Novel Protein Involved In Early Stimulation Of Adult Neurogenesis Biology Essay


Injury-induced neurogenesis and neurodegeneration diseases- stimulated neurogenesis are known to be able to produce certain amount of neural progenitor cells to replace and repair the injury site. It is believed that these induced-type of neurogenesis triggered by chemical signals that stimulate cell proliferation, follow with cell migration and differentiation.

A lot of factors that involved in proliferative cell stimulation have been identified, especially growth factors and neurotransmitters (Cameron et al., 1998). However, we believe that there are big differences between mammalian and fish neuronal repairing system.

In mammals, high percentage of newly generated neurons at their neurogenic zones unable to survive and integrate back to their original neuronal circuitry (Chapouton et al., 2007, Jin et al., 2006). Few hypotheses that have been proposed to explain the limitation in neuro-regeneration in mammals including the limited number of new neurons being synthesized from the proliferative zones and migrated successfully to the site of degeneration; but unable to differentiate and develop into fully mature and functional neurons even though it reaches the targeting site due to toxicity or release of blockage molecular factor(s) in the diseased or injured brain (Arvidsson et al., 2002, Jin et al., 2004).

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

In contrast in fish, adult teleost exhibit enormous potential for central nervous system to regenerate structurally and functionally after injury (Sîrbulescu and Zupanc, 2009). One of the first major differences after central nervous system injury would be necrosis occurred in mammals but not teleost during early stage of repairing (Zupanc and Zupanc, 2006). Necrosis is caused by the formation of glial scar which produced in high density two days after injury (Kang et al., 2006). Glial scar will become a barrier to prevent axonal regeneration which permanently block the restoration and integration back with the existence neuronal system (David and Lacroix, 2003). Thus it is important to study the expression difference during the early stage after brain injury.

Two-dimensional differential in-gel electrophoresis (DIGE) is a method for comparing protein expression in paired samples, which are differentially labeled with fluorescent dyes and electrophoresed together on the same gel (Lilley and Friedman, 2006). This facilitates comparison of proteomic profiles and can be combined with mass spectroscopy (MS) to identify differentially expressed proteins. The main objectives of present study is to study the neural-regenerative capability in zebrafish after habenula ablation, and to study the novel molecules involved in triggering new cells synthesis at the early stage of regeneration.

Materials and Methods


Sexually mature male zebrafish (Danio rerio) with standard length from 2.8-3.0 cm respectively, were used for analysis. The fish were maintained in freshwater aquaria at 27°C with a controlled natural photoregime (14/10h, light/dark). The fish were maintained and used in accordance with the guidelines of the Animal Ethics Committee of Monash University (AEC Approval Number: SOBSB/MY/2008/42).

Application of habenula ablation

Zebrafish were anesthetized by immersion in a 0.025% (1 ml of 10% benzocaine diluted in 400ml water). The anesthetized fish was sandwiched in a water soaked sponge for positioning and to avoid drying off of the fish body and gills. Guided by the specific landmark on zebrafish's head, the skull with small hole of 2.0 mm2 area was removed by means of sterile surgical blade (Grade 11, Sheffield England). Kim wipe was used to remove the fat layer covered on top of the brain to expose the pair of habenula region. An extra fine tweezer (5/ 5A Fontax, Taxal®) was 1mm depth inserted into the habenula region for ablation. The fish was then returned to an isolated tank for recovery for various post-ablation survival times: 1, 2, 3, 15 and 40 days. As a control, sham operated fish with same time points were prepared.

TUNEL staining

Apoptotic cells were detected by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL) assay using Cell Death Detection Kit (Roche Diagnostics, Mannheim, Germany). The habenula ablated and sham control fish (n=6/group) were anesthetized in a 0.01% of benzocaine solution and humanely killed by decapitation. The brains were quickly removed from the skull and frozen in Tissue-Tek Optimal Cutting Temperature (OCT) compound (Sakura Finetechnical Co. Ltd., Tokyo, Japan). The frozen fresh brain was cut into 12 mm of coronal sections using a cryostat. Sections were immediately thaw-mounted onto aminopropyltriethoxy silane (APS)-coated slides. Subsequently, the sections were fixed in buffered 4% paraformaldehyde (PFA) in 0.1M phosphate buffer at 4°C for 5 min. They were then washed with phosphate buffer saline (PBS, pH 7.4) for few times to remove the fixative solution.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Pretreatment of tissues using microwave irradiation was required to improve cell permeabilisation. Pretreatment was performed according to the manufacturer's protocol (Roche Diagnostics) with minor modification adapted from Deng et al. (2001) and Dubska et al. (2002). The slides were treated in 0.01M citrate buffer (Citric acid/ Sodium citrate, pH 6.0) and irradiated for 2 min at a microwave power of 750W. The slides were immediately immersed in PBS at room temperature for rapid cooling. After pretreatment, the slides were incubated for 60 min at 37 °C with TUNEL reaction mix containing the TdT enzyme and fluorescein-labeled dUTPs (Roche Diagnostics). Positive and negative controls were included and processed in parallel with the test samples. In the negative control, the sections were treated as above without the TdT enzyme; while for positive control, the sections were treated 1U/ml concentration of DNase (Promega, Madison, WI) for 5 min at room temperature prior to treatment with TUNEL reaction mixture. Sections were then counterstained with 4,6-diamidino-2-phenylindole, DAPI (Sigma).

