Liposomal Delivery Of Trim5alpha Peptide Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Rhesus has been reported to restrict the infection of HIV-1 virus, showing less viral resistance. However, the human Trim5 alpha protein has less function in restriction of HIV-1 infection. It was reported that the removal of 332 Arginine in the protein sequence of human Trim5alpha can increase its antiretroviral effect. In this study, we use liposome as a delivery form of this protein and explore the antiretroviral effect of both isolated rhesus Trim5alpha protein and the recombinant human Trim5-alpha protein without 332 Arginine, in order to optimize the delivery of antiretroviral Trim5 alpha as a potent treatment of HIV-1 infection.

Specific Aims:

To compare the anti-retroviral effect of isolated rhesus Trim-5-alpha proteins with human Trim5 alpha proteins not containing 332Arginine on HIV-1 infection.

To explore the efficient delivery form for Trim5-alpha protein in human dendritic cells by using liposome as the carrier.

Background and Significance:

Human immunodeficiency virus (HIV), a lentivirus belonging to the retrovirus family, leads to acquired immunodeficiency syndrome (AIDS),[1][2] resulting in the decrease in immune functioning and life-threatening infections. HIV infection in humans is considered increasingly pandemic by the World Health Organization (WHO). It was reported in 2006 that HIV infected about 0.6% of the world's population. According to current estimates, HIV infects 90 million people in Africa.

HIV infects primarily vital immune cells of human beings such as helper T cells, (specifically CD4+ T cells), macrophages, microglial cells and dendritic cells.[3] HIV-1 entry to macrophages and CD4+ T cells is mediated through interaction of the virion envelope glycoproteins (gp120) with the CD4 molecule on the target cells and also with chemokine coreceptors.[4] When CD4+ T cell numbers decline below a critical level, cell-mediated immunity is lost, and the body becomes progressively more susceptible to opportunistic infections.

Most untreated people infected with HIV-1 eventually develop AIDS,[10] and mostly die from infections or malignancies associated with the progressive failure of the immune system.[11] Treatment with anti-retroviral drugs increases the life expectancy of people infected with HIV-1. ART reduces both the mortality and the morbidity of HIV infection, but the resistance to ART is increasingly to be problematic in its functioning in HIV medications.

HIV is made up of two copies of positive single-stranded RNA enclosed by a conical capsid. The single-stranded RNA is tightly bound to nucleocapsid proteins and enzymes for the development of the virion such as reverse transcriptase, proteases, ribonuclease and integrase. To ensure the formation of the particle, a matrix composed of the viral protein p17 around the capsid.

It is rounded by the viral envelope made up of two layers of molecules called phospholipids from the membrane of a human cell. Proteins embedded in the envelope are from the host cell and about 70 copies of a complex HIV protein that protrudes through the surface of the virus particle. The protein, known as Env, contains a cap made of three molecules called glycoprotein (gp) 120, and a stem consisting of three gp41 molecules that anchor the structure into the viral envelope. [4]

The RNA genome is made up of at least seven structural landmarks and nine genes (including gag, env, tat, rev, nef, vif, vpr, vpu) encoding 19 important proteins. Especially, gag and env are genes which contain information needed to make the structural proteins for new virus particles.

Tripartite motif-containing protein 5α belongs to the TRIM protein family, which was first intruduced by Reddy in 1992. The proteins contain a RING finger zinc binding domain, a B-box zinc binding domain, followed by a coiled-coil region.[8] TRIM5α bears the C-terminal PRY-SPRY or B30.2 domain in addition to the other domains.

TRIM5 is also known as RING finger protein, which is a protein that in humans is encoded by the TRIM5 gene. [7] Its alpha isoform, TRIM5α, is a retrovirus restriction factor, which mediates species-specific, early block to retrovirus infection.

TRIM5α is composed of 493 amino acids which are found in the cells of most primates. TRIM5α is an intrinsic immune factor which is important in the innate immune defense against retroviruses.

