Molecular Biology And Medicine Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

DNA sequencing technique in which target DNA is denatured and annealed to an oligonucleotide primer, which is then extended by DNA polymerase using a blend of deoxynucleotide triphosphates (normal dNTPs) and chain-terminating dideoxynucleotide triphosphates (ddNTPs). ddNTPs lack the 3' OH group to which the next dNTP of the growing DNA chain is added. Devoid of the 3' OH, no more nucleotides can be added, and DNA polymerase falls off. The resulting newly synthesized DNA chains will be a blend of lengths, depending on how long the chain was when a ddNTP was arbitrarily incorporated. (Brown, T.A.1994)

Manual DNA sequencing:

• First, anneal the primer to the DNA template (have to be one stranded):

5' -GAATGTCCTTTCTCTAAG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

• Then split the sample into four aliquots including the following nucleotides:

"G" tube: All four dNTPs, one of which is radiolabeled, plus ddGTP (low concentration) (Lisziewicz, J., A. Godany, D.V. Agoston and H. Kuntzel. (1988))

"A" tube: All four dNTPs, one of which is radiolabeled, plus ddATP

"T" tube: All four dNTPs, one of which is radiolabeled, plus ddTTP

"C" tube: All four dNTPs, one of which is radiolabeled, plus ddCTP

• When a DNA polymerase (e.g. Klenow part) is added to the tubes, the synthetic response continues until, by chance, a dideoxynucleotide is incorporated instead of a deoxynucleotide. This is a "chain termination" occasion, since there is a 3' H instead of a 3' OH group. Since the synthesized DNA is labelled (classically by means of 35S-dATP), the goods can be detected and distinguished as of the template; (Mytelka, D.S. and M.J. Chamberlin. (1996))

Note that the higher the concentration of the ddNTP in the response, the shorter the goods will be, hence, you will get sequence CLOSER to your primer. By means of lower concentrations of ddNTP, chain termination will be less likely, and you will get longer goods (sequence further AWAY as of the primer).

If, for example, we were to look only at the "G" response, there would be a blend of the following goods of synthesis:

5'-GAATGTCCTTTCTCTAAGTCCTAAG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

5'-GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

5'-GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

5'-GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

5'-GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

5'-GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGGTACTTCTAG

3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'

Each newly synthesized strand at some point had a ddGTP incorporated instead of dGTP. Chain termination then occurred (no more polymerization). Because ddGTP incorporation is random, all possible lengths of DNA that end in G are produced.

These goods are denatured into one stranded DNA molecules and run on a polyacrylamide/urea gel. (Polyacrylamide gels, unlike agarose, allow resolution of DNA molecules that differ in size by only one nucleotide.) The gel is dried onto chromatography paper and exposed to X-ray film. Since the template strand is not radioactively labelled, it does not generate a band on the X-ray film. Only the labelled top strands generate bands, which would look like this: (Perkin-Elmer.(1995))

As you can see as of this one response (the "G" response) the chain termination events produce individual bands on a gel. The chain terminations closest to the primer generate the smallest DNA molecules (which travel further down the gel), and chain terminations more as of the primer generate larger DNA molecules (which are slower on the gel and therefore remain nearer to the top).

When similar chain termination responses are run for each nucleotide, the four responses can be run subsequently to each other, plus the sequence of the DNA can be read off of the "ladder" of bands, 5' to 3' sequence being read as of bottom to top: (Steffens, D.L. and R. Roy. (1998))

The resolution of the gel electrophoresis is very important in DNA sequencing. Molecules that are 50, 100, or 200 bases in length have to be separable as of molecules that are 51, 101, or 201 bases in length (respectively). To accomplish this: (Taub, E. (1996))

• Polyacrylamide, not agarose, is used

• The gels have to be quite large so that the molecules migrate further and are better resolved. (Taub, E. (1996))

• Samples are denatured before they are loaded, and the gels have to contain a high concentration of urea (7 to 8 molar) to prevent folding of the molecules and formation of secondary structures by hydrogen bonding that would alter the mobility of the molecule. (Taub, E. (1996))

• The gels are run at higher temperature (about 50 C), also to prevent H bond formation.

Series on gel at left:

{TG}TACAACTTTTACTATGGCGTGACACCTAAATTATAGGCAGAAA…

Automated DNA sequencing:

Dye termination sequencing

Most DNA sequencing is now automated. The Sanger technique chain termination responses are still used, but pouring, running, & reading polyacrylamide gels has been replaced by automated techniques. Instead of labelling the goods of all 4 sequencing responses the similar (by means of a radioactive deoxynucleotide), each dideoxynucleotide is labelled by means of a different fluorescent marker. When excited by means of a laser, the 4 dissimilar types of goods are detected plus the fluorescence intensity translated into a data "peak". (Szasz, G. Hu et al. (1997))

Thus all four chain termination responses can be performed in the similar tube, as well as run on a one lane on a gel. A machine scans the lane by means of a laser. The wavelength of fluorescence as of the label conjugated to the ddNTPs can be interpreted by the machine as a sign of which response (ddG, ddA, DDT, or ddC) a exacting DNA band came as of. (Williams, R.S., R.V. Shohet and B. Stillman.(1997))

Limited Clinical Data:

Limited clinical data is always not a complete source and as in this scenario where I have got limited data only, I think it is probable that the virus identified could be responsible for this outbreak as I would not like to take any chances and will prefer to be on safe side monitoring the out break and will not dismiss the role of the identified virus as there might be a fine involvement of this virus (haemorrhagic fever) in the out break? Yes it does occur in South America. And might spread in the surrounding countries and regions if the tests are not completed and it is not accurately diagnosed on time by means of suitable medication introduction.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.