BrdU Immunohistochemistry

S-phase cells were labeled by combining BrdU and 5-fluoro-2'-deoxyuridine (FdU) treatment. Fish were anesthetized in a 0.01% of benzocaine solution and injected intraperitoneally with a cocktail of 3.0 mg/ml BrdU (Sigma) and 0.3 mg/ml FdU (Sigma) in 0.9% w/v sterile NaCl saline with approximately 1.0 ml/ 100g of body weight. FdU was added to enhance incorporation of BrdU into the replicating chromosomal DNA. Twenty-four hours after the injection, the fish were anesthetized in a 0.01% of benzocaine solution and humanely killed by decapitation. The brains were removed and fixed in buffered 4% PFA for up to 6 hours at 4 °C. Cryoprotection was achieved by transferring the brains into 20% sucrose at 4°C for overnight. Subsequently, the brains were embedded in OCT compound and quickly frozen with dry ice, and were sectioned coronally using a cryostat at 14 µm.

For staining, the sections were incubated in 2N HCl at 37°C for 1 hour to denature the DNA. The reaction was stopped by a rinse in 0.1M borate buffer (pH 8.5) at room temperature for 10 minutes, followed by 3 times rinses in PBS. After blocking at room temperature for 30 minutes with 2% normal horse serum and 0.5% Triton X-100 in PBS, the sections were incubated in a mouse anti-BrdU antibody (BD PharMingin Laboratories, NJ, USA) diluted 1:200 in the blocking solution at 4°C overnight. Negative control sections were prepared with no antibody was applied. After two rinses in PBS for 10 minutes each, the sections were incubated for 2 hours at room temperature with of Alexa Fluor 594-labeled anti-mouse IgG (Invitrogen, Carlsbad, CA) diluted 1: 200 in blocking solution. Coverslips were applied with Vectashield (Vector Laboratories, Burlingame, CA).

Cell counts and statistical analysis

The sections were examined and images were captured using a inverted fluorescence microscope (TE2000, Nikon Instruments, Tokyo, Japan) with a G-2A filter (Nikon Instruments) to reveal BrdU-labeled cells with 4X and 10X objective lens. Numbers of anti-BrdU cells were determined and captured with a digital camera (DXM1200, Nikon Instruments) and Image-Pro Plus 6.0 software (Media Cybernetics Inc, USA). In the ablation experiment, number of anti-BrdU cells were counted in the habenula region on approximately 15 sections (n = 6). All values are expressed as mean ± SEM. Data were compared by using an analysis of variance (ANOVA) for multiple comparison with the Tukey-Klamer post-hoc test.

Sample preparation and protein extraction

Twenty-seven adult male zebrafish were randomly divided into sham, 20-hour post-ablation and 40-hour post-ablation groups, with 9 in each group. Eighteen zebrafish were habenula ablated and sacrificed 20 hours and 40 hours after respectively. Dissected whole brain was immediately homogenized in lysis buffer and frozen with dry ice until further processes.

For cytoplasmic level zebrafish brain extraction, 150 µl of lysis buffer containing 5% of 1.0 M Tris-HCl (Sigma), 10% of 1.0M KCl, 20% of Glycerol (Fisher Scientific) and 1% of protease inhibitor (Amersham) was added into a microcentrifuge tube. Zebrafish brain was homogenized via sample grinding stick. Homogenate was vortexed vigorously for few minutes and centrifuged at 14,000 rpm for 20 minutes at 4°C. The supernatant was collected as cytoplasm protein lysate from zebrafish brain. The lysate was stored at -20°C for further use.

Sample cleanup

Abundance protein removal was first performed using ProteoExtract Albumin/IgG Removal Kit (Merck). The abundance protein depleted sample was then re-concentrated and desalted via 3K cut-off centrifugal filter device (Amicon Ultra-4). The fractionated lysate was further purified with 2-D Clean-Up Kit (GE Healthcare) for protein precipitation and contaminating substances (such as nucleic acids, salts, lipids and detergents) removal before submitted for 2-D electrophoresis.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Protein pellet produced from the previous cleanup precipitation kit was resuspended in 20µl of lysis buffer (recommended for DIGE) containing 7M of Urea, 2M of Thiourea, 30mM of Trizma base and 4% (w/v) of CHAPS, adjusted to pH 8.5. The protein concentration was determined by using a 2-D Quant Kit (GE Healthcare).

Fluorescence labeling with CyDyes

Brain lysates were thawed, vortexed and leave at room temperature for 1 hour before labeling, and the pH was adjusted to 8.5. The minimal CyDye kit (GE Healthcare) was used to label the lysate according to the manufacturer's recommended protocol.

Lysates from 3 animals were pooled as one due to insufficient concentration of protein for one minimal CyDye labeling. For the internal standard, a pool of all lysates was labeled with using Cy2, individual samples (pooled from 3 animals) were labeled with Cy3 and Cy5. Ten micrograms of protein was labeled with 80pmol of working CyDye solutions (CyDyes reconstituted in dimethylformamide) for 30 minutes at 4°C in the dark. The reaction was terminated by addition of 1µl 10mM lysine to the mixture for 10 minutes in the dark on ice. The CyDye-labeled lysates were then ready first dimension isoelectric focusing separation.

