Maintain Proline Level In Chickpea Biology Essay



Pseudomonas aeruginosa strain OSG41, isolated from the heavy metal contaminated water irrigated rhizospheric soil of mustard crop, tolerated chromium up to the concentration of 1800 µgml-1 and reduced it by 100% at pH 6-8 after 120 h incubation at 30 to 40 C. Pseudomonas aeruginosa produced plant growth-promoting substances, both in the presence and absence of chromium; it produced 32 µgml-1 indole acetic acidml-1, in Luria Bertani broth with 100 mg tryptophanml-1, solubilized tri-calcium phosphate (417µgml-1) and secreted 20.8 µgml-1 exopolysachharides (EPS) which decreased with increasing concentration of chromium added to growth medium. While investigating the impact of hexavalent chromium on chickpea, chromium application to soil had a phytotoxic effect. The application of Pseudomonas aeruginosa strain OSG41 even with three times concentration of chromium increased the dry matter accumulation, symbiotic attributes (like nodules formation), seed yield and grain protein of chickpea compared to non-inoculated plants. The bio-inoculant decreased the uptake of chromium by 36, 38 and 40% in roots, shoots and grains, respectively. Interestingly, proline accumulation decreased significantly by 18.7, 17.8 and 24 % in roots, shoots and seed, of inoculated chickpea plants, respectively. The present finding suggests that the bioinoculant effectively reduced the toxicity of hexavalent chromium to chickpea plants and concurrently enhanced the biological and chemical characteristics of chickpea, when grown in chromium treated soils. Based on this trial, it is suggested that Pseudomonas aeruginosa OSG41could be develop as bioinoculant for enhancing the performance of chickpeas even in chromium-contaminated soils which however, requires further field testing.

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Key words: Chromium, toxicity, chickpea, Pseudomonas aeruginosa, proline, PGPR

1. Introduction

Chromium is one of the major environmental pollutants which enter the agro-ecosystem from different sources like, metal finishing, leather tanning, chromate preparation, and cooling tower of nuclear reactor. Of the various forms of chromium, hexavalent chromium (Cr6+) is mutagenic and carcinogenic (Musarrat et al. 2011). After accumulation, the elevated concentration of chromium in soil severely affects the composition and metabolic activities of microbes (Wani et al. 2007; Wani et al. 2008) leading to losses in soil fertility (Pajuelo et al. 2008). As a result of altered soil fertility, the deposited chromium in soil can indirectly (by reducing soil fertility) restrict the growth of plants. On the other hand, the uptake and transport of chromium to various organs of plants, may cause direct adverse impact such as it may (i) alter mineral nutrition (ii) impair photosynthesis and consequently decrease chlorophyll content (Wani et al. 2008; Wani and Khan 2011a) (iii) decrease plant growth and seed yield (Wani and Khan 2011b; Hussain et al. 2006). These and other associated data thus clearly suggests that the toxicity of chromium to variable agro-ecological environments including soil requires an inexpensive and effective strategy to clean up the contaminated sites. In this context, certain physico-chemical approaches like, electrochemical treatment, ion exchange, precipitation, evaporation, reverse osmosis and sedimentation have been used for detoxifying chromium polluted environment (Khan et al. 2009; Das and Mathew 2011). However, due to difficulty in (i) operation at larger scale, (ii) negative impact on the environment and (iii) prohibitive cost of operation, these physicochemical methods (Laxman and More 2002) have not been widely practiced for chromium removal. Considering these factors, focus has been shifted on to find some inexpensive option for removing/reducing chromium toxicity from the contaminated regions. In this regard, the use of bacterial cultures especially the plant growth promoting rhizobacteria (PGPR) has provided an attractive and low cost alternative for biological reduction of Cr6+ from contaminated environment (Congeevaram et al. 2007; Wani and Khan 2010; Khan et al. 2012). Mechanistically, PGPR reduce the metal toxicity by different mechanisms such as biosorption, mobilizing metals through the excretion of organic acids or bioleaching, immobilization or bio-mineralization, intracellular accumulation, and enzyme-catalyzed transformation (Khan et al. 2009; Khan et al. 2012). Apart from metal removal/detoxification, metal-tolerant microbes provide hugely important nutrients to plants (Oves et al. 2010), protect plants from nuisance of phytopathogens by synthesizing antimicrobial compounds, cyanogenic compounds and siderophores and accelerate the availability of phytohormones such as indoleacetic acid (IAA) etc. when applied to seed and soil (Khan and Zaidi, 2007). As a result of these multifaceted activities, PGPR enhance the overall growth, and yield of plants even when grown in soils already contaminated with heavy metals or soils deliberately designed for testing the toxicity of metals or bioremediation potential of microbes.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Compared to the vast and varied inherent functional properties of PGPR, there is little information available on the role of metal tolerant PGPR on the growth and development of legumes especially chickpea when grown intentionally in metal contaminated soils or in soils already polluted with heavy metals like chromium. Considering these applied and extremely important agronomic gaps, the present study was designed to search for a suitable hexavalent chromium reducing PGPR and to determine its proline stress reducing ability and plant growth-promoting activity both in the presence and absence of chromium. The growth promoting potentials of the selected metal tolerant bacterial culture was assessed further in a pot trial experiment using chickpea (Cicer arietinum L.) as a test crop.

