Listeria Monocytogenes Causes Listeriosis Serious Human Illness Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Listeria monocytogenes also known as Listeria is a bacterial pathogen that causes Listeriosis; a serious human illness. Unlike almost all other pathogens it can continue its growth under proper refrigeration condition. It is also considered as emerging since it has been recently discovered to be a food borne pathogen. According to Nightingale et al., (2004), 2500 cases and 500 deaths result from Listeriosis cases each year. Recently on the 22nd of January 2010, the monitoring and quality assurance (MoniQA) in the food supply chain reported that 24 people from Austria were infected by listeria and five cases were fatal. Although Listeriosis is rare among individual unlike other food borne disease such as Salmonellosis it produces acute consequences which includes infection of the nervous system. In Mauritius no data are available about any outbreaks of Listeria monocytogenes. This may be due to the lack of screening techniques in the country.

In most outbreaks reported, products such as ready to eat foods, milk and cheese has been implicated. In this study chicken ham was used as a ready to eat food. According to the ECOLAB "Listeria is widely distributed in nature, and the organism has been recovered from farm fields, vegetables, animals and other environments such as food processing facilities, retail stores and home kitchens and ready-to-eat foods." Therefore the source of contamination may differ. The range of population that are susceptible to Listeria monocytogenes are pregnant woman, elderly people, new borne and people with a weak immune system.

The main aim of the study is therefore to assess the genetic diversity of the listeria monocytogenes which is the only species from the genus Listeria that affect both human beings and animals. As most natural populations and microbial populations do not have a constant size and structure with constant evolutionary changes that occur in the environment and the genetic composition of the individuals. During the experiment 13 positive isolates were used for assessing the genetic diversity. The ISO method 11290-1:1996 was used for the isolation of the bacteria and for the DNA extraction the conventional method was used. For assessing the genetic diversity a conventional PCR method was used with specific PCR primers such as hly, iap and li-lnD4.

Many previous studies on the genetic diversity of listeria monocytogenes has been done and they has contributed greatly in identifying the source of outbreaks occurred in the world. According to Virdi JS et al., (2007) the major advantages of a study on the genetic diversity of a certain pathogen is to develop accurate diagnosis, vaccines and therapeutics. Furthermore in the medical field and concerning the public health, a study in pathogen diversity allows us to gain a more perspective approach towards the evolutionary pattern and introduction of new species of the pathogens. The pathogenicity and phylogenetics of the pathogen can be understood more effectively.

Literature Review:

1.1History of Listeria:

Salmonellosis, Shigellosis, Yersinosis and many other infectious diseases were named after the one who discovered them unlike Listeriosis. Once the causative agent was discovered by Murray, Webb and Swann, generic names such as bacterium monocytogenes was used and finally Listeria (Pirie) to honour Dr. Lister, the discoverer of antisepsis. Hence, in the past the disease was known as Listeriosis until, Listeria came into the general usage.

Listeria was first known to be the causative agent of epidemic and sporadic cases in 50 species of animals, now the disease has been appearing on an increasing rate in the human population.

In 1926, Murray, Webb identified Listeria monocytogenes and the bacterium was named by Swann. The bacterium was then renamed by Pirie in 1927 and was given its current name, Listeria monocytogenes.

In 1891, doctors in France and Germany discovered a gram positive bacterium in samples of tissues of patients who suffered and died from a disease similar to Listeriosis. In 1929, Nyfeldt described the first confirmed report of Listeriosis in humans caused by Listeria monocytogenes.

Listeria was first known to be the cause of epidemic and sporadic cases in 50 species of animals.

1.2Characterization of Listeria monocytogenes.

Listeria monocytogenes is a small highly motile gram positive rod. It is a non spore-forming cocco-bacillus, facultative anaerobe which is catalyses positive. These ubiquitous saprophytes are widespread in nature that is they can be found in soil and water. Vegetables can get contaminated if the soil, manure or the water used is contaminated. The bacterium can also be carried away by both wild and domestic animals that may apparently appear healthy.

The bacterium is an opportunistic pathogen. It is capable of surviving and multiplying outside animal hosts and in quite simple nutrient medium. (Chapman and Hall, 1996.). It grows under refrigeration conditions from 1°C up to 44°C. However, its growth rate decreases below 1C and it is easily destroyed by heat.

Normally pasteurization and cooking kill Listeria, but it can be found, in certain ready-to-eat food. This is due to contamination which occurs prior to packaging.

1.2.1Serology:

Listeria monocytogenes can be further characterized based on the presence of specific heat stable somatic (0) and heat-labile flagella (H) antigens. Based on the "O" and H" antigens, strains of Listeria monocytogenes, isolated from pathological sources are subdivided into serotypes: 1/2a,1/2 b, 1/2c, 3a,3b,3c,4a,4ab,4b,4c,4d,4e,4f,5 and 6. Serotypes 1/2a, 1/2b and 4b are responsible for greater than 95% of all human infections (Frances Pouch Downee, Keith Ito, 2001).

1.3 Factors affecting growth and survival of Listeria monocytogenes.

Listeria monocytogenes is a psychotropic bacterium that is it has the ability to resist the cold temperature of refrigeration. However, Listeria monocytogenes is also thermo tolerant when subjected to temperatures above the optimum.

The broad pH range for growth for Listeria monocytogenes allows it to survive. pH 7.0 - 7.5 is the optimum pH for the growth of Listeria monocytogenes (Dean, 1990).