2-DE and image analysis

Seven-centimeter Immobiline immobilized pH gradient (IPG) DryStrips (pH 3-10) were placed in the chamber for overnight rehydration with 125 µl of rehydration buffer (2M thiourea, 7M urea, 2% (w/v) CHAPS, 2% IPG buffer, 2% DTT and trace amount of bromophenol blue) at room temperature without sample. The CyDyes-labeled samples were then diluted with rehydration buffer were loaded by cup loading at the anodic end on top of the rehydrated IPG strips. The strips were then subjected to first-dimension separation by using an IPGphor system (GE Healthcare) with the following protocol: 300V for 30 min; 1kV (gradient) for 30 min; 5kV (gradient) for 1:20 hr; 5kV for 30 min and holding. The focused strips were equilibrated at room temperature for 15 min in equilibration buffer (75mM Tris-HCl with pH 8.8, 6M Urea, 30% (v/v) glycerol, 2% (w/v) SDS, trace amount of bromophenol blue) with 0.5% (w/v) of DTT, followed by another 15 min equilibration buffer washing with 4.5% (w/v) iodoacetamide added in. The equilibrated strips were electrophoresed on 12.5% SDS gels using SDS electrophoresis buffer.

The electrophoresed second dimension SDS gels were immediately scanned for Cy2 (520 BP40 filter), Cy3 (580 BP30 filter), and Cy5 (670 BP30) fluorescence with the use of a Typhoon Trio Imager (GE Healthcare) at a pixel resolution of 100 µm. The scanned gel images were loaded into the DeCyder software program v6.0 (Amersham, GE Healthcare) for differential in-gel analysis (DIA) and biological variation analysis (BVA).

Following electrophoresis, the gels were fixed in 10% acetic acid and stained with Brilliant Commassie blue. Commassie stain was used to indicate enough concentration was present in the spots to generate high-quality mass spectra. The stained gels were matched and compared with images to determine the positions of the protein spots of interest.

Mass spectrometry and protein identification

Excised gels were destained by washing in 50mM ammonium bicarbonate containing 50% of acetonitrile for at least 20 min to totally remove the dye. The gel pieces were then washed for 60 min in 20 mM ammounium bicarbonate, and 10 min in acetonitrile for dehydration. These steps were to be repeated for twice. The gel pieces were then air dried before added with trypsin (Promega) (5µl trypsin stock 100ng/µl in 0.1% TFA), 20 mM ammonium bicarbonate was also added to enough cover the gel piece. This in-gel trypsin digestion was conducted by incubating at 37°C overnight. The digests were sonicated in water bath for 10 min after overnight incubation. The digests were desalted and concentrated via ZipTips (Milipore) before 0.5µl were spotted on matrix-assisted laser desorption ionization (MALDI) plate on top of 0.5 µl of α-hydroxycinnamic acid matrix.

The dried spots with matrix-tryptic digests were analyzed by 4700 MALDI TOF-TOF (Applied Biosystems). The spectra were collected over the range m/z 800 to 3,500. Spectra were processed by using 4000 series Explorer software (Applied Biosystems) to generate monoisotopic peptide masses, which were used to identify proteins using Mascot Server and MascotScience against the National Center for Biotechnology information (NCBI) database. Cysteine modification by iodoacetamide, methionine oxidation modification, 50 ppm peptide tolerance and one missed trypsin cleavage were included as search parameters.

Real-time quantification PCR

Total RNAs were isolated from 0 (intact), 10, 20 and 40hr post-ablation zebrafish brains using Trizol (Invitrogen). Six hundred nanograms of total RNAs were reversed transcribed with RT random primers (High Capacity, ABI) for real-time PCR were designed using Primer Express software version 2.0 (Applied Biosystems). The primer sequences for SPRED2 gene are 5'-AAGGCCACGCCCACATTT -3' (forward) and 5'- AAACTGTCTCCTCACGCTT -3' (reverse). The primers for internal control β-tubulin were designed as follows: 5'- TGAATGGATCCCAAACAACGT -3' (forward) and 5'- GGTGCTGTTGCCATGAAG -3' (reverse). Real time quantification was conducted in the ABI Prism@7000 Sequence Detection System (Applied Biosystems) with using SYBR Green for the quantification. The Ct of SPRED2 was determined and normalized against the internal control. Data was then analyzed according to relative gene expression by 2-ΔΔCt.


Habenula regeneration in zebrafish

The habenula was used as the targeting region because it is located on the surface of teleost brain which ease the removal operation, as well as it is one of the adult stem cell niches in the brain of teleost (Hendricks and Jesuthasan, 2008; Kaslin et al., 2009).

Habenula was ablated via aspirating method guided with stereotaxic apparatus and specific landmark (Fig. 1), which resulted in a gradual restoration of the tissue at the site of the removal, as observed in histologically processed brain sections taken after various survival times of the fish via DAPI staining, BrdU and TUNEL immunohistochemistry (Fig. 2).

