Molecular Techniques For The Identification biology essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Fundamental to our understanding of udder health, for both the application of evidence-based prevention and control strategies and to implement rational mastitis research planning, is a scientifically valid, systematic evaluation of current pathogen levels and mitigation procedures. The actual burden of disease caused by each pathogen will direct judicious allocation of the public and private resources. Therefore, the focus of prevention and control of mastitis problems on the farm level depends on the pathogen(s) involved. Laboratory methods and handling procedures can affect the recovery of bacteria. Frozen storage has a negative effect on the recovery of Escherichia coli (Schukken et al., 1989) and Mycoplasma spp. (Biddle et al., 2004) from clinical mastitis samples, while it had a positive effect on the recovery of coagulase-negative staphylococci (CNS; Schukken et al., 1989). Other methods, like centrifugation of milk samples, have shown increased recovery of Staphylococcus aureus of samples which would return normally as (false-)negative (Sol et al., 2002; Zecconi et al., 1997). Improved techniques for the rapid and accurate detection and identification of the causative organism are critical to the judicious selection and timely use of the antibiotic of choice to control the inflammation of mammary gland. Clinical microbiology laboratories consider that the most precise method of detecting bacteria is growth in a culture. Species identification subsequent to culturing is usually accomplished by a comprehensive determination of phenotypic profiles including Gram stain results, morphology, growth requirements, biochemical or biophysical properties, and when available, specific antigen or agglutination tests. Since most of the phenotypic and biochemical properties are determined by the metabolism of actively growing cells, analysis requires a considerable number of pure organisms, and differentiation down to species level necessitates subculture in the presence of various substrates and/or selective media. Often accurate identification is compromised when common bacterial species are presented with uncommon phenotypes, or when unusual species are encountered whose phenotypic profiles are not yet available in the database (Reischl, 2006). Phenotypic methods fail to make a reliable distinction between the isolates belonging to same species because of the variable expression of the phenotypic characters (Bannerman et al., 1993; Heikens et al., 2005).

Coagulase-negative staphylococci have become the predominant pathogens causing bovine mastitis in many countries (Olde Riekerink et al., 2008; Piepers et al., 2009). Majority of heifer mastitis are caused by CNS and a variety of them have been recovered from teat skin, the streak canal and pre-calving udder secretion obtained from heifers (Nickerson et al., 1995; Borm et al., 2006). Many schemes for the identification of CNS based on phenotypic characteristics have been developed (Devriese et al., 1994), which require numerous media and are also labour intensive. Also, they require extended incubation periods that limit usefulness for routine diagnostics. An ideal test for routine diagnostic laboratory identification of CNS species in milk samples of cows would be reliable, time and cost-effective and easy to perform. Diagnostic laboratories often utilize commercial test kits like the API Staph ID 32 (API Test, bioMérieux, France) and the Staph-Zym test (Rosco, Taastrup, Denmark) for phenotypic identification of CNS, but they lack accuracy as these tests and their accompanying databases were mainly developed for human isolates (Watts and Washburn, 1991, Thorberg and Brändström, 2000; Taponen et al., 2006; Zadoks and Watts, 2009). Capurro et al. (2009) observed that the accuracy of commercialized phenotypic system (Staph-ZymTM) varied widely between CNS species and the test had low specificity in identification of important pathogens such as Staphylococcus chromogenes. For identification of CNS species, sequence data of housekeeping genes such as rpoB, cpn60, dnaJ or tuf can be used (Drancourt and Raoult, 2002; Shah et al., 2007; Zadoks and Watts, 2009). Heikens et al. (2005) opined genotypic identification based on partial sequencing of the tuf gene as a reliable and reproducible method for identification of CNS. Ghebremedhin et al. (2008) suggested that gap (glyceraldehyde-3-phosphate dehydrogenase) gene, being less conserved compared to the other genes such as16S rRNA, hsp60, sodA, rpoB, tuf, is a suitable target for taxonomical analysis of this staphylococci.