2. Materials and methods

2. 1 Heavy metal concentration in soil

The soil samples for total heavy metals were collected from the industrial area of Ghaziabad (S1), Uttar Pradesh, India and conventional (cultivated) fields of Faculty of Agricultural Sciences (S2), Aligarh Muslim University, Aligarh, U.P., India. There was consistent use of industrial sewage water, discharged from Hindan River, at site S1.The heavy metals in soil samples were determined following the method of McGrath and Cunliffe (1985) using flame atomic absorption spectrophotometer (Model GBC 932B Plus atomic absorption spectrophotometer). All chemicals used for heavy metal analysis were of Analytical grade and solutions were prepared in double distilled water.

2. 2 Bacterial strains and evaluation of metal tolerance

The bacterial strain OSG41 was isolated from the rhizosphere of mustard (Brassica compestris) grown at the edge of Hindan River near Ghaziabad. The polluted waste water of Hindan River near Ghaziabad was used to irrigate the mustard field as and when required. For enumerating bacterial cultures, King`s B agar medium was used, and the selected cultures were maintained on this medium until use. Preliminary test to identify bacterial isolates included colony morphology, and cultural and biochemical characteristics using standard methods (Holt et al. 1994). The bacterial strains were tested further to determine resistance/sensitivity against hexavalent chromium (Cr6+) by the chromium amended nutrient agar plate dilution method. Freshly prepared nutrient agar plates treated separately with increasing concentrations (0-2000 µg ml-1) of Cr6+ (used as K2Cr2O7), were spot inoculated with loopful culture of overnight grown bacterial cultures. Plates were incubated at 28±2 °C for 48 h. The highest concentration of Cr6+supporting bacterial growth was defined as the maximum tolerance level (MTL).

2. 3 Strain identification and phylogenetic tree construction

Heavy metal resistant bacteria isolate was characterized both biochemically and molecularly (Table 2). Sequencing of the 16S rDNA of strain OSG41 was done commercially by a DNA sequencing service (Macrogen, Seoul, South Korea) using universal primers, 518 F (5′CCAGCAGCCGCGGTAATACG3′) and 800R (5′ TACCAGGGTATCTAATCC3′). Nucleotide sequence data was deposited in the GenBank sequence database. The online program BLAST was used to find related sequences with known taxonomic information in the databank at the NCBI website ( to accurately identify strain OSG41. Further, the 16S rDNA gene sequence of the selected strains was characterized using universal primer 518F and 800 R. The sequence (1466 bp) so obtained were analyzed using BLAST(n) programme at NCBI server ( to identify and compare the isolate with the nearest neighbour sequence available in the NCBI database. All the sequence were aligned using Clustal W 1.6 program at (http://, BLAST alignment tools used bootstrapped neighbour-joining relationship were estimated with MEGA version 4 (Kumar et al. 2004).

2. 4 Chromium Reduction

The effect of pH on Cr6+ reduction was assessed using nutrient broth (NB) treated with varying concentrations (50, 100, 200 and 400 µg ml-1) of Cr6+and the autoclaved medium was adjusted to pH 4 to 10 with 1M HCL or 1M NaOH. A-100 µl of exponentially grown culture of Pseudomonas aeruginosa OSG41, was inoculated into NB medium containing different concentrations, of hexavalent chromium and incubated upto 120 h. For Cr6+ reduction, one ml culture from each flask was centrifuged (6000 rpm) for 10 min. at 10 ÌŠC, and Cr6+ in the supernatant was determined by the 1,5-diphenyl carbazide method (APHA, 1995; Park et al. 2000).