The fish were allowed to survive for 1, 3, 15 and 40 days after the habenula region being ablated. Meanwhile, two immunohistochemical tests, TUNEL and BrdU, were subjected to these four stages of animals to observe their morphology changes in the brain after the habenula removal operation. The cell proliferation and apoptosis of the regenerative process were monitored through BrdU and TUNEL immunohistochemistry respectively. Other than that, 4'-6-Diamidino-2-phenylindone (DAPI) staining, which is a fluorescent nuclear counterstaining, was used to observe the morphology of the habenula region (Fig. 2 A, D, G, J and M). Gradual restoration of the habenula structure was observed from these four stages using the above morphology staining methods.

The baseline level of TUNEL-labeled cells was as shown in sham (Fig 2B). The habenula region after ablation was condensed with TUNEL-labelled cells one day after the operation (Fig. 2E). TUNEL-labeled cells were slightly reduced 3 days after the ablation, relatively to first day after the ablation (Fig. 2H). However, the amount of TUNEL-labelled cells was still much higher compare to the sham baseline. Half month after the ablation, the TUNEL-labelled cells were dropped back to the baseline level (Fig 2K).

The proliferation activity at the habenula ablation site was observed through labelling of BrdU positive cells. BrdU positive-cells around the ablation site started to increase significantly on the third day after the ablation (Fig. 2I). At 15-day post ablation, there was still significantly higher number of BrdU-positive cells seen at the ablation site (Fig. 2L). High density of BrdU-positive cells was located at the ablation site. At the same time, partial morphology of habenula was observed through the DAPI staining (Fig. 2J). BrdU-labelled cell seen in regenerating habenula was back to baseline level gradually nearly 2 months after the ablation.

Forty days after the operation, the morphology structure of habenula was gradually grown back to an oval-shaped like region on 40 days after the habenula being removed (Fig. 11M). However, from the DAPI nuclear counterstaining, some morphology difference was observed. Further study is required to explain the difference.

First appearance of newborn cells

Apoptotic cells appeared one day after the injury. Meanwhile, BrdU-immunostained cells around the ablation site remained the same as sham-operated (Figure 3A). However, drastic increased of the BrdU-immunostained cells were observed through the whole brain, included optic tectum and hypothalamus areas (Fig. 3A). BrdU-immunostained cells counting also showed significant increased more than two-fold higher (P <0.05) (Fig. 3B). This observation indicated a lot of molecules and mechanisms have taken place to trigger large amount of new cells to be synthesis for neural tissue repair and regeneration. Differences in protein expression between intact and injured brain extraction were studied to understand the changes that lead to significant increase of new cell synthesis.

Identification of differentially expressed proteins

To compare the protein expression profiles of intact and 20hr/ 40hr post-ablation of zebrafish brain samples, cytoplasmic protein was extracted and analyzed through DIGE. Cy3 and Cy5 scans were aligned for spot intensity differential study by using DeCyder-DIA software (Figure 4). A total of around 600 sports from all gels were detected by the software. Out of the gels, there were only about 7-10% that showed with more than 1.5-fold changes (P<0.05) between the intact and injured fish brain (Fig. 4F). The spots with more than 1.5-fold changes and visible after commassie blue staining (to ensure sufficient amount of protein for analysis) were selected to be proceeded with MALDI TOF-TOF protein identification.

Table 1 shows the list of peptides identified from the ≥1.46-fold changes and with significant protein score while doing the peptide sequence matching. Overall, there were 19 up-regulated proteins and 3 down-regulated proteins comparing between normal and 20hr/ 40hr post-ablation samples (Table 1). In the present study, we are interested in identifying proteins that potentially involved in early stage new cell stimulation. Thus another table was prepared to show the potential molecules with their literatures that could be playing roles in new cell synthesis stimulation (Table 2). In summary, proteins from the potential list (Table 2) that showed up-regulated 20hr/ 40hr after injury included cysteine-rich motor neuron 1 protein, ependymin, fibulin1, follistatin-A, Laminin 1 protein, lessencephaly-1 homolog B, metallothionein 1& 2 and vascular endothelial growth factor A-A; whereas there was only one down-regulated protein which is sprouty-related EVH1 domain-containing protein 2 (SPRED2). Out of the 10 proteins, it is found that sprouty-related EVH1 domain-containing protein 2 has no report directly investigating its involvement in neurogenesis. Thus further experiment was conducted to confirm the expression of SPRED2. Due to unavailable of antibody for zebrafish SPRED2, verification was conducted via quantifying mRNA gene expression of SPRED2.

Verification of proteomic results

Due to unavailable of SPRED2 antibody specific on fish, gene expression was chosen to validate the expression SPRED2 after ablation. Messenger RNA from normal, 10hr, 20hr and 40hr post-ablation of zebrafish whole brain was extracted. Beta-tubulin was selected as it was reported to be a more consistent internal control compare to beta-actin (Liu and Xu, 2006).

It is shown that SPRED 2 gene expression was significantly decreasing at every timeframes: 0hr vs 20hr (P< 0.05); 20hr vs 40hr (P< 0.05); and 0hr vs 40hr (P< 0.01). Nearly 2-fold decreased was seen 40hr after ablation compare to intact of the SPRED2 gene expression.


Neuro-regeneration of habenula

Guided by landmarks on the zebrafish head, habenula removal can be done in a defined way. The first study showed the neuro-regeneration ability of the zebrafish brain after the habenula being ablated. The ablated habenula was observed to gradually regenerate structurally about 40 day post-ablation.