Culture-negative mastitis

Based on the outcome of laboratory analyses of clinical mastitis samples, treatment decisions can be made and management problems on a dairy herd with mastitis problems can be addressed and identified. Culture of milk samples of clinical mastitis cases is, therefore, important to determine the distribution of pathogens involved. Additionally, in prevalence studies and surveys a misclassification may occur if mastitis caused by certain pathogens more often results in negative cultures. However, in 25 to 40% of clinical mastitis samples, no bacterial pathogen is cultured (Barkema et al., 1998; Erskine et al., 1988; Olde Riekerink et al., 2008; Schukken et al., 1989). With decreasing bulk milk SCC the percentage of culture-negative clinical mastitis samples increases (Erskine et al., 1988; Schukken et al., 1989). Bacteria do not grow in conventional culture in a substantial proportion of mastitis milk samples. No bacterial growth is detected in at least 20 to 30% of milk samples collected from udder quarters with clinical mastitis; 27% incidence in the United Kingdom (Bradley et al., 2007) and 27% in the United States (Hogan et al., 1989). Koivula et al. (2007) and Nevala et al. (2004) reported 24 and 27% incidence of no growth samples in subclinical mastitis in Finland. In Canada, a high figure of 44% of culture-negative mastitis was recently reported (Olde Riekerink et al., 2008). No growth samples are found to be more common in subclinical mastitis, the percentage ranged from 29% (Koivula et al., 2007) to 39% (Bradley et al., 2007). Makovec and Ruegg (2003) reported an increase in no growth samples from 23 to 50% in Wisconsin during 1994 to 2001without differentiating between subclinical and clinical mastitis. It has been hypothesized that the highest proportion of culture-negative clinical mastitis cases is associated with E. coli (Zorah et al., 1993). Additionally, S. aureus mastitis can result in a negative culture because of the frequently low concentration of bacteria in the milk (Sears et al., 1993). To the dairy farmer this high percentage has a negative impact on his motivation to collect milk samples from cows with (sub) clinical mastitis.

Although many have tried to explain why or why not pathogens would appear in a routine culture of a mastitis sample and that reliable testing methods (PCR) exist without using culture techniques (Riffon et al., 2003), there is only one publication to our knowledge that address specifically the problem of culture-negative milk samples. Real-time PCR-based identification of bacteria in 79 milk samples from bovine clinical mastitis with no growth in conventional culture, identified 43% samples as positive (Taponen et al., 2009).

High-resolution melt analysis

Due to the large and increasing diversity of microorganisms and the prevalence of organisms with poorly defined phenotypic characteristics, conventional methods often fail to fully characterize them, and nowadays laboratories prefer DNA-sequencing for microorganism identification (Zadoks and Watts, 2009). Of the two PCR-based strategies which have been developed for non-culture diagnosis of bacterial pathogens, the first one targets species-specific genes for amplification, and the second uses broad-range PCR amplification of conserved bacterial DNA sequences, such as the 16S rRNA, 23S rRNA, and 16S-23S rRNA inter-space regions (Anthony et al., 2000; Greisen et al., 1994; Gurtler and Stanisich, 1996). However, speciation based on sequencing following regular PCR is relatively costly and often requires days to get results when being outsourced. Broad range PCR generates pertinent information that complements results of time-consuming and subjective phenotypic tests for detecting bacterial infections (Millar and Moore, 2002). In clinical applications, real-time PCR for broad-range amplification of bacterial DNA offers additional benefits including minimal labor, rapid turnaround time, and a decreased risk of PCR carryover contamination as there is no need to separately analyze PCR products in the laboratory. Probe-based assays and DNA sequencing of highly variable regions within the universal PCR amplicon have been used for phylogenetic analysis which in most cases leads to species-level identification, but they are generally time-consuming and relatively expensive (Clarridge, 2004; McCabe et al., 1999). Recently, a high-resolution melt analysis (HRMA) incorporating the fluorescent dye EvaGreen has been used for detecting heterozygous and homozygous sequence variants for genotyping and variation scanning (Castellanos et al., 2010a, 2010b; Liew et al., 2004; Reed and Wittwer, 2004 ). This approach is a closed-tube technique that does not require fluorescently labeled probes or separation steps (Wittwer et al., 2003). Compared to traditional melt-curve analysis, high-resolution melt reliably detects single-base differences in homozygous and heterozygous sequences (Zhou et al., 2005). Yang et al. (2009) reported highly specific species identification of 100 clinically relevant biothreat bacterial agents using unique melt profiles generated from multiple hypervariable regions of the ubiquitous 16S rRNA gene. Cheng et al. (2004) combined the use of broad-range real-time PCR and high resolution melt analysis for rapid detection and identification of clinically important bacteria. From these studies it was concluded that the HRM can be a rapid and inexpensive technique with high sensitivity and specificity.