The bacteria can resist a high concentration of salt that is an environment with a low water potential. It has been shown that the organism can tolerate environments of 25.6 % NaCl for at least 132 days at 22°C and 5 days at 37°C (Adams; 2001; Lovette, 1989).

Moreover the presence of other microorganisms in the same medium (on the same contaminated food) can cause a decrease in the population of Listeria monoctyogenes.

1.4 Listeriosis:

Also known as the Circling Disease or Silage sickness, it is a worldwide disease and a serious food borne disease for humans. The term Listeriosis encompasses a wide variety of disease symptoms that are similar on animals and humans.

Persons of advanced age, pregnant women, new born and adults with infected immune systems are normally prone to attract this disease. A normal person without those criteria mentioned above can also be affected. He can be infected by consuming contaminated food. Babies may get infected at birth itself if their mother had consumed contaminated food during pregnancy.

According to the world health organization (WHO), outbreaks of Listeriosis have been reported from many countries, including Australia, S Switzerland, France and the United states. Two recent outbreaks of Listeria monocytogenes in France in 2000 and in the USA in 199 caused by contaminated pork tongue and hot dogs. Till date no such cases have been reported in Mauritius.

1.41 Health risk of listeria:

Hayes (1992) considered Listeria monocytogenes as a low grade pathogen since there is no clinical manifestation in healthy individuals upon ingestion of low numbers of viable cells. According to the Center for Food Security and Public Health of LOWA STATE UNIVERSITY 1-10 % of the population is thought to carry Listeria monocytogenes asymptomatically in the intestines (May, 2005).

Vomiting, Nausea, Cramps, Diarrhea, severe headache, constipation and persistent fever is the symptoms that may occur suddenly. Meningitis encephalitis is the infection of the brain and its surrounding tissue. Septicemia is the poisoning of blood caused by listeria. The overall mortality rate in the group of susceptible people mention in section…. Are 20 -30%.

Listeria monocytogenes can be identified in tissues using ELISA, PCR and other molecular techniques. It is treated with antibiotics depending on the form of the disease.

1.5 Mode of invasion and spread of Listeria in host cells:

Listeria monocytogenes is acquired by ingestion. The bacterium must find and adhere to the intestinal mucosa or the intestinal crypt cells, which are the only undifferentiated mucosal cells. Once the bacterium is phagocytosed, it becomes enclosed in a phagolysosome, a sub cellular organelle. Normally the low pH and the contents of the phagosomes are toxic to microorganism, however, environment of low pH causes Listeria monocytogenes to produce hemolysin, Listeriolysin O (LLO).LLO lyses the cell membrane of the phagolysosome and this causes release of the Listeria into the cytoplasm. Listeriolysin-O produce by all pathogenic strains is important for their escape and pathogenesis (F.S Southwick and D.L Purich, 2011) .Once in the cytoplasm, the bacteria multiplies and proliferates and the bacteria become surrounded by an electron-dense material. The bacteria are then known to be polarized at one end. The electron-dense material give the bacterium an elongated protrusions form and filopods which are in turns ingested by adjacent cells and the cycle begins anew.

Spreading from cell to cell without directly being in contact with the extracellular environment is how Listeria Monocytogenes invade the cells of its hosts.

Figure1: showing invasion of Listeria Monocytogenes in cells.

http://www.google.mu/imgres?imgurl=http://legacy.lakeforest.edu/images/userImages/eukaryon/Page_6629/image%25201.jpg&imgrefurl=http://legacy.lakeforest.edu/eukaryon/vol003/reviewarticle/haas2.asp&usg=__UjJViuMqz4k-d1O1L4YH9YVB7q0=&h=540&w=720&sz=41&hl=en&start=0&zoom=1&tbnid=sN221KYvlhQ3MM:&tbnh=138&tbnw=184&ei=nMhrTYGFMNGCtgeDkIToAw&prev=/images%3Fq%3Dinvasion%2Bof%2Blisteria%26um%3D1%26hl%3Den%26sa%3DN%26biw%3D1152%26bih%3D727%26tbs%3Disch:1&um=1&itbs=1&iact=hc&vpx=355&vpy=236&dur=361&hovh=162&hovw=216&tx=138&ty=100&oei=nMhrTYGFMNGCtgeDkIToAw&page=1&ndsp=21&ved=1t:429,r:6,s:0

Isolation of Listeria Monocytogenes:

Since there has been increasing interest in the presence or absence of Listeria monocytogenes in foods, as a result of some substantial outbreaks of food borne listeriosis in North America and Europe, there has been a vital need to develop methods to isolate it in various type of food. Several methods such as ELISA, PCR and genetic hybridization technologies (Entis and Lerner, 1991, RMR Labs, 2000, certification, Report, 2000; Klein and Juneja, 2001) have been developed.

Department of agriculture (USDA) and the Food and Drug Administration (FDA), are the two US agencies that made use of different protocol for analysis of Listeria monocytogenes.

The techniques for isolation of Listeria monocytogenes involve two- stage enrichment, the pre-enrichment followed by enrichment and plating for isolation.