One day immediately after the ablation, the detached and destroyed tissues were highly stained with TUNEL signals, which indicate the apoptosis status of the ablated tissues. Apoptotic cells were greatly reduced two more days after the ablation. At the same time, sharp-increased number of BrdU-positive proliferative cells was observed around the ablated site. These observations suggest that apoptosis was taking place and mediating removal and elimination of damaged cells before replacement of newly generated neuronal tissues (Zupanc et al., 1998). The time course change of BrdU-positive proliferative cells at the ablation site was clearly different from that of apoptotic events. Besides, most of the BrdU-positive cells were populated at the peripheral layer of the optic tectum and also nearby the ablation site. These observations suggest that newborn cells started being generated after the damaged tissues have been cleared, which happened between day-1 and day-3 post-ablation as sudden high number of newborn cells was observed. Similar observation was also reported by Zupanc and his co-workers. Cell proliferation is dramatically up-regulated, both in areas near the lesion and in proliferation zones of the CCb that continuously generate new cell in intact Brown ghosts (A. Leptorhynchus) (Zupanc and Ott, 1999).

In fish brain, there is a continuous provision of newborn cells or undifferentiated cells under intact condition, whereas during injury, new cells are recruited more rapidly to compensate the cell lost (Zupanc and Ott, 1999). This is most likely because of the presence of substances released from the apoptotic cells or neighbouring cells, which activates the proliferative site to generate more newborn cells or molecular factor(s) to provoke neurogenesis. Thus it is important to investigate the up- and down- regulated molecules during the timeframe between 1-day and 3-day survival post-ablation. It could lead to a new breakthrough to how to stimulate and regulate new cells synthesis in adult brain.

Differential expressed proteins

Samples from 20hr and 40hr post-ablation were analysed in comparison with intact tissue with 2D-gels. 20 proteins were identified from spot intensity with more than 1.5 folds changed (2 S.D., P< 0.05). Out of the 20 proteins identified, there are 10 proteins that are reported to have both direct and indirect correlation on neuroprotection, neurogenesis stimulation and neural progenitor differentiation (Table 3). Among the 10 proteins, SPRED2 (Sprouty-related- EVH1 domain-containing protein 2) and metallothionein 1/2 were reported to be playing essential roles during early stage of regeneration after injury.

Real-time PCR quantification was also done to validate the protein expression being identified. It was found that the result of gene expression quantification of metallothionein and SPRED2 were in agreement with the proteomic analysis. Metallothionein showed significant nearly 2-fold of sharp raise 20hrs after the injury. On the other hand for SPRED2, 40hrs after the ablation showed 2.21 folds decrement in proteomic analysis; and 2-fold decreased was observed in gene expression. Both results from proteomics and real-time PCR supported the notion that metallothionein and SPRED2 expression was affected which caused decreasing in both gene and protein expression.

Metallothionein 1 and 2 are reported to have neuroprotective actions and suppress or minimize the damages from oxidative stress and degeneration (Stankovic et al., 2007). Metallothionein 1 & 2 knockout mice exhibited chronic inflammation and neuro-degeneration (Penkowa et al., 1999). Impaired brain parenchyma recovery, prolonged inflammatory, and significant increase of oxidative stress and apoptosis were observed in the knockout mice after brain injury (Penkowa et al., 2006).

Sprouty family is known for receptor tyrosine kinases (RTKs) pathway downregulator by controlling the Ras and Raf (Kim and Bar-Sagi, 2004, Wakioka et al., 2001, Li et al., 2010, King et al., 2005). This pathway is important in regulating cell differentiation, proliferation and survival (Wakioka et al., 2001). In mammals, there are four type of SPRY genes (SPRY1-4); while 3 were identified in zebrafish (SPRY1, 2 and 4)(Kim and Bar-Sagi, 2004, Topp et al., 2008). It is understood that each Sprouty gene is regulating different growth factors. For instant, Sprouty 1 and 2 are inhibiting FGF (Fibroblast growth factor) and VEGF (vascular endothelial growth factor), but not EGF (epidermal growth factor) (King et al., 2005).

Recently, another Sprouty-like gene was found, named as Sprouty-related EVH1 domain, a central c-kit-binding domain, and a conserved cysteine-rich (Sprouty) domain at the C-terminus (Wakioka et al., 2001, King et al., 2005). At the moment, there are only two SPRED types were identified, SPRED 1 and SPRED 2. Similarly with Sprouty protein, it inhibits the activation of mitogen-activated protein (MAP) kinase by suppressing phosphorylation and activation of Raf induced by NGF (nerve growth factor) and EGF due to the presence of both Sprouty and EVH1 domains (Wakioka et al., 2001, King et al., 2005). It is further supported by another study by Phoenix and Temple (2010), which successfully proved that SPRED1 (another domain of Sprouty related protein) is crucial in neural progenitor cells renewal/ proliferation modulation. Knockdown of SPRED1 via shRNA had successfully enhanced progenitor cell-renewal and proliferation (Phoenix and Temple, 2010). This study further confirms the important role of SPRED2 in regulating the new neural cells being generated after injury. Under intact condition, SPRED2 was relatively high-expressed to suppress the unnecessary cell proliferation and differentiation. When there is injury or huge lost of neural cells, SPRED2 expression will immediately being down-regulated to release the pathway of Ras-MAPK-ERK, which increases the cell proliferation, differentiation and migration. In one of the mammalian neurogenic zone, subventricular zone, appears to express the EGF receptor (Doetsch et al., 2002). Besides, infusion of EGF or FGF-2 increases cell proliferation in the adult brain (Kuhn et al., 1997). These studies can further proven the potential of the SPREDs to be one of the regulators for neural stem cell synthesis not just in teleost, but also mammals.

