Mapping of erecta genes in arabidopsis thaliana

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Arabidopsis thaliana is used as a model organism for analyzing genetic and biochemical process in higher plants. Due to its small genome size (Approximately 100 Mb) and availability, Arabidopsis is used as a model plant for most of the experiments. In this experiment we have analyzed the function and position of ERECTA gene with respect to expression of trait and genotyping. Genotyping was carried out using PCR analysis. The mapping was done for the whole genome of Arabidopsis RIL's using the indel markers. By using the recombinant inbred lines of Ler and Col the phenotype and genotype data were compared manually. Furthermore, the QTL analysis was used to identify the location of ERECTA gene on the chromosome along with the help of markers. From the results it is seen that the ERECTA gene is located at the second chromosome of Arabidopsis thaliana between the markers m220 and m251 (~between 22.6 cM and 37.8 cM). However marker m226 was also found to have minimum control on the expression of the trait (silique and pedicle length).

Key words: Arabidopsis thaliana, ERECTA, QTL, PCR, marker

3. INTRODUCTION

Arabidopsis thaliana is a widely distributed plant which is also used as a model organism in plant science research. Arabidopsis thaliana has more than 700 natural accessions around the world. Among the ecotypes of Arabidopsis Ler and Col are the most common ecotypes which are used for genetic and molecular studies (Anderson and Mulligan, 1992). Among those Ler is isolated from mutagenized seed populations of Arabidopsis (Rédei, 1992) and it lacks ERECTA gene. The ERECTA gene controls many physiological processes during Arabidopsis plant development such as inflorescence, internodes and pedicel elongation and leaf and siliques morphogenesis (Scott J. Douglas, 2002). From the genetic control studies, the stem development with Arabidopsis mutation (erecta) has reduced internode length (Hanzawa et al., 1997) which leads to reduced plant height. These basic morphological characters are used to differentiate the ecotypes. In this experiment our main aim is to identify the position of the ERECTA gene and its linked marker in the genome (five chromosomes) of Arabidopsis. By using the ERECTA mutated ecotype Landsberg erecta and normal ecotype Columbia the Recombinant inbred lines are produced. The phenotyping (morphological character) and genotypic correlation of inbred lines is compared with the molecular markers and the location of the ERECTA is identified. The main application for this type of experiments is to identify the location of genetic factors (quantitative trait loci or QTLs) on the genome using molecular markers and used while making selection and breeding decisions to increase the selection efficiency of the trait.

4. MATERIALS AND METHODS

I. PARENT MATERIAL

The two Arabidopsis ecotypes Landsberg erecta (Ler) and Columbia (Col-0) were used as parents to form Recombinant inbred lines.

II.BREEDING FOR RECOMBINANT INBRED LINES

The initial cross with Ler and Col was done to form F1 generation. After that the F1 went 8 generation of recurrent inbreeding to increase homozygosity. The fig.1 shows the systematic diagram of RIL.

Fig 1. The recombinant inbred line population.

III. DNA EXTRACTION

The different RIL samples were collected for DNA extraction. Collected plant samples were grinded in eppendorf tube by placing them in liquid nitrogen. 500 µl of extraction buffer was added and incubated at 650 c for 20 minutes. The extraction buffer contains 100 mM Tris (=Trizma base); M=121.14 gïƒ-mol-1, 1.4 M NaCl; M=58.442 gïƒ-mol-1, 20 mM EDTA (C10H16N2O8, M=292.24 or C10H14O8N2Na2·2H2O 372.24 gïƒ-mol-1), 2% v/v CTAB (N-Cetyl-N,N,N- trimethylammoniumbromide, M=364.46 gïƒ-mol-1). Then 500 µl of phenol- chloroform-isoamyl alcohol was added in the ratio of 25:24:1 and centrifuged at 13000 rpm for 5 minutes. The supernatant was transferred to another tube. Equal volume of chloroform- isoamyl alcohol was added in the ratio of 24:1 and centrifuged at 13000 rpm for 5 minutes. 300 µl of supernatant was transferred to a new tube. 30 µl of sodium acetate and 750 µl of 100% ethanol were added. The tubes were placed at -200 c for 10 minutes and centrifuged at 13000 rpm for 15 minutes. The ethanol was decanted. To the sample 175 µl of 70% ethanol was added and centrifuged at 13000 rpm for 5 minutes. The excess ethanol was removed using speed vacuum. The pellet was re-suspended in 50 µl of water. The concentration and purity of the DNA sample was measured on a Nanodrop.

IV. GENOTYPING

The genotyping of Ler, Col and their recombinant inbred lines (00, 03, 11, 15, 21, 27 and 51) were analyzed by using the known insertion or deletion markers. The markers and the primers with their base pair expression are given in table 1.

