0115 966 7955 Today's Opening Times 10:00 - 20:00 (BST)
Banner ad for Viper plagiarism checker

Insertion of L. hesperus TuSp1 Gene into B. mori

Published: Last Edited:

Disclaimer: This essay has been submitted by a student. This is not an example of the work written by our professional essay writers. You can view samples of our professional work here.

Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of UK Essays.

Research Plan Detailing the Insertion of L. hesperus TuSp1 gene into B. mori

Team 5: Riley Capizzi, Mingming Li, Jia Mikuls, Sarah Mrozek, Eric Nagarajan, Chandini Nair, Nate Payne, Matt Smith, Evan Templeman; 7 May 2014

Introduction:

Figure 1. TuSp1 molecular structure (Solution structures of TuSp1 domains).

The amino acid sequence of the TuSp1 gene contains a signal peptide at the N terminus that is adjacent to the NTD non repetitive sequence. There is also a non repetitive sequence at the C terminus (CTD). Linked to the CTD there is a RP2 type two repetitive sequence. Also present are 20 identical type 1 repetitive sequences ( RP1). Pictures A-H represent the different TuSp1 gene domains. Pictures A-D represent NTD, RP1, RP2 and CTD domains respectively. Pictures E-F represent and the hydrophobic and charged surfaces of NTD, RP1, RP2 and CTD respectively. The color code is blue for positive charge, yellow for hydrophobic, red for negative charge, and white for a neutral surface. The hydrophobic patches are circled in black. Micelle like structures, essential intermediates in silk formation, are formed by more hydrophilic terminal domains that are covalently linked with one or more repetitive domains. The less hydrophilic domains dictate the actual assembly of the protein. The structural transition and fiber formation mechanisms have not been found over a multitude of studies; thus, indicating more research on this topic is needed (Lin et al. 2009).

The objective of our experiment is to create a stronger, more durable and elastic silk product by genetically modifying silkworms (Bombyx mori) to express the egg case silk of the Western Black Widow spider (Latrodectus hesperus). Eggs from B. mori will be extracted, fertilized and the original silkworm silk protein, P25, will be silenced via CRISPR/Cas9. The TuSp1 gene will be extracted from L. hesperus, ligated with the promoter for the P25 gene and then inserted into a fertilized B. mori zygote via microinjection. This modification will create a line of B. mori offspring that, upon maturity, will produce egg sac silk from L. hesperus. The mechanical properties and the assembly of the spider egg case silk is due to TuSp1 because it is the main protein constituent (Figure 1). TuSp1 was the desired gene due to its role in the L. hesperus egg case silk which is both elastic and robust. The Tubuliform fibers that are products of TuSp1 expression have a serine- rich and glycine- poor amino acid composition that is responsible for the increased strength and lower tensile stiffness (Garb & Hayashi, 2005). Therefore, the introduction of the TuSp1 gene is intended to greatly increase the strength, durability, and elasticity of silkworm silk (Hu et al. 2006). The silk produced may be used for a variety of biomedical and commercial purposes including, but not limited to creating tendons, improving textiles, and developing more resilient bullet-proof vests (Omenetto & Kaplan, 2010; Altman et al. 2003).

Gene Isolation and Amplification:

Figure 2. Plasmid with Inserts The plasmid that will be inserted into the B. mori eggs. Above in red is shown the selectable marker that will be used which is flanked by its promoter and terminator in green. The region inserted is emphasised on this picture by the black partial inner ring. This region consists of the P25 promoter and the TuSp1 gene, which will be added separately using the restriction enzyme cut sites displayed on either side of the respective segment.

In order to accomplish our goal, we will first isolate usable amounts of the coding sequence of the TuSp1 gene (2.5kb) from L. hesperus. We will do this using the PCR technique with the Taq PCR Kit (New England BioLabs). This requires the use of primers that will compliment a segment of DNA a short distance before the gene’s coding sequence on the leading DNA strand and another that compliments the segment some distance on the far side of the gene on the lagging strand. These primers will be synthesized with “Invitrogen ™ Custom DNA Oligos kit”(Life Technologies). The forward primer that we will use is as follows: 5’GCG(TCTAGA)CCGCTGTTGGTCAAGTAGGTTATC3’. The bases inside the parentheses indicate the cut site where the restriction enzyme XbaI will be used later to bind the TuSp1 gene to the P25 promoter, which is necessary to express the inserted gene in the silkworm. The intended reverse primer is: 5’GCAATCGGAGCATTCAATGAAG(CCGCGG)GCG3’. Likewise, the sequence within the parentheses represents a cut site. This site will be cut by the SacII enzyme and will be used to permanently ligate the TuSp1 gene to the WDOW1 plasmid.