The enrichment procedures helps to keep the level of contaminating microorganisms to a reasonable numbers and allow multiplication of Listeria monocytogenes to levels that are enough for detection of the organism. Half Fraser Broth and the University of Vermont broth (UVM) are examples of broths for the pre-enrichment procedures. They allow revival of injured Listeria cells. The Fraser broth is used with a selective Fraser broth supplement in enriching for the enrichment steps after the pre-enrichment and for detecting Listeria. Both the Fraser and Half Fraser Broth contain sodium phosphate and potassium phosphate which are buffering agents. The presence of ferric ions acts as an indicator since the bacteria produces 6, 7- dihydroxycoumarin that reacts with the ferric ions thus resulting in the blackening of the medium. Lithium chloride, nalidixic acid and acriflavine give the broth a higher concentration of salt and inhibit growth of enterococci.

However, it is only after 48 hours that there is blackening of the broth.

For plating, PALCAM, Oxford and Modified Oxford (MOX) are used as selective agars for isolation of Listeria Monocytogenes. Lithium chloride, polymyxin B sulphate and acriflavine HCl, present in the PALCAM medium Base and ceftazidine found in the PALCAM supplement ensure the selectivity of the medium. These elements suppress other bacteria present in food except Listeria.

For differentiation, the PALCAM medium provides esculin and mannitol. Hydrolysis of esculin by Listeria causes production of 6, 7, dihydroxycoumarin, which reacts with the ferric ions that are present in the PLACAM medium to form blacken halos.

USDA method:

The USDA method involve a two- stage enrichment procedure with a 24-48 hours primary enrichment with UVM medium followed by a second enrichment phase with Fraser broth. Black colonies on the MOX plates show the presence of Listeria monocytogenes.

FDA method:

This method involves 48 hour enrichment at 30°C in buffered Listeria Enrichment Broth (BLEB). Pre enrichment procedure is optional which is done 4 hours at 30°C prior to the addition of the selective supplements. After 24 hours to 48 hours the culture is streaked onto Oxford, PALCAM, Lithium chloride-phenyl ethanol moxalactant (LPM). After 24-48 hours at 30°C, black-halo colonies prove the presence of Listeria.

ISO method:

The ISO method and the USDA method are alike with only the difference of using Half Fraser Broth for enrichment in the ISO method. The enrichment is done using Fraser Broth. On PALCAM or Oxford agar, the Listeria colonies are gray green with the black halo and black respectively.

DNA extraction:

As the phylogenic or the population genetics research is increasing, genomic DNA isolation from living material such as bacteria, fungi, plants, insects, animal cells and blood is important.

The conventional method of DNA extraction involves 3 steps namely:

Lysis of cell wall or cell membrane.

Removal of all unwanted content for example proteins, polysaccharide and lipids.

Recovery of DNA.

Gram positive bacteria such as Listeria monocytogenes has thick cell walls composed of peptidoglycan which is rigid, hence making it difficult to break down the cell wall. Therefore important treatment which involves the use of lysozyme, osmotic shock, detergent, boiling extraction is carried out. Commercial kit also available on the market is used for DNA extraction.

Molecular method for detection of Listeria monocytogenes:

Downes. F.P and Ito.k stated "Methods for subtyping Listeria can be separated into two broad categories: (a) conventional methods, which include serotyping, phage typing, and bacteriocin typing and (b) molecular methods, which encompass multilocus enzyme electrophoresis(MEE), chromosomal DNA restriction endonucleases analysis (REA), ribotyping, DNA macrorestriction analysis by pulsed- field electrophoresis (PFGE), random amplification of polymorphic DNA (RAPD) by PCR, and DNA sequence-based subtyping." (2001). RFLP ( restricted fragment length polymorphism) forms part of the molecular method for subtyping (Emily.T.yeh, 2004).

Note: for this experiment RAPD PCR was carried out to assess the genetic relatedness of the isolates of Listeria monocytogenes.

Conventional methods:

Serotyping:

According to the national salmonella reference laboratory serotyping is the testing of different antibodies with the interested bacteria to determine the nature of antigens present on the bacterial cell wall. It forms part of one of the oldest typing method still in use nowadays. Based on the presence of specific heat-stable somatic (O) and heat-labile flagellar (H), isolates of Listeria monocytogenes can be characterized using serotyping. 95% of all human infections are due to the antigens with serotypes 1/2a, 1/2b and 4b. However, serotyping alone is inadequate for confirmation of L.monocytogenes since not all Listeria spp share somatic antigens with L.Monocytogenes. (Downes.F, Ito.K, 2001)

Phage typing:

Phage typing system for L.monocytogenes was defined in 1985 by Rocourt et al. Phage typing has been the best recognize typing method for L.monocytogenes. The typing schemes are formed by isolation of a range of phages active against the bacteria of interest. The phage is then purified and its activity against large range of Listeria spp is assessed. Furthermore, to provide a high sensitivity for differentiation of the Listeria spp, a set of phages is chosen. However, this method suffers from conditions such as environmental conditions that may affect the sensitivity of the bacteria to infection by the phage.

Bacteriocin typing:

Bacteriocins are bactericidal substances that have antibiotic like effect against strains of bacteria. Bacteriocins of Listeria called, monocins, were first described by Sword and Pickett in 1961. A suitable producer strain is chosen and according to the sentivity of the bacteria against the bacteriocins, the isolates are typed.