When a retrovirus enters a host cell's cytoplasm, it processes capsid uncoating and reverse transcription. TRIM5 in the cytoplasm recognizes motifs within the capsid proteins and interferes with the uncoating process, therefore preventing reverse transcription and transport to the nucleus of the viral genome.[9][10] As a result, capsid protein from restricted viruses is degraded by proteasome.[11]

Restriction by TRIM5a starts with physical recognition of retroviruses by TRIM5a proteins. [12,13] This interaction occurs within the first hours after virus entries[14], and involves determinants present in the N-terminal domain of the capsid proteins that constitute the retroviral outer core structure.[15-17] After this initial contact, progression of the retroviral life cycle is impeded through a few mechanisms and viral cores possibly undergo the accelerated uncoating process. [13,18,19]

In the end, TRIM5a interferes with the transportation of post-entry retroviral complexes toward the nucleus of the host cells, and this antiviral activity is independent. [20,21] Since retroviral replication is inhibited in the cytoplasm in the first hours of the infection, successful restriction by TRIM5α is hoped to completely prevent transcription of viral genes from either integrated or unintegrated viral complementary DNAs in the nucleus. Besides, TRIM5α contains a C-terminal PRYSPRY domain (which is also called SPRY or B30.2)[22] that is the only determinant of restriction specificity.[23] PRYSPRY, however, is the most variable domain of TRIM5α, containing four highly variable

Old World monkeys are not infected with HIV-1, the virus which causes AIDS in humans; but they can be infected with SIV, another subtype of related virus. TRIM5α isolated as a rhesus macaque protein was responsible for blocking infection of HIV-1. [24] The human version of TRIM5α didn't target HIV-1, but can inhibit the muriue leukemia virus (MLV)[25][26] and equine infectious anemia virus (EIAV).[27][28]

Localization of Arg332 and Arg335 in the structure model for the TRIM5ahu PRYSPRY domainThe "specificity" in the restriction, whether a given retrovirus can be targeted by TRIM5α, is completely determined by the amino acid sequence in the C-terminal domain of the protein, which is called the B30.2/ PRY-SPRY domain.[29] It is discovered that amino acid 332, which occurs in this domain, probably plays a critical role in defining the specificity of retrovirus restriction.[30][31]

Studies on human and Rh recombinant TRIM5 have shown that the determinant part of the species-specific restriction against HIV-1 infection relates to the variable region 1 (V1) of the SPRY domain [32,33]. A study comparing human and Rh TRIM5 showed that a single change from arginine (R) to proline (P) at the 332nd position of the V1 of human TRIM5 support the potent restriction ability against HIV-1. In the development of researches in human immunodeficiency virus type 2 (HIV-2) infection, on the other hand, people found that three amino acid at the 339th to 341st positions of Rh TRIM5α V1 are dominant for restricting particular HIV-2 strains still resistant to CM TRIM5α [34].

Moreover, Cyclophilin A is known to be important for the function of inhibiting HIV-1 by TRIM5α. Among New World monkeys, CypA is possessed as a fusion protein with TRIM5 (TRIMCyp). CypA can bind to the CA of HIV-1, and thus the TRIMCyp expressed in owl monkey cells can recognise the HIV-1 core,probably the Gag protein domain, and shows an anti-HIV-1 effect. Disruption of CypA-CA interaction decreases HIV-1 susceptibility in human cells [35,36, 37-41], with the block occurring early, at the time of reverse transcription [36]. These data showed the possibility that, by binding to CA, CypA protects HIV-1 virus against antiviral restriction effect in human cells [42,43].

Liposomes are applied to drug delivery because of their unique properties. The liposome encapsulates a region on aqueous solution inside the hydrophobic membrane, and thus the dissolved hydrophilic solutes cannot quickly pass through the lipids. Hydrophobic chemicals can be dissolved in the membrane, and in this case liposome can carry both hydrophobic molecules and hydrophilic molecules. To deliver the molecules to sites of action, the lipid bilayer can fuse with other bilayers such as the cell membrane, thus delivering the liposome contents. There are three types of liposomes - MLV (multilamellar vesicles) SUV (Small Unilamellar Vesicles) and LUV (Large Unilamellar Vesicles). These are used to deliver different types of drugs.

In drug delivery, liposomes can be made in a particular size range and become viable targets for natural macrophage phagocytosis. These liposomes may be digested while in the macrophage's phagosome, thus releasing the drug.

Dendritic cells (DCs) are differentiated from monocytes in certain cytokine environments. DCs can bridge the innate and adaptive immune responses. DCs are divided into three major subtypes: myeloid DCs, plasmacytoid DCs (pDC), and Langerhans cells. DC life-span and survival are highly dependent on the anatomical locations, as well as the DC subtypes. In general, their half life is up to a few weeks, and they can be replaced through proliferating hematopoietic progenitors, monocytes, or tissue resident cells. It has been shown that productive HIV-1 replication occurs in human monocyte-derived DCs for up to 45 days [44]. DCs may survive longer within the lymph nodes due to cytokine stimulation in the microenvironment, which may help spread HIV-1 infection and maintain viral reservoirs.