Similarly, the promoter of the P25 gene (441 bp) will also be isolated using a PCR technique. This segment will be amplified using the 5’GCG(GCGGCCGC)ATACTAGCTGACCCGGCAGAC3’ forward and 5’TGTCTAGCTGTAGCCGCTGTG(TCTAGA)GCG3’ reverse primers. Our intended forward primer contains the NotI cut site in parenthesis and it will ligate the promoter to the WDOW1 plasmid. Our intended reverse primer has the XbaI cut site in parenthesis and that will be used to ligate to the TuSp1 gene.

The PCR products will be verified using gel electrophoresis to observe the sizes of the resulting DNA segments. The TuSp1 gene is expected to be about 2.5 kb long and the P25 promoter is expected to be about 450 base pairs long. Each of the PCR products will then be purified using a purification kit purchased from “MinElute PCR Purification Kit”(Qiagen).

Our next step is to insert both the promoter and gene into a plasmid (Figure 2). For this purpose the plZ-Flag6His-Siwi plasmid (Addgene) will be adapted into what we will call WDOW1. For best results we will insert these segments one at a time. First the P25 promoter using the previously mentioned restriction enzymes will be ligated to the plasmid. The TuSp1 gene will be similarly inserted using its associated restriction enzymes and ligated. We will then transform E. coli with the WDOW1 plasmid and grow the cultures in a medium containing Bleomycin, which is the selectable marker found on our plasmid. The cultures that grow will be isolated and the plasmid will then be extracted for further use.

CRISPR/Cas9:

Figure 3. CRISPR Cas9 Enzyme (RGENs (RAN Guided Endonucleases))

Simplified representation of the use of CRISPR to target a specific DNA sequence. This is performed using gRNA, showed by the green segment above. The gRNA binds to a specific sequence of 20 bases. The targeted sequence must be followed by the PAM site depicted in pink. The gRNA binds only at the desired site that is found in the P25 coding sequence and subsequently the bound Cas9 enzyme then cuts through the targeted DNA. The cell then attempts to repair the broken DNA strand, resulting in a base shift mutation that will render the gene inactive (Guo et al. 2014; Cheng et al. 2013).

Figure 4. CRISPR Plasmid The plasmid containing the coding information necessary for the CRISPR technology. In red is depicted the coding region for the DNA cutting enzyme Cas9 as well as the gRNA that will guide it to the appropriate location on the DNA strand. This region is preceded by a Ribosomal Binding Site (RBS), that will ensure encoding will take place upon insertion, and followed by a terminator. The origin of replication is an E. coli specific site. This will prevent the plasmid from continuing to be present during later stages of development.

In order to silence the existing P25 gene present in the posterior silk glands of B. mori a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) technique will be used (Ma et al. 2014).The function of CRISPR technology in this experiment is to inhibit the production of mRNA from the P25 gene by blocking the transcription of the gene (Makarova et al. 2011). Once the DNA is cut the cell will make a repair that will result in a base shift mutation that will render gene inactive. Once the P25 is silenced in the B. mori eggs then, after maturation and reproduction, the offspring will also have a silenced P25 gene. This heritability of chromosome and genetic modification has been shown in silkworms with chromosomal deletions (Ma et al. 2012).

For this technique we will use a separate bacterial plasmid, pwtCas9-bacteria (Addgene) which will be adapted into the WDOW2 plasmid, which will decompose after the P25 gene has been knocked out. This plasmid will be modified to target the DNA sequence: 5’ATTCGCGCAACATGCTGGCG3’, which is present only at the beginning of the P25 coding sequence. This plasmid was also selected because it uses a RBS as the promoter to create the gRNA and Cas9 enzyme. The gRNA will guide the Cas9 into the correct position where it will cut through the DNA strand (Figure 3). The plasmid cannot be replicated by B. mori because it has an E. coli specific origin of replication (Figure 4). The fact that the plasmid cannot be replicated means that it will only be present temporarily, but the use of a RBS ensures that it will be transcribed while it is there. This will result in the presence of the CRISPR enzyme, and subsequent deactivation of the P25 gene early on, but will allow the WDOW2 plasmid to decompose some time after its purpose is served.

