Molecular Application To Screen Hiv Biology Essay


Malaysia HIV-1 epidemic shows the tremendous increment in HIV cases since its first notified cases in 1986. 26 years after the outbreak, as of December 2011 the Ministry of Health estimated at 81,000 people are living with HIV-1 in Malaysia; the epidemic is concentrated within the most-at-risk populations especially among Injecting Drug Users (IDU), Sex workers, transgender, and men who have sex with men (MSM). In the early year of Malaysia epidemic, nearly 90% of infection individuals were aggravated among male and IDU's population with the ratio of 1:99 in 1990. However the patterns were dramatically spread among female population into nearly 1 female for every 4 male whom living with HIV.

The emergence of various HIV-1 circulating recombinant forms (CRF) and other subtypes, exhibit the remarkable genetic diversity determined by their rapid mutation (Malim MH et al 2001), recombination factors and their antiretroviral resistances on most of conventional drug therapy. The breakthroughs of HIV-1 diversity at times, prove the on-going transmission, and claim the viral sovereignty within human population. Since then, global population had faced severe downturn due to the failure of existed drug to overcome the viral infection. In 1997, the introduction of protease inhibitors cocktails with other antiretroviral which later named as Highly Active Anti-retroviral therapy (HAART), providing a new hope for people-Living with HIV (PLHIV) by placing the HIV into chronic but treatable condition.(

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

The recombination substantially contributes to the overall genetic diversity of HIV-1 and multiple genotypes rapidly co-circulated, facilitate the diverse generation of HIV-1 forms Wang W. et al (2011). The aim of this study is to screen for potential new circulating recombinants forms (CRF) among HIV-1 seropositive individuals of Kajang Prison, and to rule out the molecular epidemiology patterns of HIV-1 among prisoner in Malaysia.


Study subjects and specimens

All subjects (n=8) were HIV-1 seropositive prisoners of HARAPAN from Kajang Prison, Malaysia in August 2010. All study participants were all male and their samples were named with the unique identification numbers according to HARAPAN sample collection datasheet. Such samples were PR162, PR216, PR217, PR219, PR220, PR226, PR229, and PR230. Since the samples collected from prison, details pertaining participants demographic background and clinical information were unable to be retrieved as per discussed by Li et al (2010). This study was approved by University Malaya Medical Centre (UMMC) Medical Ethics Committee. The specimens from 8 patients were serologically determined as HIV-1 positive and there were no HIV-2 infections detected. HIV-1 genotypes were screened based on Protease and Reverse Transcriptase region using frozen plasma HIV-1 RNA as described by Tee et al (2005).

HIV-1 genotypic determination, isolation of viral region, and nucleotides sequencing.

HIV-1 RNA was extracted from frozen plasma using magnetic beads and Nuclisens biomerieux (USA) automated extraction device. The RNA was reverse transcript into complementary DNA (cDNA) by reverse transcription Polymerase Chain reaction (RT PCR) using random hexamer (GeneAmp®RNA PCR, USA) primer and synthesized by Superscript III enzyme (Invitrogen, Carlsbad, CA). The HIV-1 cDNA were subjected to a nested PCR on the basis of Pol (Protease-RT) region according to HXB2 reference Strain (nucleotides). The nested PCR was performed according to QIAGEN hOTsTARTtAQ® Plus DNA Polymerase (QIAGEN HotStartTaq kit, QIAGEN, Germany) with initial denaturation temperature at 95°C for 5 minutes, and 35 cycles of denaturation at 94°C for 30 seconds, annealing at 50°C for 1 minutes, elongation at 72°C for 1 minutes and 45 seconds, and final elongation at 72°C for 10 minutes. 2 µL of cDNA was aliquoted for the first PCR and 5µL of first PCR product was aliquoted for subsequent nested PCR. For pol region, primers (P24A: AAG GAA CCC TTT AGA GAC TAT GTA GA, HXB2:1657 à 1682) (P24B: TATGGATTTTCAGGCAATTTTTG, HXB2: 2692 ß 2716) and nested with primers (P24C: GTAAAAAATTGGATACAGAAACCTTG, HXB2: 1726 à1752) (P24D: ACTTTTGGGCATCCATTCC, HXB2: 2592 ß 2611) were used for protease region while primers (K1: GGAAACCAAAAATGATAGGGGGAATTGGAGG,HXB2:2377à2407) (K2: CTG TAC TTC TGC TAC TAA GTC TTT TGATGGG, HXB2: 3509 ß 3539) and nested with primers (K3: GTGGAAAAAAGGCTATAGGTACAG, HXB2: 2452 à 2475) (K4: CTG CCA ACT CTA ATTCTGCTTC, HXB2: 3441 à 3462) were used for RT region in nested PCR modified cycling condition based on Tee et al (2006). The amplicons of targeted region were detected using 1.2% agarose gel electrophoresis base on GeneRuler DNA ladder 1kb (Fermentas, GeneRulerTM, ThermoFisher Scientific.Inc).