Molecular methods:

Multilocus Enzyme Electrophoresis (MEE):

Multilocus enzyme electrophoresis (MEE or MLEE) was introduced in the early 1980s by Selander and coworkers. The technique is based on the separation of some enzymes used in metabolic pathways on non-denaturing starch gel (gel matrix). Different migration changes can occur due to the difference in the electrical charges, size and conformation of the enzymes. This can be easily observed after specific enzyme staining is done. Migration of the enzymes refers directly to the related to the nucleic acid on the corresponding genetic locus. Therefore analysis of different enzyme loci allows differentiation of many subtypes within a species. (Downes.F, Ito.K, 2001)

Chromosomal DNA restriction endonucleases analysis (REA):

The conventional REA of chromosomal DNA is an alternative method to the typing method. The techniques involve the digestion of chromosomal DNA and comparing the different fragment size obtained upon a gel electrophoresis. However, it remains a complicated method since a large number of bands may be of the same size, hence making identification difficult.

Ribotyping:

Ribotyping may be known as a specific example of RFLP analysis using conventional REA gels. The gel then undergoes southern blotting and hybridization. An rRNA gene is appropriately labeled and is allowed to hybridize on a nylon membrane. For sub-typing of L.Monocytogenes, ribotyping has been exclusively employed. (Bruce et al., 1995; Graves et al., 1994; Wiedmann et al., 1997).

Pulsed- field electrophoresis (PFGE):

This method makes use of freshly obtained large fragment of DNA. The genomic DNA is loaded on agarose gel. The electric fields are altered providing resolution of the large DNA fragment. A limited number of DNA bands are obtained which can be easily identified and compared.

Random Amplification of Polymorphic DNA (RAPD):

RAPD is a molecular marker system since it is easy and cheap and results are produced easily. It is an application that makes use of the PCR to detect any polymorphic differences that exist between individuals and species. (Saunders.G.C and Parkes.H.C, 1999)

DNA sequence-based Subtyping:

Advances made in the field of genomes sequencing technology, have facilitated sequencing of the entire genomes. DNA sequenced based sub-typing is an appropriate method for L.Monocytogenes with its excellent set of characterized, related and unrelated strains. The challenge when using DNA sequence sub-typing is to consider the region to be sequenced carefully to obtained epidemiological information that are relevant.

PCR methods:

In 1983, the introduction of PCR has revolutionized the microbial ecology and has been of increasing use in food microbiology. The polymerase chain reaction makes use of enzymes to amplify millions of copies of target DNA in few hours. "PCR today plays a central role in genetic typing of organisms or individuals and molecular epidemiology (Viljoen, G.J et al., 2005).

However, false positive results may be obtained if the PCR reaction is contaminated by living cells since the PCR can amplify both sequences from both living and non living cells. (Malorny et al., 2003)

Advanced PCR technologies:

Real-time PCR:

This new method of PCR has been recently invented by Higuchi and his colleagues.

According to Dr. J. Maurer (2006), this new enhanced PCR technique is based on detecting and quantifying the PCR products. It uses a fluorescent signals derived from the polymerase chain reactions(PCR) and convert them into numerical values for each sample.( M.T.Dorak, 2006). Real-Time PCR has been of major use in the diagnosis of infectious disease in laboratories. However, strict protocol should be followed and PCR inhibitors must be taken into consideration. (M.Schuller et al.,2010)

PCR:

A reaction mix for a conventional PCR consists of the targeted DNA, DNA polymerase (Taq polymerase.), deoxynucleotide triphosphates (dNTPs), buffer, Magnesium ions and primers. However, conventional PCR can detect only 1 parameter which limits their range. It is used to detect viruses and bacteria in microbiology laboratories dealing with diagnosis.

Multiplex PCR:

Multiplex PCR is a widespread molecular biology technique for amplification of multiple targets in a single PCR experiment. It is used to detect multiple targets within a single amplification reaction with multiple primers at the same time. Using a multiplex PCR we can diagnose the complex of a disease caused by possible pathogens.

Table1 showing target gene and primer sequence used in research made on L.Monocytogenes.

Target gene

Primer sequence (5'-3')

Hyl A

Forward: GCATCTGCATTCAATAAAGA.

Reverse: TGTCACTGCATCTCCGTGGT.

Hyl A

Forward: CCTAAGACGCCAATCGAA.

Reverse: AAGCGCTTGCAACTGCTC.

Dth18

Forward: CCGGGAGCTGCTAAAGCGGT.

Reverse: GCCAAACCACCGAAAAGACC.

α -hemolysin

Forward: CGGAGGTTCCGCCAAAGATG.

Reverse: CCTCCAGAGTGATCGATGTT.

β -hemolysin

Forward: ACAAGCTGCACCTGTTGCAG.

Reverse: TGACAGCGTGTGTAGTAGCA.

Hyl A

Forward: AACCTATCCAGGTGATC.

Reverse: CGCCACACTTGAGATAT.

Pep C

16S rRNA

Forward: GGTCGGTGCATTAATAAG.

Reverse: CAAGAGTTACAAATTACACC.

Forward: CACGTGCTACAATGGATAG.

Reverse: AGAATAGTTTTATGGGATTAG.

Hyl A

Forward: CATCGACGGCAACCTCGGAGA.

Reverse: ATACAATTACCGTTCTCCACCATTC.

Hyl A

Forward: ATTGCGAAATTTGGTACAGC.

Reverse: ACTTGAGATATATGCAGGAG.

iap

Forward: CGAATCTAACGGCTGGCACA.

Reverse: GCCCAAATAGTGTCACCGCT.

For this experiment the following primers were used:

Table 2 showing target genes and primer sequences used in the experiment:

Target gene

Primer sequence (5'-3')

hly

Forward: AGGATGCATCTGCATTCA

Reverse: GGATATCTGCATTATTTTGAT.

iap

Forward: AGGTTCTTCCAACAATAACAGC

Reverse: ATTTAACGCCATTGTCTTGC

i-inlDc

Forward (li-inlD4):

GAGAGAGCAATCTTTCAAC.