2. 5 Bioassay of plant growth promoting (PGP) activities under chromium stress

2. 5. 1 Phosphate solubilization and siderophore production

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Various PGP activities such as, P-solubilization, indole acetic acid (IAA), siderophores, and hydrogen cyanide (HCN) of the bacterial strains were assayed both in the presence and absence of the selected chromium salt under in vitro conditions. The phosphate solubilization activity was quantitatively assayed using liquid culture medium containing tri-calcium phosphate (TCP) amended with 0, 50, 100, 200 and 400 µg Cr ml-1. The amount of water-soluble P was estimated by a chlorostannous reduced molybdophosphoric acid blue method (King 1932; Jackson 1967). The productions of siderophores by the Pseudomonas aeruginosa OSG41 strain was detected using the Chrome Azurol S (CAS) method (Alexander and Zuberer 1991) using the four concentrations (50, 100, 200 and 400 µg ml-1) of chromium, added to CAS agar plates. For quantitative estimation of siderophore, the Pseudomonas aeruginosa OSG41 strain was grown in Modi medium (K2HPO4 0.05%; MgSO4 0.04%; NaCl 0.01%; mannitol 1%; glutamine 0.1%; NH4NO3 0.1%) treated with 0, 50, 100, 200 and 400 µgCr ml-1 for 5 days and Catechol-type phenolates was measured (Reeves et al. 1983) . For the assay, one volume of the Hathway's reagent was added to one volume of sample, and absorbance was determined at 560 nm for salicylates with sodium salicylate as a standard and at 700 nm for dihydroxy phenols with 2,3 DHBA as a standard.

2. 5. 2 Bioassay of indoleacetic acid and cynogenic compounds

Indole-3-acetic acid synthesized by Pseudomonas aeruginosa OSG41 strain was quantitatively evaluated by the method of Gordon and Weber (1951), later modified by Brick et al. (1991). For this activity, the Pseudomonas aeruginosa OSG41 strain was grown in Luria Bertani (LB) broth (gl-1: tryptone 10; yeast extract 5; NaCl 10 and pH 7.5). A- 100 ml of LB having a fixed concentration (100 µg ml-1) of tryptophan as a inducer (Glickmann and Dessaux, 1955) and supplemented with 0, 50,100, 200 and 400 µg ml-1 of hexavalent chromium was inoculated with 100 µl culture (108 cells ml-1) of P. aeruginosa OSG41 strain and incubated for 7 days at 28±2 ÌŠC with shaking at 120 rpm. After seven days, a 5 ml culture from each treatment was centrifuged (8000g) for 15 min. and an aliquot of 2 ml supernatant was mixed with 100 µl of orthophosphoric acid and 4 ml of Salkowsky reagent (2% 0.5 M FeCl3 in 35% per-chloric acid) and incubated at 28 ±2 ÌŠC in darkness for 1 h. The absorbance of developed pink colour was read at 530 nm. The IAA concentration in the supernatant was determined using a calibration curve of pure IAA as a standard. Hydrogen cyanide production by P. aeruginosa OSG41 strain was detected by the method of Bakker and Schipper (1987). For HCN production, P. aeruginosa OSG41 strain was grown on an HCN induction medium (g l-1: tryptic soy broth 30; glycine 4.4 and agar 15) supplemented with 0, 50, 100, 200 and 400 µg ml-1 of hexavalent chromium at 28±2 ÌŠC for 4 days. Further, a loopful culture of strain OSG41 was placed in the centre of the Petri plates, amended with selected concentration of hexavalent chromium. A disk of Whatman filter paper No. 1 dipped in 0.5% picric acid and 2% Na2CO3 was placed at the lid of the Petri plates. Plates were sealed with parafilm. After 4 days incubation at 28 ±2 ÌŠ C, an orange brown colour of the paper indicating HCN production was observed.

2. 5. 3 Ammonia and exo-polysaccharide synthesis

For ammonia (NH3) detection, P. aeruginosa OSG41 strain was grown in peptone water with 0, 50, 100, 200 and 400 µg ml-1 of hexavalent chromium and incubated at 28±2ÌŠ C for 4 days. One millilitre of Nessler reagent was added to each tube and the development of yellow colour indicating ammonia production was recorded following the method of Dye (1962). The exo-polysaccharide (EPS) produced by the Pseudomonas aeruginosa OSG41 was determined as suggested by Mody et al. (1989). For this, the bacterial strain was grown in 100 ml capacity flasks containing basal medium supplemented with 5% sucrose and treated with 0, 50, 100, 200 and 400 of hexavalent chromium. Inoculated flasks were incubated for 5 days at 28 ± 2 ÌŠC on a rotary shaker. Culture broth was spun (5433 g) for 30 min. and EPS was extracted by adding three volumes of chilled acetone (CH3COCH3) to one volume of supernatant. The precipitated EPS was repeatedly washed three times alternately with distilled water and acetone, transferred to a filter paper and weighed after overnight drying at room temperature.