Another function that has been reported is SPREDs is one of the key regulators of RhoA-mediated cell motility, especially for migration of endothelial cells (Miyoshi et al., 2004). Over-expression of SPRED inhibited tumour metastasis, cell migration and Rho-dependent stress fiber formation (Miyoshi et al., 2004). However, latest study was suggesting there might not be a direct interaction between Sprouty proteins and RTKs pathway (Ahn et al., 2010). Thus the complete mechanism involved is still remains unclear.

With all the studies above, we hypothesized that metallothionein and SPREDs could be playing an important role in regulating or stimulating new cells after injury. Nevertheless, more future studies are required to study the expression regulation of metallothionein and SPRED2 at the early stage of regeneration. Combination of both factors might contribute more new insights into the factors that limit the neuro-regeneration of injured CNS in mammals.

AHN, J. H., EUM, K. H. & LEE, M. 2010. Spry2 does not directly modulate Raf-1 kinase activity in v-Ha-ras-transformed NIH 3T3 fibroblasts. BMB Rep, 43, 205-11.

ARVIDSSON, A., COLLIN, T., KIRIK, D., KOKAIA, Z. & LINDVALL, O. 2002. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nature Medicine, 8, 963-970.

CAMERON, H. A., HAZEL, T. G. & MCKAY, D. G. 1998. Regulation of neurogenesis by growth factors and neurotransmitters. Journal of Neurobiology, 36, 287-306.

CHAPOUTON, P., JAGASIA, R. & BALLY-CUIF, L. 2007. Adult neurogenesis in non-mammalian vertebrates. BioEssays, 29, 745-757.

DAVID, S. & LACROIX, S. 2003. Molecular approaches to spinal cord repair. Annu Rev Neurosci, 26, 411-40.

DOETSCH, F., PETREANU, L., CAILLE, I., GARCIA-VERDUGO, J. M. & ALVAREZ-BUYLLA, A. 2002. EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. Neuron, 36, 1021-34.

JIN, K., L., P. A., MAO, X. O., XIE, L., COTTRELL, B. A., HENSHALL, D. C. & GREENBERG, D. A. 2004. Increased hippocampal neurogenesis in Alzheimer's disease. PNAS, 101, 343-347.

JIN, K., WANG, X., XIE, L., MAO, X. O., ZHU, W., WANG, Y., SHEN, J., MAO, Y., BANWAIT, S. & GREENBERG, D. A. 2006. Evidence for stroke-induced neurogenesis in the human brain. PNAS, 103, 13198-13202.

KANG, S. K., SO, H. H., MOON, Y. S. & KIM, C. H. 2006. Proteomic analysis of injured spinal cord tissue proteins using 2-DE and MALDI-TOF MS. Proteomics, 6, 2797-2812.

KIM, H. J. & BAR-SAGI, D. 2004. Modulation of signalling by Sprouty: a developing story. Nature Reviews Molecular Cell Biology, 5, 441-450.

KING, J. A., STRAFFON, A. F., D'ABACO, G. M., POON, C. L., I, S. T., SMITH, C. M., BUCHERT, M., CORCORAN, N. M., HALL, N. E., CALLUS, B. A., SARCEVIC, B., MARTIN, D., LOCK, P. & HOVENS, C. M. 2005. Distinct requirements for the Sprouty domain for functional activity of Spred proteins. Biochem J, 388, 445-54.

KUHN, H. G., WINKLER, J., KEMPERMANN, G., THAL, L. J. & GAGE, F. H. 1997. Epidermal growth factor and fibroblast growth factor-2 have different effects on neural progenitors in the adult rat brain. J Neurosci, 17, 5820-9.

LI, D., JACKSON, R. A., YUSOFF, P. & GUY, G. R. 2010. The direct association of Sprouty-related protein with an EVH1 domain (SPRED) 1 or SPRED2 with DYRK1A modifies substrate/kinase interactions. Journal of Biological Chemistry.

LILLEY, K. & FRIEDMAN, D. 2006. Difference gel electrophoresis DIGE. Drug Discovery Today: Technologies, 3, 347-353.

LIU, N.-K. & XU, X.-M. 2006. Beta-tubulin is a more suitable internal control than beta-actin in western blotting analysis of spinal cord tissues after traumatic injury. Journal of Neurotrauma, 23, 1791-1801.

MIYOSHI, K., WAKIOKA, T., NISHINAKAMURA, H., KAMIO, M., YANG, L., INOUE, M., HASEGAWA, M., YONEMITSU, Y., KOMIYA, S. & YOSHIMURA, A. 2004. The Sprouty-related protein, Spred, inhibits cell motility, metastasis, and Rho-mediated actin reorganization. Oncogene, 23, 5567-76.

