Inheritance Molecular And Biochemical Defects Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

In this essay the inheritance, molecular and biochemical defects of Familial hypercholesterolemia is going to be discussed. The first part of the essay will be a brief overview of the disease and its symptoms. The main component of the essay is going to cover the inheritance, typical pedigree and incidence of the disease. Then the molecular genetics of the disease along with the molecular biology and the molecular defects (i.e. the consequences of the mutation) will be explored. Methods of diagnosis and treatment of the disease will also be discussed, and then finally a conclusion which summarizes all the main arguments and points made in the essay.

Familial Hypercholesterolemia (FH) (#143890) is a genetic disease characterized by elevated LDL-Cholesterol (LDL-C), which deposits in the tissues causing the external disorders of the disease, such as tendinous and xanthomas and others. LDL-C deposits in the blood vessels leading to premature cardiovascular disease. FH is defined as an inherited autosomal dominant disease. The prevalence of the severe phenotype has an incidence of 1 in a million in the general population, compared to the much more common form which affects 1 in 500 people (Fahed & Nemer, 2011).

To inherit this condition the affected gene must only be on only one of the number 19 chromosomes. If someone inherits one copy of the mutated gene which causes the disease, they have heterozygous FH. This person has a 1 in 2 chance of passing the mutated gene on their children. A progeny with themutated copy from both parents they have what is called homozygous FH, and this is a more severe form of the disease compared to heterozygous FH. If this person has children then each of the children will have at least one copy of the mutated gene therefore they will all have at least heterozygous FH (WWW, Learning About Familial Hypercholesterolemia). The affected locus of FH #14390 # 606945 is at 19p13.2 and the gene/locus name is the Low density lipoprotein receptor (LDLR).

Familial Hypercholesterolemia is when there is a mutation in the LDL receptor gene, which causes FH to have a lack of functional hepatic receptors for the uptake of circulating LDL, leading to increased plasma LDL-C levels (Motazacker et al., 2012). When talking about Familial Hypercholesterolemia #143890#606945, the clinical features which will be discussed are to do with the phenotype 143890 and the 606945 gene of this particular type of the disease, of course there are many more phenotypes and genes that can cause Familial Hypercholesterolemia. People who are FH heterozygous develop cardiovascular disease ten years earlier than normal people, but people with FH heterozygous die of heart attacks usually before reaching their late 20's. (Lodish et al., 2012)

When a mutation in the LDLR gene occurs this causes the disease. There are known to be more than 1000 mutations which cause this particular defect for this phenotype and gene affected. The DNA of the defected LDLR gene must be analysed to see the nature of the gene defect and the mutations involved. Scientists in Mexico extracted genomic DNA from leukocytes and for the LDLR gene, in the proximal promoter region 18 exons and the respective flanking introns regions were amplified using the PCR (polymerase chain reaction) method. Mutations that were analysed by sequential methods were corroborated using PCR- REA, which were incubated with each endonuclease and was then put to electrophoresis on a 10% acrylamide gel which was stained with silver nitrate.

Sequencing analysis was performed to identify ADH-causing mutations in the LDLR genes. Mutations were identified in 38 (61%) cases. The frequency of xanthomas in the mutation-positive group was 45% (17/38), whereas this value was 17% (4/24) in the mutation-negative group. Based on sequencing analysis, a total of 25 mutations, 18 missense, 4 small insertion-deletions, 2 nonsense and 1 splicing, were identified . All the mutations were located in the LDLR gene. (Vaca et al., 2011)