2. 6. 1 Plant growth and metal uptake

Seeds of chickpea var. Avrodhi were surface sterilized with 70% ethanol, 3 min. followed by 3% sodium hypochlorite, 3 min., rinsed six times with sterile water and shade dried. The sterilized seeds were bacterized with P. aeruginosa OSG41, grown in nutrient broth, by dipping the seeds in liquid culture medium for 2 h using 10% gum Arabic as adhesive to deliver approximately 108 cells seed-1. The non-coated sterilized seeds soaked in sterile water served as control. The non-inoculated and inoculated chickpea seeds (8 seeds per pot) were sown in clay pots (25 cm high, 22 cm internal diameter) using 3 Kg unsterilized soils from agricultural field of Aligarh Muslim University Aligarh (sandy clay loam, organic carbon 0.4%, Kjeldahl N 0.75 gkg-1, Olsen P 16 mgkg-1, pH 7.2 and WHC 0.45 mlg-1, Cr 6.5 µgg-1, Cu 18 µgg-1, Ni 14.7 µgg-1, Zn 25 µgg-1, Pb 9.5 µgg-1 and Cd 0.4 µgg-1) with control (without chromium) and four treatments each with 50, 100, 200, and 400 µgg-1 chromium (vi) in soil used in this study. Six pots used for each treatment were arranged in a complete randomized block design. Three weeks after emergence, plants in each pot were thinned to three plants. The pots were watered with tap water and were maintained in an open field condition. The experiments were conducted for two consecutive years to ascertain the reproducibility of data.

2. 6. 2 Measurement of biological characteristics, symbiotic efficiency, seed yield and metal uptake

All plants in three pots for each treatment were removed at 80 days and remaining three pots at 130 days after seeding (DAS), and was observed for growth and symbiotic attributes. Plants uprooted at 80 and 130 DAS were oven-dried at 80 ÌŠC and dry matter was measured. Total chlorophyll content in fresh foliage of inoculated chickpea plants grown in chromium stressed and metal free (control) soil was measured at 80 DAS by the method of Arnon (1949). The leghaemoglobin (Lb) content in fresh nodules recovered from the root system of chickpea plants maintained under metal stressed and metal free soils (control) was assessed at 80 DAS (Sadasivum and Manikam, 1992). Seed yield and grain protein was estimated (Lowery et al. 1951) at 130 DAS (harvest). Chromium content in chickpea organs (roots and shoots) at 80 DAS and roots, shoots and grains at 130 DAS were determined by the method of Ouzounidou et al. (1992).

2. 6. 3 Bioassay of proline

The proline content in roots and shoots of chickpea plants was determined at 80 DAS while in seed it was assayed at 130 DAS. A 500 mg fresh weight of chickpea plant materials prepared separately was homogenized with 10 ml of 3% aqueous sulfosalicylic acid. The resulting homogenate was filtered through Whatman No.2 filter paper. The filtrates were made upto 20 ml with 3% sulfosalicylic acid and used for the estimation of proline following the method of Bates et al. (1973).

2. 7 Statistical analysis

The experiment was conducted for two consecutive years under the identical environmental conditions and each treatment was repeated three times. Since the data of the measured parameters obtained were homogenous, they were pooled and subjected to analysis of variance. The difference among treatment means was compared by high range statistical domain (HSD) using two-way ANOVA at 5% probability level.

3. Results

3. 1 Total heavy metal concentration in soils

Heavy metal in polluted soils of Ghaziabad near Hindon River and non polluted soils of Faculty of Agricultural Sciences, AMU, Aligarh was determined by atomic absorption spectrophotometer (Table 1). Heavy metal concentrations in polluted soils of Ghaziabad (S1) were (µgg-1): cadmium 16.4, chromium 108.5, copper 745, lead 230.5, Nickel 318.5 and Zinc 4580. While Heavy metal concentration in conventional cultivated soils of Faculty of Agricultural Science (S2) were (µgg-1): cadmium 0.4, chromium 6.5, copper 18, lead 9.5, nickel 14.7 and zinc 25.5

3. 2 Characterization and molecular identification of the strain OSG41

The bacterial strain OSG41 recovered from mustard rhizosphere was characterized and identified as Pseudomonas aeruginosa by standard morphological, physiological and biochemical tests. To further validate the identity of the isolate, 16S rDNA sequence analysis of this strain was performed. The nucleotide sequence of 16S rDNA of OSG41 was found to be approximately 1466 bp in size. The sequence of the 16S rDNA of this strain was submitted to GenBank (accession number HM222648). A similar search was performed by using the BLAST program that indicated that strain OSG41 shared a close relationship with the rDNA sequence of Pseudomonas aeruginosa EU037096.1 (16S: 99% similarity with the reference strain EU037096.1). Such high similarity values confirmed it as Pseudomonas aeruginosa. A phylogenetic tree constructed by MEAG 4 software, based on 16S rDNA partial sequence is presented in Fig.1.