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Phylogenetic Analysis

The Nucleotides sequences of partial HIV-1 genomes (HXB2 gag-pol region: 1753 à 3439) were aligned with the HIV-1 references subtypes and CRF's obtained from Los Alamos HIV Database (, using the ClustalX 2.0.11. The sequences were further adjusted manually based on codon position of HIV sequence Compendium 2011. Phylogenetic trees were constructed using neighbour-joining method Saitou N et al (1987) based on KIMURA-2 parameter model with transition -to-transversion ratio of 2.0, pair wise deletion and 1000 bootstrap replications for statistical support. The analysis was executed in Molecular Evolutionary Genetic Analysis (MEGA) version 5.0 software platform.



RT region

PR region

























Table 1

Recombinant identification program (R.I.P)

Patient PR162 -pro region

FIGURE 1: S distance (similarity)

Figure 1 show the S distance similarity of query (PR 162) protease region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 833bp and BLAST shows sample PR162 protease region is similar to isolate 05MYKL031, complete sequence of Malaysia from the HIV database.

PR217 -PR region:

Figure 2: S distance (similarity)

Figure 2 show the S distance similarity of query (PR 217) protease region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 848bp and BLAST shows sample PR217 protease region is similar to isolate 07CNHB_ES52 of gag-pol protein of China from the HIV database.

Sample PR219 -PRRT region

Figure 3: S distance (similarity)

Figure 3 show the S distance similarity of query (PR 219) pro-RT region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 1681bp and BLAST shows sample PR219 pro-RT region is similar to isolate 04MYKL005, complete genome of Malaysia from the HIV database.

PR220 - PRRT region

Figure 4: S distance (similarity)

Figure 4 show the S distance similarity of query (PR 220) pro-RT region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 1682bp and BLAST shows sample PR220 pro-RT region is similar to isolate 96CNKM006, gag-pol fusion poly-protein of China from the HIV database.

PR226 -PRRT region

Figure 5: S distance (similarity)

Figure 5 show the S distance similarity of query (PR 226) pro-RT region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 1673bp and BLAST shows sample PR226 protease region is similar to isolate 04MYKL014, gag-pol protein of Malaysia from the HIV database.

PR230-PRRT region

Figure 6: S distance (similarity)

Figure 6 show the S distance similarity of query (PR 230) pro-RT region in comparison with other HIV-1 subtypes and CRF's for the identification of recombinants. The length of the Query is about 1676bp and BLAST shows sample PR230 protease region is similar to isolate 07IDJKT194-C, proviral DNA nearly complete genome of Jakarta from the HIV database.


Eight samples (PR162, PR216, PR217, PR219, PR220, PR226, PR22, PR226) of frozen plasma from individual previously HIV-1 seropositive tested from Kajang Prison Malaysia, two (PR216 AND PR 229) of them were re-identified as HIV-1 sero-negative (as referred to table 1). The PR 216 was referred as patient who had been under-gone unknown antiretroviral therapy which previously the frozen plasma from the same individual (PR164) was tested for the HIV-1 genotype with negative result. Sample PR 229 was identified as false positive HIV-1 rapid agglutination test and re-confirm as HIV-1 negative individual thus being excluded from the research.