PENKOWA, M., CÁCERES, M., BORUP, R., NIELSEN, F. C., POULSEN, C. B., QUINTANA, A., MOLINERO, A., CARRASCO, J., FLORIT, S., GIRALT, M. & HIDALGO, J. 2006. Novel roles for metallothionein-I + II (MT-I + II) in defense responses, neurogenesis, and tissue restoration after traumatic brain injury: Insights from global gene expression profiling in wild-type and MT-I + II knockout mice. Journal of Neuroscience Research, 84, 1452-1474.

PENKOWA, M., CARRASCO, J., GIRALT, M., MOOS, T. & HIDALGO, J. 1999. CNS wound healing is severely depressed in metallothionein I- and II-deficient mice. J Neurosci, 19, 2535-45.

PHOENIX, T. N. & TEMPLE, S. 2010. Spred1, a negative regulator of Ras-MAPK-ERK, is enriched in CNS germinal zones, dampens NSC proliferation, and maintains ventricular zone structure. Genes Dev, 24, 45-56.

SÎRBULESCU, R. F. & ZUPANC, G. K. H. 2009. Dynamics of caspase-3-mediated apoptosis during spinal cord regeneration in the teleost fish, Apteronotus leptorhynchus. Brain Research, 1304, 14-25.

STANKOVIC, R. K., CHUNG, R. S. & PENKOWA, M. 2007. Metallothioneins I and II: Neuroprotective significance during CNS pathology. The International Journal of Biochemistry & Cell Biology, 39, 484-489.

TOPP, S., STIGLOHER, C., KOMISARCZUK, A. Z., ADOLF, B., BECKER, T. S. & BALLY-CUIF, L. 2008. Fgf signaling in the zebrafish adult brain: Association of Fgf activity with ventricular zones but not cell proliferation. The Journal of Comparative Neurology, 510, 422-439.

WAKIOKA, T., SASAKI, A., KATO, R., SHOUDA, T., MATSUMOTO, A., MIYOSHI, K., TSUNEOKO, M., KOMIYA, S., BARON, R. & YOSHIMURA, A. 2001. Spred is a sprouty-related supressor of Ras signalling. Nature, 412, 647-651.

ZUPANC, G. K., KOMPASS, K. S., HORSCHKE, I., OTT, R. & SCHWARZ, H. 1998. Apoptosis after injuries in the cerebellum of adult teleost fish. Exp Neurol, 152, 221-30.

ZUPANC, G. K. & OTT, R. 1999. Cell proliferation after lesions in the cerebellum of adult teleost fish: time course, origin, and type of new cells produced. Exp Neurol, 160, 78-87.

ZUPANC, M. & ZUPANC, G. 2006. Upregulation of calbindin-D28k expression during regeneration in the adult fish cerebellum. Brain Research, 1095, 26-34.

ADAMS, D. S., HASSON, B., BOYER-BOITEAU, A., EL-KHISHIN, A. & SHASHOUA, V. E. 2003. A peptide fragment of ependymin neurotrophic factor uses protein kinase C and the mitogen-activated protein kinase pathway to activate c-Jun N-terminal kinase and a functional AP-1 containing c-Jun and c-Fos proteins in mouse NB2a cells. J Neurosci Res, 72, 405-16.

ASMUSSEN, J. W., VON SPERLING, M. L. & PENKOWA, M. 2009. Intraneuronal signaling pathways of metallothionein. Journal of Neuroscience Research, 87, 2926-2936.

BUNDSCHU, K. 2005. Gene Disruption of Spred-2 Causes Dwarfism. Journal of Biological Chemistry, 280, 28572-28580.

DUBAND, J. L., BELKIN, A. M., SYFRIG, J., THIERY, J. P. & KOTELIANSKY, V. E. 1992. Expression of alpha 1 integrin, a laminin-collagen receptor, during myogenesis and neurogenesis in the avian embryo. Development, 116, 585-600.

GLIENKE, J., STURZ, A., MENRAD, A. & THIERAUCH, K. H. 2002. CRIM1 is involved in endothelial cell capillary formation in vitro and is expressed in blood vessels in vivo. Mech Dev, 119, 165-75.

HANSEN, T. M., MOSS, A. J. & BRINDLE, N. P. 2008. Vascular endothelial growth factor and angiopoietins in neurovascular regeneration and protection following stroke. Curr Neurovasc Res, 5, 236-45.

HEATON, M. B. & SWANSON, D. J. 1988. The influence of laminin on the initial differentiation of cultured neural tube neurons. J Neurosci Res, 19, 212-8.

JIN, K., ZHU, Y., SUN, Y., MAO, X. O., XIE, L. & GREENBERG, D. A. 2002. Vascular endothelial growth factor (VEGF) stimulates neurogenesis in vitro and in vivo. Proc Natl Acad Sci U S A, 99, 11946-50.

KOLLE, G., GEORGAS, K., HOLMES, G. P., LITTLE, M. H. & YAMADA, T. 2000. CRIM1, a novel gene encoding a cysteine-rich repeat protein, is developmentally regulated and implicated in vertebrate CNS development and organogenesis. Mech Dev, 90, 181-93.