3. 3 Chromium tolerance

In this study, bacterial strain Pseudomonas aeruginosa OSG41 isolated from the rhizosphere of mustard, grown at the outskirts of Ghaziabad (28° 40´ latitude and 77° 25´ longitude), India was tested against a range of heavy metals that included Cr+6 , Cd2+ , Cu2+ , Ni2+ and Zn2+ in order to establish it as a metal tolerant bacterial strain. Bacterial strain in general showed a variable response to each metal but even the lower concentrations of all tested metals were inhibitory to all bacterial strains (data not shown) except strain P. aeruginosa OSG41, which tolerated a considerable amount of heavy metals such as Cr+6, Cd2+, Cu2+, Ni2+ and Zn2, when grown on nutrient agar plates amended with the graded concentrations (0-2000 μg ml−1) of each metal. The tolerance level of P. aeruginosa OSG41 strain against heavy metals ranged above 1200 (e.g., Ni, Cu, Zn) and 1800 μg ml−1 (chromium). Among the selected heavy metals, P. aeruginosa OSG41 strain displayed the maximum tolerance against Cr6+. The MTL values of the strain OSG41 against each metal were, however, remarkably high (Table 2).

3. 3. 1 Chromium reduction influenced by environmental variables

3. 3. 1. 1 Effect of pH on Cr6+ reduction

The effect of different pH values on P. aeruginosa OSG41 mediated reduction of Cr6+was variable (Fig. 2). Generally, strain OSG41 was found to significantly reduce chromium at pH range from 6 to 8 when culture was grown at 35±2 ËšC in the presence of 100 µgCrml-1 added to NB medium. The maximum reduction (100%) of Cr6+ was however, observed at pH from 6-8 after 120 h incubation by P. aeruginosa OSG41, which was followed by pH 5 (88%) and pH 10 (79%). While comparing the effect of different pH values on chromium reduction by strain OSG41, incubated for variable time periods, a maximum of 3.40 times greater reduction was observed at pH 8 relative to pH 4 after 10 h bacterial growth. Chromium reduction increased significantly with increasing pH and incubation period; 40% reduction at pH 6 (80ugml-1) and 55% reduction at pH 8 (110 ugml-1) after 40 h of bacterial growth which increased substantially by 81% at pH 6 (162 ugml-1) and 83% at pH 8 (166 ugml-1) after 80 h incubation of P. aeruginosa OSG41 in the presence of 200 µgCrml-1 added to NB medium.

3. 3. 1. 2 Effect of temperature on Cr6+ reduction.

Temperature is yet another important factor, which directly affects the growth of bacterial populations and their associated activities including the bio-reduction of hexavalent chromium. Generally, the chromium reduction by the test bacterial strain increased consistently upto 35 °C which however decreased considerably at 40 °C. For example, P. aeruginosa OSG41 significantly increased the hexavalent chromium reduction by approximately 20% at 30 and 35 (each) compared to those observed at 25 °C which however decreased by about 25% at 40 °C relative to those determined at 30 and 35 (each) after 120 h at 50 µgCrml-1 (Fig. 4).

3. 3. 1. 3 Effect of chromate concentration on Cr6+ reduction

Chromium reduction monitored at different initial concentration ranging from 50 to 400 µgml-1 was greatly influenced by P. aeruginosa OSG41 (Fig. 3). Chromium reduction by the strain P. aeruginosa OSG41 was comparatively maximum at lowest concentration of 50 µgml-1; complete reduction was observed after 60 h., at 100 µgCrml-1, complete reduction was achieved after 120h after bacterial growth.

3. 4. 1 Plant growth promoting activities

Hexavalent chromium tolerant bacterial strain OSG41 used in this study revealed considerable production of PGP substances when grown both with and without hexvalent chromium (Table 3). The effect of four concentrations (50, 100, 200 and 400 µgml-1) of hexavalent chromium on plant growth promoting traits like IAA, P solubilization, exo-polysaccharide (EPS) production, siderophores production (salicylic acid, 2,3-dihydroxybenzoic acid ), hydrogen cyanide (HCN) and ammonia production by P. aeruginosa OSG41 was variable (Table 4). Generally, the measured traits of strain OSG41 like, EPS production increased with 100 µgCrml-1 and then decreased with increasing metal concentrations. Likewise, phosphate solubilization, IAA and siderophores activities progressively decreased with increasing dose of metal, HCN and ammonia production were however, not affected by increasing metal concentration. At 400 µgCrml-1 the PGP activities IAA, phosphate solubilising activity, EPS, SA and 2,3-dihydroxybenzoic acid of strain P. aeruginosa OSG41 decreased by 67, 81, 12, 58 and 53% compared to those observed under metal free medium.