Silkworm Egg Extraction and Fertilization:

A population of silkworm eggs (Carolina™) will be cultivated to produce B. mori larvae. B. mori eggs and sperm will be extracted and used for artificial insemination.

In order to begin the process of inserting the TuSp1 gene into the silkworm genome, the first step is the extraction of the B. mori eggs. Silkworm larvae will first be anesthetized by cooling on ice. Then small incisions will be made on the eighth segment of the body and the ovaries will be extracted (Mochida et al. 2003). The eggs will be removed from the ovaries and stored at -20 o C until use (Kageyama & Takahashi, 1990). Similarly, sperm from B. mori males will be extracted and isolated from surgically extracted from ruptured seminal vesicles (Takemura, Kanda & Horie, 2000).

After extraction of the egg and sperm, the egg will be artificially inseminated in vitro and will be grown in conditions ideal for silkworm development (Tan et al. 2013). In this process a 50μl capillary tube is used to dispense the semen into the extracted unfertilized egg (Takemura, Kanda & Horie, 2000). Promptly after fertilization, before the cells have differentiated, the WDOW1 and WDOW2 plasmids will be combined into a single solution and microinjected into the egg so that the plasmids are incorporated into all of the cells of the developing silkworm (Thomas et al. 2002).

Microinjection and Determining a Successful Experiment:

Microinjection is the delivery method in which the gene of interest and the CRISPR technology necessary for gene knock out will be introduced into the B. mori fertilized eggs before cell differentiation occurs. Gene insertion via microinjection has been previously proven to be successful for the introduction of genes of interest into B. mori (Thomas et al. 2002). Furthermore, precedence of the insertion of plasmids into B. mori can be found in work done on transgenic silkworm Bombyx mori L (Nikolaev et al. 1993).

The fertilized eggs will be placed on a plastic sheet that will be glued into a Petri dish. Using glass needles, a solution containing both the WDOW1 and WDOW2 plasmids will be injected into cell nuclei on the dorsal posterior third of the egg. The microinjection will allow for TuSp1 to be introduced into the cells DNA so when the cells undergo meiosis and mitosis, TuSp1 will be replicated throughout all the cells (Thomas et al. 2002).

Typically, the P25 gene is found in all of the cells in the organism; however, the gene is exclusively expressed in roughly 500 cells of the organism’s posterior silk gland. This localization of gene expression is due to the fact that the posterior silk gland is the only region where both of the two silk gland specific factors, SGFB and PSGF, are present for promoter activation. SGFB and PSGF are cis- acting elements that are placed ahead of a non- P25- related basal promoter and they are necessary to drive the transcription of the P25 gene (Horard et al. 1997). After microinjection, the TuSp1 gene will be present in all the cells of the offspring, but will only be expressed in the posterior silk gland cells due to the presence of silkworm specific factors SGFB and PSGF in these cells. The WDOW2 plasmid will initially be present in all the cells of B. mori as well, but this will be temporary, as was explained earlier. Inspite of this, its effect of knocking out the P25 gene will remain not only throughout the silkworms lifespan, but in the descendants of our modified B. mori population (Ma et al. 2012).

A negative control will be carried out in which the fertilized B. mori eggs will be subjected to CRISPR technology in order to knock out the P25 gene, but there will be no microinjection of the TuSp1 gene. The purpose of this negative control is to confirm the CRISPR technology is successfully knocking out the P25 gene in the fertilized eggs. The expected result from eggs under negative control would be silkworms that do not produce silk, due to the inhibited P25 protein gene and no microinjection of the TuSp1 gene.

Works cited:

Altman, G. H., Diaz, F., Jakuba, C., Calabro, T., Horan, R. L., Chen, J., Kaplan, D. L. (2003).

Silk-based biomaterials. Biomaterials, 24(3), 401–416. doi:10.1016/S0142-9612(02)00353-8

Cheng, A. W., Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., … Jaenisch, R. (2013). Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Research, 23(10), 1163–71. doi:10.1038/cr.2013.122

Garb, J. E., & Hayashi, C. Y. (2005a). Modular evolution of egg case silk genes across orb-weaving spider superfamilies. Proceedings of the National Academy of Sciences of the United States of America, 102(32), 11379–84. doi:10.1073/pnas.0502473102

Guo, X., Zhang, T., Hu, Z., Zhang, Y., Shi, Z., Wang, Q., … Chen, Y. (2014). Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis. Development (Cambridge, England), 141(3), 707–14. doi:10.1242/dev.099853