Preliminary Studies:

It was reported that TRIM5α inhibits HIV-1 replication through the degradation of HIV-1 protein Gag.[45]

Of the common protein-altering SNPs, only one (H43Y) was found to modulate activity against retroviruses in vitro; in this case, the 43Y allele weakens TRIM5α restriction [46].

It was demonstrate that the potentiation of HIV-1 inhibition results from the removal of a positively charged residue at position 332 of TRIM5hu[47].

Design and Methods:

Generation of monocyte-derived dendritic cells

Monocyte derived dendritic cells (Mo-DC) were prepared from blood obtained from healthy and HIV-1+ donors according to the method described previously [48]. Briefly, peripheral blood mononuclear cells isolated from blood were seeded and incubated at 37 â-¦C, 5% CO2 for 2 h. The supernatant containing non-adherent cells was replaced with fresh culture media containing 50 ng/ml hGM-CSF and 50 ng/ml hIL-4 and the adherent cells further incubated at 37 â-¦C, 5% CO2 to differentiate peripheral blood mononuclear cells into Mo-DC. Cultures were harvested by gentle pipetting on day 6 or 7 and washed twice in culture media before the use.

Peptide synthesis

2.1 RT-PCR

RT-PCR is performed as previously described[47]. Generally, total RNA was extracted from rhesus macaque CD4+ T lymphocytes and cDNA was prepared using SuperScript III Reverse Transcriptase. Quantitative polymerase chain reaction(PCR) was performed in duplicate on 1 μL of cDNA on a LightCycler. The TRIM5α primer pair was defined to amplify both human and rhesus macaque TRIM5α cDNA: TTGGATCCTGGGGGTATGTGCTGG (forward) and TGATATTGAAGAATGAGACA GTGCAAG(reverse). TRIM5α primers were: CATTATCATCAGCCACCCTGTGG (forward) and GGAGAATCATAAATCTTAAAACACGAG(reverse).

PCR products were cloned directly into the vector. 6 to 15 independent cDNA clones from individual rhesus monkeys were applied to automated sequence analysis. Genomic DNA was isolated from lymphocytes from the same cohorts of rhesus monkeys, and then sequenced.

2.2 Peptide Preparation and purification

According to previous studies, [47][49], plasmids expressing TRIM5 hu with single-amino-acid changes were created by QuikChange mutagenesis. In the definition of ΔR332 mutant of TRIM5αhu, arginine 332 is deleted.

As a source of TRIM5 protein, 1 million 293T cells seeded in a six-well plate were transfected with 1 μg of the pLPCX-TRIM5 plasmid. 48 hours later, the cells were harvested in phosphate-buffered saline(PBS) containing 5 mM EDTA and then re-suspended in 250 μl of hypotonic lysis buffer (10 mM Tris-HCl, pH 8.0, 10 mM KCl, 1 mM EDTA) and placed on ice for 15 min. The cells were lysed by homogenizer, and the cell debris was discarded after centrifugation at 4°C for 10 min in an Eppendorf microcentrifuge.

Conjugation of fluorescein isothiocyanate to Trim5alpha or tetanus toxoid

Usng fluorescien isothiocyanate for tracking and analyzing, as previously described[51], a total of 20 mg of fluorescein isothiocyanate (FITC) was dissolved in 10 ml of carbonate buffer pH 9.5 with isolated TRIM5αrh and Δ332TRIM5αhu, separately. The mixture was gently mixed in the dark at 4 â-¦C for 18 h. Buffer salts and unbound FITC were removed with repeated dilution with water and then ultrafiltration using a 10,000-molecular weigh cut-off membrane in a 50ml cell pressurized to 200 kPa. The resulting FITC-TRIM5α(both human and rhesus) or FITC-tetanus toxoid (FITC-TT) solution was dried, freezed and finally stored avoiding light at 4 â-¦C. Before use, the protein was analysed for the existence of free FITC by ultra-centrifugation of an aqueous solution through a 10,000-molecular weight cut off filter unit. Unbound FITC should contribute less than 1% of total fluorescence in all cases.

Mass spectrometry.