3. 4. 1. 1 Plant growth and symbiotic traits

In this study, we analyzed the chromium toxicity to chickpea crop and determined the effect of bioinoculant on crop performance in metal treated soil. Chickpea seeds inoculated with plant growth promoting rhizobacterium, P. aeruginosa OSG41 grown in sandy loam soils amended with different concentration of Cr+6 applied separately, had better growth compared to uninoculated plants (Table 4). P. aeruginosa OSG41 strain used as a bioinoculant with 108 µgCrg-1, increased the dry biomass of roots, and shoots, nodule numbers, nodule biomass and whole plant biomass by 68, 52, 27, 23, and 58% at 80 DAS and 53, 41, 50, 49 and 52 at 130 DAS, respectively. Grain yields recorded for inoculated plants was increased by 40%, compared to control. While comparing the effect of bioinoculant (strain OSG41) applied at 216 µgCrg-1 concentrations to those of only chromium amended soil, a maximum increase of 63, 67, 50 and 48%, in root dry mass, shoot dry mass, number of nodule per plant and nodule dry mass at 80 DAS, and root dry mass, shoot dry mass, total dry mass, nodule mass and nodule number increased by 71, 60, 62, 36 and 33%, respectively at 130 DAS. The two way ANOVA revealed that the effects of inoculation and chromium was significant (P≤0.05) for the measured parameters. The interactive effect of inoculation and chromium was significant for all parameter (Table 4) at 80 DAS and 130 DAS.

3. 4. 1. 2 Chlorophyll and leghaemoglobin content

In the absence of bacterial inoculants (P.aeruginosa OSG41), chlorophyll and leghaemoglobin content of chickpea plants measured at 80 DAS decreased consistently with increasing concentration of Cr+6 (Table 5). Chromium at 216 µgg-1 decreased the total chlorophyll and legheamoglobin contents by 50 and 33% respectively, relative to those observed for uninoculated chickpea plants. In contrast, the bioinoculant increased the chlorophyll content by 30% and leg-haemoglobin content by 27% at 108 µgCrg-1 soil compared to un-inoculate. While comparing the effect of 216 µgCrg-1 on inoculated and un-inoculated plants, a maximum increase of 32, 38, 35, 15, 31, 35 and 38% in total chlorophyll content, leghaemoglobin, N content in roots and shoots, P content in roots and shoots, and seed protein, respectively. Two factor ANOVA revealed that the individual effect of inoculation and their interaction (inoculation - Cr+6) were significant (P≤0.05) for the measured parameters.

3. 4. 1. 3 Seed yield and grain protein

Seed yield and grain protein assayed at harvest (130 DAS) progressively decreased with increasing concentration of chromium (Table 6). Seed yield and grain protein of inoculated chickpeas increased by 19 and 21%, respectively, compared to control. In comparison, the chromium reducing strain P. aeruginosa OSG41 increased the seed yield and grain protein by 39 and 30 % respectively, at 108 µg Crg-1 soil, compared to uninoculated chickpea plants grown in the soil treated with similar concentration of chromium. While chromium reducing P.aeruginosa (OSG41) enhanced the seed yield and grain protein by 15 and 9% respectively, at 108 µgg-1 soil, compared to inoculated but metal free control chickpea plants. Two way ANOVA revealed that the individual effect of inoculation and Cr and their interaction (inoculation - Cr+6) were significant for the measured parameters.

3. 5. 1 Chromium uptake

Chromium accumulation in roots and shoots of chickpea plants observed at 80 and 130 DAS, increased with increasing concentration of Cr+6, added to soil. Maximum chromium uptake like, 46.9 µg Crg-1 and 26.8 µg Crg-1 was determined at 80 DAS in uninoculated plants while 25.5 µgg-1 and 17.5 µgg-1 in the roots and shoots of inoculated chickpea plants, respectively. Application of bioinoculant (P. aeruginosa OSG41) however reduced the level of chromium in roots and shoots by 46.6% and 35% respectively, measured at 80 DAS (Fig. 5). At 130 DAS, chromium accumulated in roots and shoots of uninoculated plants were: 72.5 µgg-1 and 33.6 µgg-1 (Fig. 6) while it was 45 µgg-1 (roots) and 20.5 µgg-1 (shoots) of P. aeruginosa inoculated chickpea plants. Interestingly, the inoculant bacterial strain (OSG41) decreased the concentration of chromium in roots and shoots by 37 and 63%, respectively at 130 DAS when chickpea was grown with 216 µgg-1 soil compared to those observed for uninoculated plants. A maximum decrease in chromium uptake (36%) was recorded for chickpea seeds compared to uninoculated chickpea. While comparing the accumulation of chromium in different plant organs, seeds in general had maximum chromium compared to other tested parts of chickpea plants.