There are over 1000 genetic variant mutations in the LDLR gene which can occur. The genes of the variants are frequently associated with Alu elements, which account for 65% of the LDLR intronic sequences and offer many opportunities for homologous recombination. Non-allelic homologous recombination can use repetitive sequences, such as Alu elements as homologous recombination substrates. Similar testing was carried out in Tunisia where two families one from the north of Tunisia and one from the south were tested to see the extent of mutation in the LDLR gene. The promoter, of 18 exons with the flanking intron sequences of the LDLR gene, was amplified by PCR. The genomic DNA was hybridized to target the 18 LDLR exons and the proximal promoter. After 16 hours of hybridization, the probes were ligated and amplified by PCR. The PCR products were separated on an ABI PRISM 3130xL sequencer and the data analysed with Coffalyser software. Afterwards a Long-range PCR was performed using the Expand Long Template PCR System Kit. Primers for the initial amplification of the exon 2-5 deletion were on forward sense ACTGCAGGTAAGGCTTGCTC (starting at genomic position 11 200 285), and on reverse sense CCGCTGTGACACTTGAACTT (starting at genomic position 11 218 110). Concerning the deletion of exon 5-6, the primers were on the forward sense ACGAGGAAAACTGCGGTATG and on the reverse sense: TTGTTGTCCAAGCATTCGTT). The genomic sequence of the LDLR gene was obtained from nucleotides 11,200,038-11,244,492 on chromosome 19. The final conclusion was that there were two major rearrangements in the LDLR gene. The first one was a homozygous deletion of exons 2-5 for subjects A.III-1, A.III-2, and B.II-1. Subjects A.II-1, A.III-3, B.I-1 and B.I-2 were heterozygous for this deletion of exons 2-5. The second rearrangement was a heterozygous deletion of exon 5 and 6 for patient A.I-1. The results of the exon deletion in these two families are shown below in the diagram of figure 2. (Jelassi et al., 2012)

Full-size image (62 K)

Fig. 2. MLPA analysis of the LDLR gene in families A and B.(A) Subjects A.III-2 and B.II-1, homozygous for the deletion of exons 2 to 5.(B) Subject A.II-2 and A.II-3, heterozygous for the deletion of exons 2, 3, 4, and 6 and homozygous for the deletion of exon 5

The analysis of the breakpoints showed that the deletions arose through Alu-Alu homologous recombination (Fig. 3) which is schematically shown below. For the deletion of exons 2-5, the Alu sequences involved were AluSp located in intron 1 at position 11,204,838-11,205,120; and AluSx in intron 5 at 11,217,515-11,217,805. For the deletion of exons 5-6 the Alu sequences involved were AluSx in intron 4 at 11,216,591-11,216,901and AluSz in intron 6 at 11,218,967-11,219,265. The novel Alu sequence is a 283 base pair AluSp sequence made of the last 214 base pairs of the AluSp in intron 1 and the first 69 base pair of the AluSx in intron 5. Therefore, these results show that the mechanism at the origin of these deletions is non-allelic homologous recombination (NAHR). (Jelassi et al., 2012)

Full-size image (66 K)<img

Fig. 3. Schematic illustration of rearrangements in the LDLR gene, including the DNA sequence of breakpoints and the ALU sequences involved.(A): deletion of exons 2 to 5, (B): deletion of exons 5 and 6. Alu sequences are shown with their monomeric subunits in different shades of gray. The genomic position of the Alu sequences and the breakpoints (ends of the deletions) are given. The homologous sequences involved in the recombinational events are delimited. The size of exons, introns and Alu sequences are not in scale. From (Jelassi et al., 2012)

Methods of diagnosis for familial hypercholesterolemia have been discussed such as electrophoresis and PCR. However simple methods such as genetic testing can be applied to see if a mutation in the LDLR gene has occurred. Clinicians have used mutation detection techniques like, denaturing HPLC, or direct Sanger sequencing for the detection of substitutions, small insertions, and deletions. To detect larger rearrangements, including exonic deletions, a process such as multiplex ligation-dependent probe amplification is needed (Hollants et al., 2012).

There are many different treatments that can be used to treat Familial Hypercholesterolemia. The first step in treatment for an individual who is heterozygous FH is changing the diet to reduce the total amount of fat eaten. This can be done by limiting the amount of beef, pork, and lamb, dairy products as well as organ meats. More regular exercise can help in lowering cholesterol levels. Drug therapy is necessary along with the other factors, as these may not be able to lower cholesterol levels alone. The drugs that can be used to affect which very effective choice are drugs called "statins." Individuals who have homozygous familial hypercholesterolemia need different treatment to control their high cholesterol levels. Sometimes drugs aren't affective to lower LDL cholesterol levels so these people may need l LDL apheresis, or surgery such as a liver transplant (WWW, Learning About Familial Hypercholesterolemia).

To conclude the main inheritance, molecular and biochemical defects of Familial Hypercholesterolemia are, that if your parents carry one or two of the mutated gene then it depends whether or not a person is heterozygous or homozygous for the disease. The main problem in this disease is that there is a mutation on chromosome 19, on the LDR receptor gene. This causes increased LDL-C and cholesterol levels which can lead to death in the early 20's. This problem is specifically for the 606945 gene and no other.

Word Count is 1529 words.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.