Marker

Forward primer

Reverse primer

Col-0 (bp)

Ler (bp)

m213

GCACCTCATGAAACCGATGCAAGT

ATCTTTGTTTGTGGTGGCAGAGCC

222

176

m251

GCGCACCTCTGTACAGTCTCT

CCTCTGGGTCAAACGAAGAA

477

445

ERECTA

ATCCCCAGCACGAATGTTTA

GGCAAACCAAAGAAAACCAA

1035

413

m220

TTGCGTCATGTGGTGACTCT

CGAGATTGAATGGTGATCCA

513

468

m457

GACCGGTCTTACATGACCAA

AACGGGTGACTTCTGGTTTG

616

533

m600

CTCGCAGTGGTGATGAAGAA

GCAGCTTGGTTCTGTGATGA

502

387

m555

AAAAGCAGAGAAGCAAAACACA

AGTTGGTGAAAGAGCGGCTA

537

310

Table1. The Markers and primers used for genotyping.

V. PCR ANALYSIS

The 12x concentration of buffer, water, dNTP, polymerase and primers (Table 2.1) were added to a PCR tubes along with the DNA of different genotypes. The tubes were mixed well (without air bubbles) and placed in ice. Water is used as a negative control. The PCR program was set as shown in table 2.2. The tubes were placed in PCR machine and allowed to run for 35 cycles.

NEB Taq DNA Polymerase

1x

12x

10x ThermoPol buffer

2.5 µl

30 µl

dNTP (10mM)

0.5 µl

6 µl

Taq polymerase (5U/µl)

0.2 µl

2.4 µl

Primer 1 (10µM)

0.6 µl

7.2 µl

Primer 2 (10µM)

0.6 µl

7.2 µl

DNA template

0.5 µl

H2O

20.1 µl

241 µl

96 °C

5 min

 

94 °C

30 sec

 

60 °C

30 sec

35 cycles

72 °C

1.5 min

 

72 °C

10 min

 

4 °C

hold

Table 2.1 The reagents for PCR Table 2.2, PCR program

VI. AGAROSE GEL ELETROPHORESIS

5 µl of loading dye was added with the products obtained from PCR. The samples were then loaded into agarose gel. DNA ladders were added to the first and last lanes of the gel. The gel was run at 100 V for 1-2 hrs.

VII. PHENOTYPING

From the grown RIL and ecotypes of Arabidopsis the phenotyping was done. The morphological characters such as short plant, silique width, compact inflorescence and short silique length, pedicle length and petiole length contained plants were considered as landsberg erecta. For the Columbia ecotype tall plant, long silique length, pedicle length, petiole length, thin siliques width and with disperse inflorescence considered as phenotypic characters. The phenotypic data was compared with genotypic data obtained from the electrophoresis. Then the phenotypic data was compared with standard marker data and scoring was done.

VIII. QTL ANALYSIS

The widely-used methods for detecting QTLs such as single-marker analysis, simple interval mapping (Liu, 1998) were used to find, whether the marker is linked to a QTL and the position of the QTL on the map.

5. RESULTS

I. GENOTYPIC RESULTS

The DNA of ecotypes and RIL were analyzed by using the insertion and deletion markers with the help of electrophoresis (Fig .2) and the data obtained was given in table 3. Based on the size of the DNA the ecotypes were differentiated as shown in fig 2. For DNA size refer table 1. For many of the markers there was no DNA band observed for the Parents and RIL's.

Fig 2. The gel picture of Arabidopsis ecotypes and their RIL's according to the marker.

From the table (Table 3) it's clear that some of the markers such as m600, m555 and 457 were more different from the phenotype. Some of the other markers like m220, m213 and ERECTA don't have clear genotypic results to compare with phenotype. However the marker m457 results have closely related to the phenotypic result. So there may be contamination or practical errors be occurred during the DNA analysis.

Marker

Col-0

Ler

RIL 00

RIL 03

RIL 11

RIL 15

RIL 21

RIL 27

RIL 51

H2O

m213

-

Ler

-

Col

-

-

-

-

Ler

-

m251

Col

Ler

Ler

Col

Col

Col

Ler

Ler

Col

-

ERECTA

-

Ler

Ler

-

-

Ler

-

-

Ler

-

m220

Col

-

-

-

Col

-

-

-

-

-

m457

Col

Ler

Col

Col

-

-

Col

-

-

-

m600

Col

Ler

-

Col

Ler

Ler

-

-

Ler

-

m555

Col

Ler

Ler

Ler

Ler

Col

Col

Ler

Col

-

Phenotype

Col

Ler

Ler

Col

Col

Ler

Ler

Ler

Ler

-

Table3. The result form agarose gel electrophoresis and phenotyping.

II. RILPHENOTYPE DATA

The morphological characters such as type of inflorescence (compact or dispersed), plant height, silique length, silique width, pedicle length and petiole length was analyzed from the recombinant inbred lines of Ler and Col (Table 4). As it was said earlier (methods), based on the morphological characters, the ecotypes were differentiated and noted down. Form the result it was observed that most of the RIL's expressed Ler phenotype.

RIL's

Heigth

Inflo.