3. 6. 1 Proline accumulation

Proline accumulation in the plant roots and shoots measured at 80 DAS and grains at 130 DAS increased with increasing concentration of Cr+6, added to soil. A maximum uptake of 46 and 42 mgg-1 fresh weight was recorded in roots and shoots after 80 DAS when plants were grown without bioinoculant while in the presence of bioinoculant, it was 37.5 and 34.50 mgg-1 fresh weight proline in roots and shoots, respectively, at 216 mgkg-1 chromium amended soil. The application of bioinoculant substantially declined the proline concentration in roots and shoots of chickpea plants by 35% and 18.% respectively, after 80 DAS (Fig. 6) Maximum proline (63.3 mgg-1 fresh weight ) accumulation was recorded in grains collected from uninoculated while it was 48.2 mgg-1 fresh weight in grains of inoculated plants.

4. Discussion

4. 1 Identification and characterization

The effluents discharged from different industries are reported to contain variable heavy metals including chromium to an extent of toxicity level (Dermou et al. 2005). When used intentionally in agronomic practices, such effluents are known to cause shifts in microbial communities leading even to the emergence of pollutant (e.g., metal) resistance among bacterial population (Stepanauskas et al. 2005). Considering the wide spread resistant/reducing traits among bacteria, metal reducing for example chromium reducing plant growth promoting rhizobacteria such as Bacillus sp. (Wani et al. 2007; 2011; He et al. 2010) and Pseudomonas sp. (Hassan et al. 2008; Raja et al 2006) have been isolated and characterized from metal contaminated environment. In this study we isolated metal tolerant bacteria from soil receiving metal containing effluent. Metal tolerant strain (OSG41) was later on identified as Pseudomonas aeroginosa (Acc no. HM222648) using biochemical tests and 16S rDNA sequence characterization and phylogenetic analysis.

4. 2 Hexavalent chromium reduction

The ability to reduce the toxicity of hexavalent chromium has been found in many bacterial species including PGPR such as Pseudomonas fluorescence (Bopp et al. 1983), Enterobacter cloacae ( Wang et al. 1989), Bacillus sp. (Wani et al. 2007) and Staphylococcus capitis (Zahoor and Rehman, 2009). Under both aerobic and anaerobic conditions.The chromium reduction is however influenced both by varying pH and temperature (Stewart et al. 2007; Van Engelen et al. 2008). Considering the importance of these environmental variables in chromium reduction, we used a bacterial strain Pseudomonas aeruginosa OSG41 to assess its chromium reducing ability under changing factors. Interestingly, this strain was able to reduce Cr(VI) at wide range of pH (4-10) and temperature (20-40 ÌŠ C), as also reported by others (Wani et al. 2007; Zahoor and Rehman 2009). Furthermore,

The growth of Pseudomonas aeruginosa OSG41 and its reduction ability was assessed at varied Cr+6concentration; the overall rate of Cr+6 reduction decreased with increasing concentration of Cr+6. However, the rate of Cr+6reduction was not inhibited by high levels of chromium during early phase of reduction process. Similar trend was observed by Rahman et al. (2007) for Pseudomonas sp. C-171 against different concentration of Cr+6. However, among bacteria, Athrobacter sp. has been found more efficient chromium reducing organism than Bacillus sp. (Megharaj et al. 2003) while the Arthrobacter oxydans was affected even at a very low (35 µgml-1) concentration of Cr+6 (Asatiani et al. 2004).

4. 3 Effect of chromium tolerant strain (OSG41) on chickpea grown in chromium treated soils

Application of bacterial inoculants as biofertilizer has been reported to result in better growth and increased yield of different crops (Zaidi et al. 2003; Bushan and Holgiuin, 1997; Wani et al. 2011) Considering both the growth promoting efficiency and metal tolerant ability of the Pseudomonas aeruginosa OSG41, we designed an experiment to assess the performance of inoculated chickpea in chromium amended soils. The results are discussed in the following section.

4. 4 Plant growth and nodulation

Generally, the chickpea growth expressed both in terms of dry matter and symbiotic attributes, was higher for inoculated chickpea than in uninoculated ones even when grown in the presence of the varying level of Cr+6. Like any conventional PGPR, chromium tolerant Pseudomonas aeruginosa OSG41 used as inoculants in this study caused a substantial increase in the overall performance of chickpea probably due to the synthesis of plant growth regulating substances (Wani et al. 2008), reported to promote root growth directly by stimulating plant cell elongation or cell division (Minamisawa and Fukai 1999). Furthermore, the HCN, and siderophores producing ability of this stain might also have enhanced the root growth and uptake of soil minerals by the host plant as also observed by others (Zaidi et al. 2006; Wani et al. 2007a; 2008).