Reverse(li-emr5):

TTTCACCAACTAAAGCATTCAT.

The best characterized of Listeria monocytogenes is the listeriolysin 0 (LLO), which is coded by the hly gene. It is the LLO that gives the Listeria monocytogenes its pathogenecity effect. The LLO is produced by the Listeria monocytogenes in the host cell. The host cell is then lysed by the LLO which result in the release of the Listeria monocytogenes.

Iap and the i-inlDc locus are genes coding for the virulence factors in Listeria monocytogenes.

Restricted fragment length polymorphism (RFLP):

" one of the most commonly used tools for following the inheritance of genes or gene markers is that of the linked Restriction Fragment Length Polymorphism(RFLP)"stated by M.J.McPherson, et al.,1991.

The main technique involve in RFLP is making use of enzymes to digest the targeted DNA into different small fragments. Separation of the fragments is done by gel electrophoresis and comparison is done using a probe.

In many epidemiological investigations, RFLP has been successfully used. However, to compare and distinguish between isolates of closely related strains, a greater amount of DNA sample cannot be used to have a maximum variation. (G.Roger, 2005).

METHODOLOGY:

2.1Choice of sample:

From a previous dissertation work on detection of Listeria Monocytogenes in ready-to-eat foods in Mauritius , the food sample that showed positive result during isolation was mainly meat known as ham that need no further processing before consuming. Ham is also a food that is consumed by almost all people in the population. Moreover, food products related to outbreaks in France (2000), USA (2002) and in Canada (2008) are mainly pork tongue, roasted turkey meat and smoked meat. Therefore in this experiment Ham was used as sample.

2.1.1 Collection of sample:

The samples were purchased at random at different supermarket almost around the island. Precautions were taken to take the sample as fresh as possible and to maintain the temperature of the product until the experiment begun. The samples were well labeled using numbers so as to prevent any confusion that may crop up during the experiment.

2.2 Isolation of Listeria Monocytogenes:

For the isolation of Listeria Monocytogenes the ISO method 11290-1:1996 was used. However, some modifications were brought which are mentioned below. In the original protocol 25.0g of food sample was used for 225ml of Half Fraser Broth and in the experiment only 10.0g of food sample was used for only 90 ml of the Half Fraser Broth. Fraser Broth was used for the pre-enrichment step instead of Half Fraser Broth due to lack of the Half Fraser Broth supplement. The streaking was done of PALCAM agar.

2.2.2Media preparation:

The Fraser Broth and the PALCAM agar were prepared according to the instructions of the manufacturer (media preparation procedures in appendix I & II.)

10.0g of food sample + 90ml of Fraser Broth in a stomacher bag. Incubate at 30-32 °C.2.2.3 Enrichment and plating steps in the method used for isolation of Listeria Monocytogenes:

Pre- enrichment step:

Pipette 0.1 ml of Fraser Broth into corning tubes containing 10ml of fresh Fraser Broth.

Stomacher bag.

Enrichment step:

Incubate at 35°C for 48 hours.

Visually examine FB for darkening.

Figure 2: diagram showing the major steps involved in isolation of listeria Monocytogenes.

Plating step:

0.1ml of FB is streaked on PALCAM plate.

Incubate at 37°C for 48 hours under micro aerophilic conditions.

After 48 hours grey-green colonies with black centers and halo are looked for. C:\Documents and Settings\adadasd\Desktop\plate.jpg

2.2.4 Sterile measures taken during the experiment:

Scalpel and forceps were flame sterilized by using alcohol.

The pre-enrichment, enrichment and plating step were carried out in the laminar flow.

Broths and the media were autoclaved.

Stomacher bags were used to homogenize the samples under sterile conditions.

To be able to control the parameters affecting the results a positive and a negative control was carried out for each isolation batches done. The positive control was spiked yoghurt with Listeria Monocytogenes which gave a Grey-green with sunken and black halo and the distilled water was used as a negative control.

2.3 Gram staining and visualizing under the microscope:

A gram staining test was done as a confirmation test. The colonies obtained on the PALCAM plates, are gram stained and viewed under the microscope to confirm the presence of Listeria Monocytogenes.

A gram positive (purple color) stained cell indicates a positive result and a gram negative (pink color) stained cell indicates a negative result since Listeria Monocytogenes is a gram positive bacteria.

2.4 Sample preparation for PCR:

A PCR was used to assess the genetic diversity of the Listeria Monocytogenes obtained from the food samples.

2.4.1 Enrichment step:

Using a sterile streaking loop a colony of Listeria Monocytogenes on the PALCAM plates was scrapped and transferred to a corning tube containing 5ml of FB. The corning tube was incubated overnight at 37°C in an agitator at 250rpm. This step is crucial in concentrating the bacteria.

2.4.2 Collection of bacteria from the enrichment broth:

1.5ml of the inoculated FB culture was transferred to an eppendorf of 1.5 ml and centrifuge at 7050rpm for 10 min at 4°C. The supernatant is then discarded. Another 1.5ml of the FB culture is added to the pellet obtained and under the same conditions it was repelletized.

Using 1ml of 1XTE buffer the bacterial pellets was washed and centrifuged for 7050rpm for 10 min at 4°C.