Samples PR219, 220, 230 were amplified based on the nested PCR modified cycling protocol by Tee et al (2006). While PR162 Pro regions, PR217 Pro region, PR226 were amplified after additional of Qiagen Q-solution. The PR217 RT-region was amplified without Q-solution but increase PCR cycling from 35 cycles to 40 cycles. All the positive amplified samples were subjected PCR purification using Qiagen Spin-column technique while sample PR220 RT-region was subjected to Gel purification due to multiple bands amplified and samples were send for sequencing.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

The subtypes B among injecting drug users (IDU) and CRF01_AE among heterosexually most at risk group were the two main strains initiating HIV/AIDS in Southeast Asia region in early year (Liu Y. et al 2012). The co-circulation of such strains has given rise to various new CRF descended from B subtypes and CRF01_AE. According to Los Alamos HIV database ( ) So far, there are 8 CRF's emerged from the chimera of two major circulating subtypes in Southeast Asia such CRF15_01B (Tovanabutra S. et al 2001), CRF33_01B (tee et al 2006), CRF34_01B (Tovanabutra S. et al 2007 ), CRF48_01B (Li Y et al 2010), CRF51_01B (Ng et al 2012), CRF52_01B (Liu Y et al 2012), CRF53_01B (Chow et al 2012), and CRF54_01B (Ng et al 2012).

In this study, most of the screened Protease and RT regions were identified to be closely related to CRF33_01B (PR162 pro region, PR219 PRRT region, PR260 PRRT region, PR230 PRRT region) which had been discuss previously by Tee et al (2006) while sequences sub-region PR217 Pro region and PR220 PRRT region have been identified to be similar with subtypes B. This finding proves that CRF33_01B is indeed the common CRF's circulating among HIV positive individual in in Malaysia. Interestingly, PR162 pro region appear to cluster along with CRF53_01B (sequence 10MYKJ079_53) which recently discussed by Chow et al 2012 and sequence PR217 pro region shows short length of subtype D about 100 base-pairs (figure 2) which might be suspected as potential URF. However, analysis on full length genome is required for further discussion.

Sample troubleshot:

Since the invention of polymerase chain reaction (PCR) by K.Mullis and co-workers in 1983, the technique permit the evolution in scientific study by introducing the rapid multiplication of a single DNA/RNA fragments into millions of copies. It has been a fundamental tool for multidisciplinary aspect of evident based research including detection of Human Immunodeficiency Virus (HIV) in human cells. It led to intense activity in the field of molecular virology which continues relevant until present day. PCR help to amplify three structural genes and six other regulatory genes encoded of HIV structure and help to better understand the replicative pattern of HIV and its' defiant mechanism towards antiretroviral therapy (ART). It is also essential in defining the heterogeneity of HIV diverse population throughout the global (smith et al 1988).

There are ever-increasing needs for further improvements of PCR protocols for cost-effective and high-throughput efficacy of particular analysis at genome or routine diagnostic purposes (Csako G et al 2006, Ding C. et al 2004). One of the major confounding factors limiting the PCR product is that a number of DNA/RNA sequences are poorly or not amplifiable under standard reaction conditions, either because of their intrinsic properties to form secondary structures, and/or because of their high GC content (Ralser M. et al 2006). Various samples required miscellaneous modification in the PCR protocol including stepwise reduction annealing temperature for each cycle (Nagai M. et al, 1998), or modification in DNA polymerase prior 'HotStart' reaction (Kellog D.E et al 1994). Apart from substance enhanced/yield PCR specificity, PCR enhancing additives are necessary such Betaine (Henke W. et al 1997), dimethyl sulfoxide (DMSO) (Chakrabarthu R. et al, 2001) and Dithiothreitol (DTT) (Nagai M. et al 1998). Commercial enhancers have led to better result but overpriced and unknown chemical composition.