Hypotheses

Estimation of bacterial load in normal and mastitis (subclinical and clinical culture-positive and negative) milk samples will provide insight into the extent of involvement of bacterial species in the pathogenesis of mastitis.

b) Real-time PCR coupled with HRMA can speciate common mastitis pathogens including CNS. It can also be used as a technique to identify multiple strains within species.

Objectives

To estimate the bacterial load in healthy, subclinical and clinical culture-positive and negative mastitis milk samples using16S rDNA quantitative real-time PCR ;

2. To develop a real-time PCR and HRMA based on 16S DNA or other housekeeping gene sequences to discriminate common mastitis pathogens including CNS. The feasibility of using HRMA in subclinical, clinical and culture-negative mastitis milk samples would also be evaluated;

3. To evaluate the influence of possible strain specific sequence differences on the performance of HRMA.

4. To identify the bacterial pathogens involved in culture-negative mastitis using species-specific primers

Duration of study

The study started in the fall of 2009 and will end by 2013 winter.

Methodology

Milk sampling

A total of 150 samples comprising 30 samples each of healthy, subclinical culture-positive and negative and clinical culture-positive and negative mastitis samples will be included in the study. The criteria of sampling will be as follows:

a) Healthy

SCC<200,000/ml of milk

No growth on culturing

b) culture-positive subclinical (SCC>200,000/ml of milk, Growth on culturing, no gross change in milk) and clinical (growth in culturing and gross change in milk)

c) culture-negative subclinical (SCC>200,000/ml of milk, no growth on culturing, no clinical mastitis symptoms) and clinical (no growth in culturing but symptoms of clinical mastitis). @@Praseeda, clinical mastitis not necessarily implicates changes in appearance of the milk. The cow can have an inflamed udder without visible change in the appearance of the milk

Bacterial strains and isolates

The bacterial isolates employed in this study comprised of seven reference strains obtained from the American Type Culture Collection (ATCC), 14 directly obtained from the Canadian Bovine Mastitis Research Network (CBMRN) mastitis pathogen collection (Reyher et al., 2010) and 5 isolated from milk samples originating from organic farms in Alberta or obtained through the CBMRN (Table 1). The isolates obtained by culturing were subjected to further characterization and identification by morphological and biochemical reactions described by Barrow and Feltham (1993) and genotypically confirmed by sequencing of PCR amplicons based on the sequences of the16S rRNA gene (DNA core laboratory, University of Calgary). We also included the 14 most frequently encountered mastitic staphylococcal spp. (Sampimon et al., 2009) obtained from CBMRN, which were identified as coagulase-negative by rpoB gene sequencing at Faculty of Veterinary Medicine, Missouri.

4.1. Extraction of bacterial genomic DNA

Genomic DNA of bacterial isolates in pure culture was extracted based on the protocol for gram positive and gram negative bacteria using the kit from Qiagen (DNeasy Blood and Tissue Kit, Qiagen, Mississauga, Ontario, Canada). Isolation of bacterial DNA from milk was done with the same protocol with some modifications including bead beating for 2 min and boiling for 10 min before subjecting the samples to spin columns. In the case of milk, the starting quantity will be 500µl. The samples will then be measured with a spectrophotometer (Nanophotometer, Montreal Biotech Inc.) to ensure presence of sufficient quantity and quality of DNA.

4.2. Amplification of target gene using Real-time PCR

Real-time PCR amplification of the 16S rRNA gene was performed using the primer pairs designed for the V5-V6 region of the gene for common mastitis pathogens and V1-V2 region for CNS. In case of CNS, as an alternate method, rpoB, hsp60 or tuf gene can also be used for species differentiation. Bacterial genomic DNA(2µl) at a concentration of 10ng/µl from each isolate and milk samples was added to reaction mixture containing 0.25 µM of each primer, 10µl of SsoFast™ EvaGreen supermix (Bio-Rad, Canada) and ultrapure DNAse and RNAse free distilled water (Invitrogen, NY, USA) made up to 20µl. Each isolate was tested in triplicate to determine the differences in their melting curves.