2.4.3 DNA extraction of Listeria Monocytogenes:

The method used for DNA extraction was adapted from Burbano et al., 2006. Since Listeria Monocytogenes is a gram positive bacterium lysozyme was used to break down its cell wall and to decrease the concentration of protein and lipid which are PCR inhibitors the phenol chloroform extraction step was chosen.

200µl of 1XTE buffer with 2mg/ml of lysozyme was used to resuspend the bacterial pellet and was incubated for 45 min at 37°C for lysis of cell.

To the mixture another 300µl of 1XTE buffer with 1% SDS and 100µg/ml of proteinase K were added and incubated at 65°C for 1hour. This is done for degradation of proteins present in the mixture.

By adding 84µl of 5M NaCl and 60µl of CTAB (10% CTAB dissolved in 0.7M of NaCl.) for 65°C for 20 min residual peptides and lipids are removed.

To the resultant suspension an equal volume of phenol:chloroform:isoamyl(25:24:1) was added and was centrifuge at 9970rpm for 10 min at 4°C

To a fresh eppendorf tube, the resultant viscous aqueous phase is transferred and the organic phase is discarded.

The previous step (phenyl: chloroform: isoamyl) is repeated.

To the viscous phase in the fresh eppendorf, an equal amount of chloroform: isoamyl alcohol (24:1) was added, mixed and centrifuged at 9970rpm for 10 min at 4°C.

The DNA is recovered by adding 0.6 volume of isopropanol.

The eppendorf is inverted several times until stringy white precipitate is visible.

The eppendorf is then incubated at -20°C overnight to allow concentration of the precipitate.

The next day, the tube is centrifuged at 9970rpm for 15 min and was placed on ice to prevent degradation of the DNA.

Once centrifuged the supernatant was discarded and the pellet was washed with 1ml of 70% ethanol for 5 min at 4°C at 9970rpm.

The supernatant was discarded and the pellet was air dried in the centrifugal evaporator at 37°C for 20 min.

50µl of sterile distilled water was added to the pellet to resuspend the DNA and stored at -20°C.

2.5 Viewing the DNA by gel electrophoresis:

1.5 %( w/v) Agarose gel was prepared in 1XTE buffer. And the extracted DNA was run of the gel at 90V for 2 hours. After 2 hours the gel was stained with Ethidium Bromide solution and was viewed under UV light.

2.6 PCR AMPLIFICATION PROTOCOL:

For the PCR, three primers namely hly, iap and li-inlD4&li-emr5 pairs was used. They are specific for the hly gene (Listeriolysin O), iap gene (invasion associated protein) and the i-inlDC locus (internalin family in listeria proteins.) respectively. According to Hudson et al. (2001) and in many other PCR studies hlyA gene is an L.Monocytogenes specific primer and according to Cocolin et al. (2002) primers for the iap gene was used for food samples in Italy. In 2004 Schmid.W.M made use of the li-inlD4&li-emr5 for the evolutionary history of the genus Listeria and its virulence genes. The extracted DNA from the colonies obtained from the food sample was used for the PCR amplification.

The total volume for the PCR reaction in the PCR tubes was 30µl of reaction mixture. (Concentration and composition of reaction mixture in appendix.)

The hly primer sequence that targets the hly gene is as follows:

Forward sequence:

AGGATGCATCTGCATTCA

Reverse sequence:

GGATATCTGCATTATTTTGAT

The iap primer sequence that targets the iap gene is as follows:

Forward sequence:

AGGTTCTTCCAACAATAACAGC

Reversed sequence:

ATTTAACGCCATTGTCTTGC

The li-inlD4> & li-emr5< primer sequence that targets the i-inlDC locus is as follows:

Forward sequence (li-inlD4):

GAGAGAGCAATCTTTCAAC.

Reversed sequence (li-emr5):

TTTCACCAACTAAAGCATTCAT.

The following program for the amplification of hly gene: denaturation at 94°C for 1 min, followed by 40 cycles of denaturation at 94°C for 30s, annealing at 54°C for 30 s, elongation at 72°C for 30s and a last extension at 72°C for 5 mins was preset on the Bio-Rad MyCyler TM PCR machine.

For the iap gene amplification the PCR machine was preset as follows: denaturation at 94°C for 1 min, followed by 40 cycles of denaturation at 94°C for 30s, annealing at 57.5°C for 30s, elongation at 72°C for30s and a last extension at 72°C for 5 min.

For the i-inlDC locus amplification the PCR machine was preset as follows: denaturation at 94°C for 1 min, followed by 40 cycles of denaturation at 94°C for 30s, annealing at 45°C for 30s, elongation at 72°C for 30s and a last extension at 72°C for 5 min.

The total amplification times were approximately 2 hours. For the PCR a negative and a positive control were done. The positive control was the ATCC 7644 and for the negative control nanopure water was added to the mixture to replace the DNA sample.

After the PCR reaction, the products are run onto a 1.5 %( w/v) Agarose gel for electrophoresis at 90V for 2 hours along with a 2Kbp DNA ladder which acts as a molecular size marker. Once the gel electrophoresis ended, the gel was dyed with Ethidium Bromide and viewed under UV light.

CHAPTER 3: RESULT.

Isolation of Listeria Monocytogenes.

