement of gene delivery and expression.

The present study aimed to investigate Foxp3siRNA plasmid delivery efficiency and cellular viability under various conditions of transfection, mainly focused on ultrasound irradiation parameters and microbubble concentrations. With regard to control group, we identified that with a gradual increase in ultrasound irradiation exposure time and microbubble concentration, a gradual decrease in Treg cell viability was observed. Thus, the hypothesis has been tested that both ultrasound and microbubble have effect on Treg cell viability. Low-intensity pulsed ultrasound have been reported to stimulate the viability, proliferation of stem cells [26-28]. While in our research, within a certain period of irradiation time, ultrasound irradiation could promote Treg cell proliferation.

Many factors affect the transfection efficiency. For a particular type of the target cells and exogenous gene, it is vital to successfully determine the specific optimal conditions for utilization of the ultrasound/microbubble gene transfer system. For Foxp3siRNA gene transfection of Treg cells, when ultrasound frequency was 2.5MHz, with mechanical index of 1.4, irradiation time of 150s or 180s, SonoVue microbubble concentration of 10%, the effect of ultrasound/microbubble to the cell viability and apoptosis was minimum, and the transfection rate had been raised 50% compared with the control group. The above parameters will function as a significant reference for gene therapy of hepatocarcinoma, but currently remain unsuitable for experiments in vivo.

Conclusion

In summary, using 2.5-MHZ transducer with mechanical index of 1.4, combined with 10% microbubble is the optimal condition for Treg cell transfection, with minimum effect on Treg proliferation, apoptosis and viability. Our research provides for the further research of improving the immune microenvironment, break the immune tolerance, resistant immune escape, provide the basis for the feasibility and safety, new effective method for gene therapy joint with immunotherapy of hepatocarcinoma.


To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Request Removal

If you are the original writer of this essay and no longer wish to have the essay published on the UK Essays website then please click on the link below to request removal:


More from UK Essays