LEUNG, Y. K. J., PANKHURST, M., DUNLOP, S. A., RAY, S., DITTMANN, J., EATON, E. D., PALUMAA, P., SILLARD, R., CHUAH, M. I. & WEST, A. K. 2010. Metallothionein induces a regenerative reactive astrocyte phenotype via JAK/STAT and RhoA signalling pathways. Experimental Neurology, 221, 98-106.

LI, D., JACKSON, R. A., YUSOFF, P. & GUY, G. R. 2010. The direct association of Sprouty-related protein with an EVH1 domain (SPRED) 1 or SPRED2 with DYRK1A modifies substrate/kinase interactions. Journal of Biological Chemistry.

MARCORELLES, P., LAQUERRIERE, A., ADDE-MICHEL, C., MARRET, S., SAUGIER-VEBER, P., BELDJORD, C. & FRIOCOURT, G. 2010. Evidence for tangential migration disturbances in human lissencephaly resulting from a defect in LIS1, DCX and ARX genes. Acta Neuropathol, 120, 503-15.

MORRIS, N. R., EFIMOV, V. P. & XIANG, X. 1998. Nuclear migration, nucleokinesis and lissencephaly. Trends Cell Biol, 8, 467-70.

MRUTHYUNJAYA, S., MANCHANDA, R., GODBOLE, R., PUJARI, R., SHIRAS, A. & SHASTRY, P. 2010. Laminin-1 induces neurite outgrowth in human mesenchymal stem cells in serum/differentiation factors-free conditions through activation of FAK-MEK/ERK signaling pathways. Biochem Biophys Res Commun, 391, 43-8.

OHSAWA, I., TAKAMURA, C. & KOHSAKA, S. 2001. Fibulin-1 binds the amino-terminal head of beta-amyloid precursor protein and modulates its physiological function. J Neurochem, 76, 1411-20.

PENKOWA, M., CÁCERES, M., BORUP, R., NIELSEN, F. C., POULSEN, C. B., QUINTANA, A., MOLINERO, A., CARRASCO, J., FLORIT, S., GIRALT, M. & HIDALGO, J. 2006. Novel roles for metallothionein-I + II (MT-I + II) in defense responses, neurogenesis, and tissue restoration after traumatic brain injury: Insights from global gene expression profiling in wild-type and MT-I + II knockout mice. Journal of Neuroscience Research, 84, 1452-1474.

RAAB, S., BECK, H., GAUMANN, A., YUCE, A., GERBER, H. P., PLATE, K., HAMMES, H. P., FERRARA, N. & BREIER, G. 2004. Impaired brain angiogenesis and neuronal apoptosis induced by conditional homozygous inactivation of vascular endothelial growth factor. Thromb Haemost, 91, 595-605.

REINER, O., ALBRECHT, U., GORDON, M., CHIANESE, K. A., WONG, C., GAL-GERBER, O., SAPIR, T., SIRACUSA, L. D., BUCHBERG, A. M., CASKEY, C. T. & ET AL. 1995. Lissencephaly gene (LIS1) expression in the CNS suggests a role in neuronal migration. J Neurosci, 15, 3730-8.

SIVAK, J., PETERSEN, L. & AMAYA, E. 2005. FGF Signal Interpretation Is Directed by Sprouty and Spred Proteins during Mesoderm Formation. Developmental Cell, 8, 689-701.

SUAREZ-CASTILLO, E. C., MEDINA-ORTIZ, W. E., ROIG-LOPEZ, J. L. & GARCIA-ARRARAS, J. E. 2004. Ependymin, a gene involved in regeneration and neuroplasticity in vertebrates, is overexpressed during regeneration in the echinoderm Holothuria glaberrima. Gene, 334, 133-43.

VUKOVIC, J., MARMORSTEIN, L. Y., MCLAUGHLIN, P. J., SASAKI, T., PLANT, G. W., HARVEY, A. R. & RUITENBERG, M. J. 2009a. Lack of fibulin-3 alters regenerative tissue responses in the primary olfactory pathway. Matrix Biol, 28, 406-15.

VUKOVIC, J., RUITENBERG, M. J., ROET, K., FRANSSEN, E., ARULPRAGASAM, A., SASAKI, T., VERHAAGEN, J., HARVEY, A. R., BUSFIELD, S. J. & PLANT, G. W. 2009b. The glycoprotein fibulin-3 regulates morphology and motility of olfactory ensheathing cells in vitro. Glia, 57, 424-43.

WU, H. H., IVKOVIC, S., MURRAY, R. C., JARAMILLO, S., LYONS, K. M., JOHNSON, J. E. & CALOF, A. L. 2003. Autoregulation of neurogenesis by GDF11. Neuron, 37, 197-207.

YANG, Y., LIU, J., MAO, H., HU, Y. A., YAN, Y. & ZHAO, C. 2009. The expression pattern of Follistatin-like 1 in mouse central nervous system development. Gene Expr Patterns, 9, 532-40.

CAMERON, H. A., HAZEL, T. G. & MCKAY, D. G. 1998. Regulation of neurogenesis by growth factors and neurotransmitters. Journal of Neurobiology, 36, 287-306.

JIN, K. 2004. Proteomic and immunochemical characterization of a role for stathmin in adult neurogenesis. The FASEB Journal, 18, 287-299.