Like growth characteristics, the nodules formed on the root system of inoculated chickpea plants raise in soil amended with chromium, was significantly higher compared to those observed for uninoculated plants. Also, the leghaemoglobin content in fresh nodules collected from inoculated chickpea was greater. The improved symbiotic relationship measured as nodule numbers and leghaemoglobin in bacterized legumes host grown in chromium amended soil is a clear suggestive of the rhizobial establishment and survival within chromium polluted soil which despite chromium continued to express its full growth promoting abilities even in the presence of chromium. Similar, increase in the growth of inoculated legumes grown in the presence of metals has been reported by Pajuelo et al. (2008) and Wani and Khan (2011).

4. 4.1 Chlorophyll, seed yield and grain protein

In the absence of bacterial culture, there was a progressive decrease in the chlorophyll content in fresh foliage measured at 80 DAS and seed yield and grain protein after harvest. In comparison, Pseudomonas aeruginosa OSG41 increased the measured parameter when chickpea was grown with different concentration of chromium added intentionally to sandy clay loam soils. Tripathi et al. (2005) has reported a similar increase in the chlorophyll content of greengram [Vigna radiata (L) wilczek] plants inoculated with siderophore producing and lead and cadmium resistant Pseudomonas putida KNP9 under metal stressed condition. Seed yield and protein of chickpea was increased in presence of bioinoculant strain (Pseudomonas aeroginosa OSG41) under influence of chromium in soil. However, severe adverse effects were recorded when chickpea was grown with sole application of chromium. In a study similar to the present investigation, Chaudhri et al. (2000) observed an increase in seed yield of pea (Pisum sativum) when grown in the presence of bioinoculant under influence of heavy metals for example zinc and copper. While seed protein increased in the presence of bioinoculant (Klyvera ascorbata SUD165) in the presence of heavy metals Zn, Ni and Pb.

4. 5 Chromium accumulation

The uptake of chromium in different organs such as roots, shoots and grains of chickpea plants, grown in variously metal treated soils increased gradually with increase in the concentration of chromium added to soil. Interestingly, plant growth promoting and chromium reducing bacterial strain used as a bioinoculant, however caused a substantial decline decrease in the concentration of chromium in roots, shoots and seed compared to uninoculated crop. The reduction in chromium concentration in chickpea organs thus exhibited the ability of this strain to protect legume crop against the inhibitory effect of high concentration of hexavalent chromium. Faisal and Husnain (2005) have also observed a lesser accumulation of chromium in Ochrobacteriam intermedium inoculated Helianthus annus while Wani et al. (2008) reported a reduced uptake of chromium by Mesorhizobium inoculated chickpea plants and concomitantly a significant increase in the overall performance. In the presence Bacillus sp. inoculated chickpea when grown in chromium stressed soils (Wani and Khan 2011).

4. 6 Proline accumulation

Enhanced synthesis of free cellular protein during various abiotic stresses has been found to provide a multifunctional protective role in most plant species (Hare and Cress 1997; Szabados and Savoure, 2010). For example, Schat et al. (1997) reported heavy metal-induced accumulation of free proline in a metal-tolerant and a nontolerant ecotype of Silene vulgaris. In our study, we observed a significant accumulation of proline in chickpea plant organs like, roots, shoots and seeds due to high concentration of hexavalent chromium present in soils and increased with metal concentration suggesting that metals probably has inducible effect on proline synthesis . Proline accumulation however decreased significantly in bacterized plants (Fig. 4).

6. Conclusion

In the present study, we demonstrate the pytotoxic effect of hexavalent chromium on the performance of chickpea plants, grown in hexavalent chromium treated sandy loam soils. Hexavalent chromium tolerant Pseudomonas aeruginosa OSG41 when used as seed inoculant, however protected the plants from the toxicity of hexavalent chromium leading thereby to a considerable increase in the dry biomass, nutrient assimilation, seed yield and seed protein. The increased growth of chickpea plants even in the presence of chromium might have been due to several factors like (i) synthesis and release of plant growth promoting substances such as phytoharmones, siderophores and EPS by Pseudomonas aeruginosa OSG41 (ii) chromium reducing ability of the test bacterial strain and (iii) ability of bacterial strain to overcome the proline accumulation in metal stressed environment. Based on these properties, the bacterial strain OSG41 of Pseudomonas aeruginosa could be develope as a bioinoculant for its ultimate transfer to legume growers in order to enhance the production of chickpea in soil even poisoned with hexavalent chromium.

7. Conflict of interest

The authors declare that there are no conflicts of interest.

8. Acknowledgement

One of the authors Oves M. is grateful acknowledged to UGC and CSIR New Delhi, India for financial assistance in form of scholarship.