4.3. Quantification of bacterial DNA

Staphylococcus aureus (ATCC 33862) will be cultured on Todd Hewitt broth at 37°C overnight. Serial 10-fold dilutions of S. aureus will be made with sterile PBS and viable cell counts (CFU) determined by plating 0.1ml onto Tryptic soy agar in duplicate. DNA will be extracted from the dilution with109 CFU/ml.

Real-time PCR amplification of the 16S rRNA gene fragment will be performed with the BioRad CFX thermal cycler using the primer pairs, p775 (5'-AAGCGTGGGGAGGCRAACAG-3') and p1126 (5'-AGGGTTGCGCTCGTTGCG-3') with a resulting amplicon of 352bp. A uniprobe, (5'-CACGAGCTGACGACARCCATGCA -3') labelled with HEX at 5' end and BHQ-1 at 3'end and has the sequence which is the reverse complement of nucleotides 1063 to 1085 of the 16S rRNA gene (Yang et.al., 2002) recognizes the specific target sequence in the inter-primer segment.

Serial 10-fold dilution of the S. aureus DNA (100 to 10−6) will be prepared in deionized ultrapure water and 2μL of the dilutions will be used in 3 replicates for each PCR reaction. The results obtained for the dilutions, corresponding to 106,105, 104, 103, 102 ,101 and 100 copies of the target sequences per PCR reaction, will be used to make standard curves for further quantification of bacterial target. The Ct values obtained will be plotted on the respective standard curves to convert the Ct values to copies of target sequence per PCR reaction and finally depending on the volume of milk used for DNA extraction, the number of bacterial genome copies per 1 ml of milk can be determined. The occurrence of duplication of 16S rDNA in some bacterial organism is expected to only influence the results within the error margins of the technique.

4.4. Speciation of pathogens from mastitis milk samples using Real-time PCR and HRMA

Real-time PCR was performed with the Bio-Rad CFX96 thermal cycler. The melting step ranged from 70 to 95°C with 0.2°C increment for every 10 sec hold. HRM analysis will be carried out on triplicate samples with the CFX96 Bio-Rad Precision Melt Analysis program (Bio-Rad, Canada). Melt analysis of the samples will be subjected to fluorescence normalization and temperature shift.

4.5. Validation of HRM assays

Milk samples will be obtained and cultured through an already funded project that compares incidence and prevalence of disease between organic and conventional Canadian dairy herds (H.W. Barkema, PI). Results of the bacteriological culturing of milk samples followed by species-specific PCR will be used for validation of HRMA and 20 samples will be used per bacterial species. Therefore, to validate the test for the 10 most frequently found major mastitis pathogens and 13 CNS species, 460 milk samples will be subjected to the qPCR HRM assay.

As a pilot study, HRMA was tried on DNA extracts of 10 mastitis samples which were positive by bacteriological culturing for S. aureus, out of which only 3 samples clustered well with positive control of S. aureus. Only 3 out of the 10 samples tested had a single melting peak corresponding to S. aureus. The primers amplifying the V5-V6 region of the 16SrRNA gene resulting in an amplicon of 290 bp were used. To test for the limit to which HRMA can be used for milk samples, the PCR products will be cloned into the TOPO TA cloning vector (Invitrogen) according to the manufacturer's recommendations; this vector self-ligates PCR-amplified DNA into itself using topoisomerase technology. The ligated vector will then be transformed into chemically-competent TOP 10 cells and plated onto Luria-Bertani (LB) agar containing 100µg/mL ampicillin at 37°C overnight. Colonies will be picked, three of them from each PCR product and whole cell PCR reactions done to check the correct orientation of the inserts in the vector. Positive clones with inserts in the correct orientation will be grown overnight in 5ml LB broth cultures containing 100µg/mL ampicillin at 37°C with shaking. Plasmids will be harvested using the GenElute Plasmid miniprep kit (Sigma), following the manufacturer recommendations and will be eluted in water and stored at -20°C. Following purification, sequencing will be done using the sequencing primer provided with the cloning kit to verify the sequence and orientation of each insert. Sequencing will be performed by the University of Calgary Genetic Analysis Laboratory on an Applied Biosystems 3730x196 capillary genetic analyzer. Based on the results obtained from sequencing, the performance level of HRMA will be assessed. Presence of more than one bacterial DNA in the mastitis samples that didn't cluster well with S. aureus control in the HRMA, would explain why HRMA didn't work well with these samples.