Silique length

Siliques width

Pedicle length

Leaf_shape

Col/Ler

CS/N1900

22

1

14

1

6

0

ler

CS/N1901

20

0

16

0

12

1

col

CS/N1903

23

0

18

0

13

0

col

CS/N1905

27.5

0

20

0

11

1

col

CS/N1910

18.5

1

12

1

3

0

ler

CS/N1911

32.5

0

14

0

10

1

col

CS/N1913

8.5

1

6

1

6

0

ler

CS/N1915

18.5

1

15

0

6

1

ler

CS/N1919

35

0

18

0

12

1

col

CS/N1921

13.5

1

9

1

4

0

ler

CS/N1923

20

1

10

1

6

0

ler

CS/N1924

32.5

0

17

0

11

1

col

CS/N1927

16

1

10

1

9

0

ler

CS/N1929

28

0

16

0

13

1

col

CS/N1933

9

1

6

1

3

0

ler

CS/N1934

20

1

10

1

6

1

ler

CS/N1935

20

1

11

1

5

0

ler

CS/N1937

23

1

9

1

5

0

ler

CS/N1938

24.5

1

15

0

4

0

ler

CS/N1942

23.5

1

10

1

4

0

ler

CS/N1945

34

0

16

0

11

1

col

CS/N1946

22.5

0

15

0

10

1

col

CS/N1948

30

0

15

0

11

1

col

CS/N1951

5

1

5

1

2

0

ler

CS/N1953

25

0

16

0

10

1

col

CS/N1954

35

0

18

0

13

1

col

CS/N1957

15

1

11

1

5

0

ler

CS/N1958

17

1

10

1

8

0

ler

CS/N1959

18.5

1

14

1

5

0

ler

CS/N1960

18.5

1

12

1

6

0

ler

CS/N1963

21

1

11

1

8

0

ler

CS/N1966

7

1

10

1

8

0

ler

CS/N1969

12

1

10

1

3

0

ler

CS/N1971

38.5

0

16

0

8

1

col

CS/N1974

25.5

1

11

1

3

0

ler

CS/N1975

11.5

1

8

1

6

0

ler

CS/N1978

36.5

0

19

0

13

1

col

CS/N1980

16.5

1

9

1

6

0

ler

CS/N1984

12.5

1

7

1

8

0

ler

CS/N1985

12

1

12

1

4

0

ler

CS/N1988

13

1

4

1

6

0

ler

CS/N1989

34

0

17

0

14

1

col

CS/N1990

23.5

1

14

1

3

1

ler

Table4. The morphological characters of RIL of Ler and Col. In inflorescence 1 denote compact inflorescence and 0 denote disperse inflorescence. For leaf shape 0 and 1 indicates presence and obscene respectively. Like that, Silique length was also denoted by 0 and 1.

The genotype of the markers was scored with the help of phenotypic data (Table 5). In the table the phenotype observed was compared with the genotype data, by highlighting the similarity between phenotype and genotype. Form the table5 marker m220 had highest value of 37 followed by m251with 36 and m216 & m326 respectively with 29.

Table5. The data of scored marker with observed phenotypic data of RIL's. Highlighting indicates genotype and phenotype were matching.

III. QTL ANALYSIS DATA

The QTL results based on single marker analysis and interval mapping are shown in Fig.3.1, 3.2, 3.3, 3.4. The QTL analysis for height, silique and pedicle length indicated that (Fig.3.1, 3.2 & 3.3) marker m220 had peak above the threshold level. For silique length and pedicle length the QTL showed (Fig 3.2 & 3.3) two peaks (high and low) above the threshold level for the markers m220 and m226 respectively.

Fig. 3) 3.1.The QTL of plant height with peak on m220 (indicated by arrow, 3.2 & 3.3, QTL of silique length and petiole length with two peaks above threshold level on m220 and m226 and 3.4, the marker map of Arabidopsis showing the place of ERECTA gene.

6. DISCUSSION

The genotype result gave an idea to eliminate the marker which was not closely related to phenotype such as m600, m555 and 457. But, the genotype result did not given clear conclusion about the marker that closely related to ERECTA gene. The genotype data of m220, m213, m457 and ERECTA did not express DNA band for most of the RILs (Fig. 2). However, the score obtained from the comparison of phenotype with standard genotypic data provide some evidence of the location of ERECTA gene when compared with molecular map of Arabidopsis thaliana. It showed that m220, m251, m216 and m226 were closely related to the ERECTA gene. Still we cannot say clearly that ERECTA is located somewhere between m220, m251, m216 and m226 because the marker m226 and m326 were located at third chromosome of Arabidopsis thaliana. Additionally, the markers m326 and m226 showed some effects on silique and pedicle length which were observed in both QTL analyses and RILs scoring. So it can be said that these genes also have a little effect on controlling the expression of silique and pedicle length of Arabidopsis thaliana. By using QTL analysis the finest details about location of ERECTA gene was obtained. From the QTL data it was clearly shown that the ERECTA gene is located between m251 and m220 (Fig. 3.4).

7. AKNOWLEDGEMENT

We thank Tom martin, Jonas Ross and Luisa Ghelardini for providing technical support and assessment during the experiment.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.