Based on previous research[47], both rhesus and 332-Arginine-deleted human TRIM5α proteins were desalted for electrospray ionization mass spectrometry and analyzed by a mass spectrometer. Spectra were combined, and the multiply charged molecular ions were de-convoluted into a molecular-mass spectrum.

Liquid chromatography tandem mass spectrometry experiments were performed to test the posttranslational modifications of both TRIM5αrh and Δ332TRIM5αhu expression.

Peptide molecular masses were measured by transform ion cyclotron resonance, and peptide sequencing was operated by collision-induced dissociation in the linear ion trap of the instrument. Protein identification and post-translational modifications (such as phosphorylation and ubiquitylation) of peptides were determined and the NCBInr mammalian taxonomy database using a significance threshold of P< 0.05 with an ion score cut-off value of 20.

Liposome preparation

The preparation is performed according to previous description[50]. As it was described, a total of 100 mg of phosphatidylcholine (PC) was solubilised in 10 ml chloroform and 1ml methanol within a 300 ml round bottomed flask and dried under vacuum at 45 â-¦C to produce a thin lipid film. Lipid films were stored overnight at 4 â-¦C, to facilitate removal of residual solvent. 2ml of Hepes buffer (pH7.4) or 2ml Hepes buffer containing FITC-TRIM5αrh orFITC-Δ332TRIM5hu or 5 mg/ml FITC-TT and 45 mg/ml TT was added and multilamellar vesicles prepared by hand shaking. Mannosylated liposomes were prepared as described above, with replacing 20 mg of PC with trimannose- dipalmitoylphosphatidylethanolamine (man3-DPPE). Negatively charged liposomes were prepared by replacing 11.6 mg of PC with the equivalent weight of phosphatidylserine. Liposome dispersions were decreased by size and lamellarity by 10 cycles of high-pressure extrusion through two 400 nm filters and a 10 ml extruder pressurized with nitrogen. Removal of unentrapped peptide was performed by twice diluting the dispersion in Hepes buffer, following with centrifugation and re-dispersion of the liposome pellet.

Flow cytometric analysis of uptake

The analysis of uptake is performed as previously described[51]. Generally, Mo-DC were incubated with TRIM5α(both rhesus and modified human protein) for 24 h. Additional cells were incubated for baseline measurement. Expression of markers was evaluated by incubating cells with saturated concentrations of the respective PE lined antibody (MHC-II) for 30 min at 4 â-¦C. The cells were washed and measured by flow cytometry. Appropriate isotype controls were included in all experiments and there is no significant non-specific binding.

For any difference in fluorescence because of the variations in formed FITC-TRIM5α content of the formulations, the mean fluorescence intensity of the FITC related to the cell population (MFIFITC) was measured and adjusted for the specific FITC-TRIM5α content of the formulation used.

For analysis of the level of expression of the various surface activation markers, the mean fluorescence intensity of the PE (MFIPE) regarding to the antigen-exposed cell population was identified as a percentage of the MFIPE of the control population. The surface marker which is highly expressed by the cells was also measured as a control.

Assays for primed T cell proliferative responses and characterisation of T cell subsets

According to previous study[51], Mo-DC pulsed with liposomes for 2h. Cells were washed twice and added to TT-primed T cells set up in triplicate. The ratio of Mo-DC to T cells remains 1:10. The cultures were incubated at 37 â-¦C for 3 days and cell proliferation was measured by measuring incorporation of tritiated thymidine solution (3H-TdR) following a 16 h pulse. The ratio of CD8+ to CD4+ T cells after the 3 day incubation was analysed in non-tritiated cultures by labelling with CD4 FITC conjugate/CD8 PE conjugate cocktail followed by FACS analysis.

Transmission electron microscopy analyses.

For transmission electron microscopy analyses, we incubate binding reactions with healthy DCs and infected DCs, both of which contain TRIM5α (TRIM5rh and Δ332TRIM5hu) liposomes. Carbon-coated grids were used on aliquots of each reaction mixture (7 μl, 90 s), washed with 3 drops of 0.1 M KCl, stained with 3 drops of 4% uranyl acetate, and air dried. We then image samples on transmission electron microscopes at magnifications between 25,000 and 100,000. Each electron microscopic analysis was repeated three times.

Data Analysis

The antiviral effect, based on analysis of conjugation with Gag protein and the production of immune response, was compared between rhesus and modified human TRIM5α proteins. T-test is used and a p value <.05 is considered as significant.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.