4.6. Multiple strains within species

Twenty isolates each of S. aureus, E. coli, K. pneumoniae and S. uberis from mastitis milk samples will be subjected to DNA extraction and PCR and HRMA based on 16S rDNA or other housekeeping gene sequences. First, 16S rRNA gene would be the targeted for identifying the strain differences and later on other housekeeping genes like rpoB or cpn60 would also be tried. Since HRMA identifies the SNPs in the particular region of the gene amplified, the performance level of this technique in identifying the strain differences will be evaluated.

4.7. Culture-negative clinical mastitis milk samples

A minimum of 200 culture-negative clinical mastitis milk samples from the organic and conventional dairy herds will be used for the study. The number of samples can increase based on the results obtained with reference to the different bacteria involved. The predominant bacteria might mask the less frequently occurring ones, and hence we may have to do many more samples to confirm the presence of the latter. So far, I have obtained 28 such samples and DNA extracted and stored at -20°C.

Using real-time PCR assays, the presence of DNA of E. coli (Chui et. al., 2010), S. aureus, S. uberis (Gillespie and Oliver, 2005), and Mycoplasma bovis (Sachse et. al., 2009), will be determined using species-specific primers and probes as in the following table. The primers for E. coli target the stx2 gene, S. aureus, targeting a specific genomic marker, S. uberis, the plasminogen activator gene, and M. bovis, the oppD gene. Additionally, the Pathoproof Mastitis Assay kit (Finnzymes, Finland) would also be tried for identification of other pathogens involved in culture-negative mastitis.

Name

Sequence (5'-3')

Product

Size (bp)

Fluorescent dye, Reporter/Quencher

E. coli

forward

reverse

probe

CCGGAATGCAAATCAGTC

CAGTGACAAAACGCAGAACT ACTGAACTCCATTAACGCCAGATATGA

113

5'VIC/3'TAMRA

S. aureus forward

reverse

probe

TCAACGATATTCTTCACGACTAA

CCAGCTTCGGTACTACTAAAG

TCAAGACGGCTTTTACATACAGAACACA

160

5′FAM/3′BHQ2

S. uberis

forward

reverse

probe

AGAGGAATTCATCATGTTTTAACA

AATTGTAGAAGAACCATTTGATGT

AGCGTCTAACAACTCGGCCTTTG

93

5′CY5/3′BHQ2

M. bovis

forward

reverse

probe

TCAAGGAACCCCACCAGAT

AGGCAAAGTCATTTCTAGGTGCAA

TGGCAAACTTACCTATCGGTGACCCT

71

5'FAM/3'TAMRA

5'FAM/3'TAMRA= 6-Carboxyfluorescein/ Tetramethyl-6-Carboxyrhodamine

5′FAM/3′BHQ2 = 6-Carboxyfluorescein / Black Hole Quencher 2.

5′CY5/3′BHQ2 = Cyanine5/Black Hole Quencher 2.

5. Statistical Analysis

Data will be statistically analyzed using the computer program Stata (Intercooled Stata 10, College Station, TX, USA). Statistical significance will be determined by one-way ANOVA, followed by pair-wise multiple comparisons (Bonferroni's method) in estimating the bacterial load in various types of mastitis. Differences of P≤ 0.05 will be considered statistically significant.

6. Significance to the Dairy Industry

This study will provide insight into the bacterial load in various types of mastitis milk samples. HRM provides rapid analysis (10-20 minutes after PCR) without further reagent additions or separations. It offers low cost analysis compared with many other alternatives. The usefulness of high-resolution melt analysis for speciation of common mastitis pathogens including CNS will be evaluated. Even though CNS as a group are still regarded as minor pathogens mainly causing transient infections, their harmless nature has recently been disputed. Since the most commonly recovered pathogens from the milk of fresh heifers are CNS, this project will enhance our knowledge on pathogenic or protective nature of the CNS. Knowing more about the pathogens in culture-negative mastitis milk samples is important for the dairy farmers, veterinarians and extension specialists, as it provides a solid explanation to the occurrence of mastitis even though the milk sample is culture-negative. Providing information on the pathogens involved in culture-negative mastitis will motivate the farmers to submit such milk samples for identification of the etiological agents.

PROCESS FLOW

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.