Table 3: representing list of sample used and the result before PCR from winners St Pierre

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Winners St Pierre

Ham(chicken ) on counter

H1

absent

Sausages(chicken) on counter

H2

Absent

Packed ham chicken (île de France)

H3

Suspected presence of L.Monocytogenes

Packed Ham with sweet pepper (chicken)( île de France)

H4

Suspected presence of L.Monocytogenes

"Roulade de poulet aux olives" (chiko)

H5

Absent

"Roulade de poulet aux cornichant trauchées  (chicko)

H6

Absent

"Jambo poulet"(île de France)

H7

Absent

Table 4: representing list of sample used and the result before PCR from winners Port-Louis

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Winners Port-Louis

"Roti de boeuf" ( île de france)

H8

Absent

"Roti de boeuf "(Silverside)

H9

Absent

"Mortadelle de Boeuf " (Silverside)

H10

Absent

"Mortadelle de poulet " (Silverside)

H11

Absent

"Galantine poulet"(Silverside)

H12

Absent

"Mortadelle poulet à l'aile"(Silverside)

H13

Absent

Table 5: representing list of sample used and the result before PCR from Shoprite

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Shoprite

"Blanc de poulet dore au four délices "(Saint Michel)

H14

Absent

"saucisson à l'oil"(Delice saint Michel

H15

Absent

"Mortadelle à l'aile" (Saint Michel)

H16

Suspected presence of L.Monocytogenes

Ham chicken on counter

H17

Absent

"Jambon poulet"(Saint Michel)

H18

Absent

"Mortadella chicken"on counter

H19

Suspected presence of L.Monocytogenes

Table 6: representing list of sample used and the result before PCR from Way Ebene

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Way Ebene

"Roti de Boeuf"(île de France)

H20

Absent

"Galantine de volaille"(île de France)

H21

Absent

"Mortadella à l'aile"(saint Michel)

H22

Suspected presence of L.Monocytogenes

"Jambo de poulet" (Isla Delices)

H23

Absent

Chicken mortadelle on counter

H24

Suspected presence of L.Monocytogenes

Jambo de dinde (île de france)

H25

Absent

Chicken galantine on counter

H26

Suspected presence of L.Monocytogenes

Table 7: representing list of sample used and the result before PCR from Way Flacq

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

way Flacq

Jambo de dinde (île de france)

H25

Absent

Roti de boeuf (ile de france)

H26

Absent

Jambon de volatile ( île de france)

H27

Absent

Galantine de volaille (isle de france)

H28

Absent

"Mortadelle l'aile piment" (saint michelle)

H29

Absent

"Mortadelle tranche"( Saint Michelle)

H30

Suspected presence of L.Monocytogenes

Table 8: representing list of sample used and the result before PCR from Spar Helvettia

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Spar Helvettia

"Galantine de volaille" (isle de france)

H31

Suspected presence of L.Monocytogenes

"Jambon de dinde" (isle de france)

H32

Absent

"Mortadelle poulet"( chicko)

H33

Absent

Mousseline de foie de volaille (chicko)

H34

Absent

Table 9: representing list of sample used and the result before PCR from Hypermarket Jumbo Phoenix

PLACE

SAMPLE

CODE

ABSENT/ PRESENT

Hypermarket Jumbo Phoenix

Jambon poulet on counter

H35

Suspected presence of L.Monocytogenes

Mohadelle poulet on counter

H36

Absent

Jambon dinde on counter

H37

Absent

Jambon pork on counter

H38

Suspected presence of L.Monocytogenes

Chicken ham on counter

H39

Suspected presence of L.Monocytogenes

Chicken ham with olives and capsicum on counter

H40

Suspected presence of L.Monocytogenes

The suspected grey green colonies obtained on the PALCAM plates were gram stained and viewed under the microscope to have more precision about the morphological characteristics of the bacteria. All the isolates develop a violet color with crystal violet.

Gel electrophoresis:

1

17

2

3

4

5

9

8

7

6

10

11

16

15

14

13

12

Figure3 : showing gel electrophoresis of genomic DNA.

The DNA obtained after extraction from the suspected colonies obtained were run on an Agarose gel.

From well 3 to 8, contained samples H3, H4, H16, H19, H30, H31. Well 2 consist of the positive control that is ATCC7644 and well 1 consists of a negative control which was sterile distilled water.

From well 10 to 16, contained samples H22, H24, H26, H35, H38, H39, H40. Well 17 have another positive control that is the ATCC7644.

PCR products:

2000

1800

1600

1400

1200

1000

800

700

600

500

400

300

200

100

50

Hly gene:

6

7

8

10

9

11

12

4

3

2

1

F:\hanaa.jpg

Figure4: showing bands of PCR products of hly gene

5

4

3

2

1

≈ 273-275 kbp. C:\Documents and Settings\adadasd\My Documents\My Pictures\Picture\Picture 006.jpg

Figure5: showing bands of PCR products of hly gene

Figure1 and 2 shows the PCR products run on a 1.5% Agarose gel. The bands show that they are of 273 to 275 kilo base pairs for the hly gene.

Iap gene:

2000

1800

1600

1400

1200

1000

800

700

600

500

400

300

200

100

50

15

16

14

13

12

11

10

9

8

7

4

2

3

5

6

1

Figure6: showing bands of PCR products of iap gene

Figure 3 shows the PCR products run on a 1.5% Agarose gel. The bands demonstrate are of approximately 330-350 kilo base pairs for the iap gene.

I-inlDC locus:

For the I-in1Dc locus no bands appeared while using the primer li-inlD4> & li-emr5<.