Horard, B., Julien, E., Nony, P., Garel, A., & Couble, P. (1997). Differential binding of the Bombyx silk gland-specific factor SGFB to its target DNA sequence drives posterior-cell-restricted expression. Molecular and Cellular Biology, 17(3), 1572–9. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=231883&tool=pmcentrez&rendertype=abstract

Hu, X., Kohler, K., Falick, A. M., Moore, A. M. F., Jones, P. R., & Vierra, C. (2006). Spider egg case core fibers: trimeric complexes assembled from TuSp1, ECP-1, and ECP-2. Biochemistry, 45(11), 3506–16. doi:10.1021/bi052105q

Kageyama, T., & Takahashi, S. Y. (1990). Purification and characterization of a cysteine proteinase from silkworm eggs. European Journal of Biochemistry, 193(1), 203–210. doi:10.1111/j.1432-1033.1990.tb19324.x

Lin, Z., Huang, W., Zhang, J., Fan, J.-S., & Yang, D. (2009). Solution structure of eggcase silk protein and its implications for silk fiber formation. Proceedings of the National Academy of Sciences of the United States of America, 106(22), 8906–11. doi:10.1073/pnas.0813255106

Ma S, Zhang S, Wang F, Liu Y, Liu Y, et al. (2012) Highly Efficient and Specific Genome Editing in Silkworm Using Custom TALENs. PLoS ONE 7(9): e45035. doi:10.1371/journal.pone.0045035

Ma, S., Chang, J., Wang, X., Liu, Y., Zhang, J., Lu, W., … Xia, Q. (2014). CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori. Scientific Reports, 4, 4489. doi:10.1038/srep04489

Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J. J., Charpentier, E., Horvath, P., … Koonin, E. V. (2011). Evolution and classification of the CRISPR-Cas systems. Nature Reviews. Microbiology, 9(6), 467–77. doi:10.1038/nrmicro2577

Mochida, Y., Takemura, Y., Kanda, T., & Horie, Y. (2003). Fertilized eggs obtained from transplantation of frozen ovaries and parthenogenesis in combination with artificial insemination of frozen semen of the silkworm, Bombyx mori. Cryobiology, 46(2), 153–160. doi:10.1016/S0011-2240(03)00021-X

Nikolaev, A. I., Tchkonia, T. T., Kafiani-Eristavi, C. A., Tarantul, V. Z.. (1993). Preferential extrachromosomal localization of exogenous DNA in transgenic silkworm Bombyx mori L. Molecular and General Genetics MGG. 236(2-3), 326-330. doi:10.1007/BF00277129

Omenetto, F. G., & Kaplan, D. L. (2010). New opportunities for an ancient material. Science (New

York, N.Y.), 329(5991), 528–31. doi:10.1126/science.1188936

‘RGENs (RNA Guided Endonucleases)’ [image], CRISPR/Cas 9 (RGEN), PNA Bio, viewed 15 April 2014,<http://pnabio.com/products/image/RGEN.jpg>.

‘Solution structures of TuSp1 domains’[image], Solution structure of eggcase silk protein and its implications for silk fiber formation, PNAS, viewed 7 May 2014, <http://www.pnas.org/content/106/22/8906/F2.expansion.html>

Takemura, Y., Kanda, T., & Horie, Y. (2000). Artificial insemination using cryopreserved sperm in the silkworm, Bombyx mori. Journal of Insect Physiology, 46(4), 491–497. doi:10.1016/S0022-1910(99)00135-3

Tan, A., Fu, G., Jin, L., Guo, Q., Li, Z., Niu, B., … Huang, Y. (2013). Transgene-based, female-specific lethality system for genetic sexing of the silkworm, Bombyx mori. Proceedings of the National Academy of Sciences of the United States of America, 110(17), 6766–70. doi:10.1073/pnas.1221700110

Thomas, J.-L., Da Rocha, M., Besse, A., Mauchamp, B., & Chavancy, G. (2002). 3×P3-EGFP marker facilitates screening for transgenic silkworm Bombyx mori L. from the embryonic stage onwards. Insect Biochemistry and Molecular Biology, 32(3), 247–253. doi:10.1016/S0965-1748(01)00150-3


To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Request Removal

If you are the original writer of this essay and no longer wish to have the essay published on the UK Essays website then please click on the link below to request removal:


More from UK Essays

We can help with your essay
Find out more