Discussion:

The main aim of this study is to assess the genetic diversity of Listeria Monocytogenes. However, it includes also the isolation of Listeria Monocytogenes from ready to eat food in this case chicken ham was chosen by observing the trend of the positive result obtained from another study done on the "detection of Listeria Monocytogenes in ready to eat foods in Mauritius." The isolation of the bacteria was done by the traditional method and using the PCR method confirmation and assessing the genetic diversity was done.

Only 13 samples turned out to be positive out of 40 samples collected in almost all the most visited hypermarkets and supermarkets in the island. The positive result was acknowledged by the grey green color of the colonies surrounded by a black halo on PALCAM agar. By undergoing a gram staining test, the positive result was confirmed. The colonies appeared as rod shaped and violet in color demonstrating the characteristics of listeria spp. However, it becomes difficult to differentiate between Listeria Monocytogenes and the other species such as L.ivanoii in the genus of Listeria since all the Listeria spp are rods and gram positive and form grey green colonies on the PALCAM agar. Therefore confirmation of the isolates to be listeria Monocytogenes by the traditional method is improper and time consuming.

Therefore to continue with the confirmation test and assessing the genetic diversity, PCR methods are used. Specific primers which amplify unique regions in listeria Monocytogenes were used. The purity of the DNA obtained plays a major role in the PCR products obtained. Hence the method of DNA extraction is necessary. In this study the use of lysozyme was made, since listeria Monocytogenes is a gram positive bacterium its cell wall is thicker and more extensive than gram negative bacteria (Mahalanabis.M et al., 2009). The use of lysozyme in the experiment also increases the yield of the DNA. The bands obtained on the 1.5% Agarose gel shows little smear which implies that the DNA is not highly contaminated. The sample from well 3 to 8 shows no smear present that demonstrate the purity of the DNA extracted. Sample in well 10 to 16 shows some smears implying that the DNA is not as pure as it should be. This is due to contamination that may have occurred during the extraction procedure. These contaminations may be due to protein, phenols or RNA. Through a gel electrophoresis a comparison of the quantity and concentration of DNA present in each sample. (Grody .W.W. et al., 2010).

The DNA extracted was used for the PCR reactions using specific primers that are specific to genes such as hly, iap and the I-inlDC locus. The hly and iap gene codes for the pathogenicity and virulence respectively. The I- inlDC locus codes for internalins in the cell wall of the bacteria. The PCR products obtained with the hly primer were run on a 1.5% Agarose gel to be able to evaluate the result. The gel shown in the result section figure…. demonstrate that all bands obtained are of 273 to 275 kilo base pairs. According to Koo and Jyakus (2003) the band should be of 273 kilo base pair. A positive control ATCC7644 was also amplified so as to ensure that the isolates obtained are really listeria Monocytogenes. A negative control that produced no bands at all show that the PCR reaction mixed prepared was not contaminated by any inhibitors. All the isolates produced common bands at 273 to 275 kbp .The 273-275 kbp bands also confirms that species are listeria Monocytogenes and not from other species of listeria.

The PCR products for the iap primer were run on a 1.5% Agarose gel to be able to estimate the result. The gel shown in the result section figure…. gave bands of about 330 kbp. A positive control namely ATCC7644 was also amplified so as to ensure that the isolates obtained confirm listeria Monocytogenes. A negative control of the reaction mix was also present which didn't produce any bands. This demonstrates that the reaction mix was free from contaminants. Contaminant in a reaction mix can be dead or alive cell. They may influence the reaction and produced bands that render the result bias and hence giving false conclusion. From the gel electrophoresis, the result obtained shown that all the isolates had common bands with the positive control that confirms the presence of listeria Monocytogenes and not any other species of listeria.

The PCR products of the li-inlD4 & li-emr5 primer were run on a 1.5% of Agarose gel to be able to assess the result obtained. Surprisingly no bands were obtained in the reaction with an annealing temperature of 45°C. Moreover, attempts for an optimization of the conditions were done with no efficient effect. The 1st attempt was to maintain all the conditions with the only change made was to increase the annealing temperature that is from 45°C to 50°C. The 2nd attempt was to maintain each condition and decreasing the annealing temperature down to 42°C. The 3rd attempt was to increase the concentration of MgCl2 1.0mM. The 4th attempt was to use both primers separately although they were reversed and forward primers. However, no expected bands of 1200 kilo base pairs were obtained. The positive control also did not have any result.

The primer li-inlD4 & li-emr5 did not yield any PCR products. Varying the annealing temperature according to the optimum temperature 45°C (Schmid.M.w, 2004) can be a possible measure to improve the PCR products. Varying the concentration of MgCl2 is one of the measures to enhance the result of a PCR reaction. (Thermo scientific PCR guide). According to the troubleshooting guide for PCR of Fermentas life sciences, the annealing temperature should be increased by 1°C to 2°C.

Conclusion& recommendation:

In relation to the result obtained with the amplification of the hly and iap primer, show that the isolates obtained is listeria Monocytogenes. Therefore we can conclude that the isolation steps were well followed. However, the genetic diversity of the bacteria could not be assessed due to unavailability of results of the amplification of the I-inlDC locus. More optimization about the annealing temperature can be done since according to the Fermentas life sciences optimization of the annealing temperature should be an increment of 1°C to 2°C. The Restricted Fragment Length Polymorphism techniques, Random Amplified Polymorphic DNA (RAPD), Amplified Polymorphic Length Polymorphism (AFLP), microsatellites, are tools that can be used to assess genetic diversity of the bacteria. (Somasundaram. S.T. & Kalaiselvam. M)

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.