Influence Of Dietary Insufficient Protein Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

-Influence of dietary insufficient protein on gene-protein expression of neutral amino acid transport systems at peak lactation in sow mammary cells. The study was to determine the influence of dietary insufficient protein on plasma amino acid concentration in sows, visible mammary gland conformation, the expression levels of mRNA and protein of some neutral amino acid transport systems; System A; ATA2, System L; LAT2 and System ASC; ASCT1 in mammary tissues at peak lactation (d 18 of lactation). Eight multiparous lactating sows were provided restriction feed access to one of two isocaloric diets, each 4 sows for deficient and normal protein diet group (8 and 18 % CP, as-fed basis, respectively). The results showed that sows fed with deficient protein diet had significant decrease in plasma amino acid concentrations notably for neutral and cationic amino acids (p<0.05). The visible mammary gland conformation of sows fed with deficient protein diet seemed to be smaller when compared to those fed with normal protein diet. The quantitative mRNA expressions of ASCT1 and LAT2 were down regulated significantly (p<0.05) for sows fed with deficient protein diet when compared to those fed with normal protein diet. In contrast, that of ATA2 was not changed (p>0.05). Consequently, the protein expression levels of ATA2 and ASCT1 were not changed (p>0.05) but those of LAT2 was down regulated significantly (p<0.05) for sows fed with deficient protein diet when compared to those fed with normal protein diet. Therefore, the dietary protein level under peak lactation can regulate the different gene-protein expression of some neutral amino acid transporters in sow mammary gland.

Introduction

Dietary management of the lactating sow ensuring a diet sufficient in protein is an important factor to achieve the ability of the sows to produce adequate milk supporting the rapid growth of their litters. The main source of amino acids or protein of suckling piglets is found in sow's milk. Thus, diet of lactating sow need to be formulated to maximize milk production and maintain body condition throughout lactation. Insufficient amino acid requirements of the sows during lactation can lead to decrease milk production and litter weaning weights (King et al., 1993). The studies of Trottier et al. (1997) and Nielsen et al. (2002) reported that there were two different physiological mechanisms responsible for the appearance of amino acids in milk, namely mammary plasma flow and amino acid transport systems in mammary tissues. The level of dietary protein concentration is an important factor affected amino acid concentration in sow's milk via these two mechanisms (Guan et al., 2004a). As dietary crude protein (CP) increased from deficient protein (7.8% CP) to normal protein (18.2% CP) level, all essential amino acids taken up across mammary tissues were increased and reached maximum in sows fed with the normal protein diet, and decreased in those fed with the excess CP diet. The mammary arteriovenous difference of amino acids as amino acids which enter and leave the mammary glands (Trottier et al., 1995) was increased with increasing dietary CP concentration while the mammary plasma flow was not change (p>0.05). Consequently, the mechanisms responsible to directly increase the arteriovenous difference may possibly be through types of amino acid transport systems, expression and localization of amino acid transporters. Therefore, these assume that the amino acid transporter proteins may play the important roles on amino acid transport not only for sow's milk production but also milk composition and then affect their piglet growth.

The transportation of amino acids from mammary arterial plasma across mammary cells by amino acid transport systems is now recognized as an important mechanism of amino acid appearance in sow's milk. Amino acids, absorbed from the digestive system, do not permeate through cell membranes and therefore require specialized transport proteins in order to cross the cell membranes (Christensen, 1990). The lactating mammary gland takes up free amino acids from the blood in large quantities to satisfy the needs of protein synthesis (Guan et al., 2004a) and synthesis of nonessential amino acids in mammary tissue protein (Trottier et al., 1997). At least five amino acid transport systems have been characterized to transport amino acids into the mammary secretory cells (Shennen, 1997). The major important amino acid transport systems for sows and their piglets that should be studied are: system A that prefers to transport neutral amino acids, especially short-chain amino acids such as methionine (Baumrucker, 1985); system L, which principally transports branched-chain amino acids that are taken up in excess of their appearance in milk (Baumrucker, 1985; Jackson et al., 2000); system ASC that transports some neutral amino acids such as alanine serine and cysteine (Christensen, 1990). Nowadays, the requirements for sow milk production are based solely on the amino acid composition in secreted milk protein. It may inaccurately predict the sufficient requirements (Nielsen et al., 2002). Thus, the estimation of the amino acid requirements should be assessed using the amino acid uptake across mammary tissues (Trottier et al., 1997). Knowledge of the amino acid transport systems is needed to be determined and corporately estimated the amino acid requirements at peak lactation in sows. Most of the studies have been conducted on mice, rats, guinea pigs, cattle, goats, and humans. Only a research study by Laspiur et al. (2004) and our laboratory were conducted on mRNA expression of some amino acid transporter in sow lactating cells. Therefore, the objectives of this study were to determine the effect of dietary protein level on plasma amino acid concentrations, visible mammary gland conformation, and not only relative abundance mRNA expression but also relative abundance protein expression of some neutral amino acid transporters; LAT2, ATA2, and ASCT1 at peak lactation (d18 of lactation) in mammary tissues of sows.

Methods and Materials

Experimental design and diets.

Animal procedures used in this study were approved by the Animal Care and Use committee, Faculty of Veterinary Science, Chulalongkorn University. Eight multiparous crossbred lactating sows were randomly selected based on their genetic backgrounds, mammary gland conformation and farrowing day. Sows were allocated into 2 groups; each 4 sows for deficient and normal protein diet group (8 and 18 % CP, respectively) which were isocaloric (3.2 ME, Mcal/kg) and balanced other nutrients, according to the recommendation of NRC (1998). Sows were provided sufficient feed and free drinking water.

Animals.

Sows were moved to farrowing create 2 weeks prior to farrow and housed individually in farrowing creates. After farrowing (d 0), piglets were cross-fostered after birth to achieve equal number of piglet per sow. Their piglets were received sow's milk throughout lactation period and given a starter diet ad libitum from d 18 of lactation until weaned day on d 28 of lactation. Sows were weighed individually on d 1 postpartum, d 14, and d 28 of lactation.

Blood sampling.

Blood samples obtained from each sow on d 16 of lactation. Blood samples of sows were collected 4 h after feeding for 4 ml each sow, via anterior vena cava puncture and were then put into heparinized tubes. All blood samples were kept on ice until centrifugation. Plasma was separated by centrifugation at 3,000g for 15 min at 4°C, then transferred to new tube and stored at -20°C until analysis of amino acid concentration according to method documented by Reverter et al. (1997).

Mammary tissue sampling.

On d 18 of lactation, mammary tissue samples were obtained by incisional biopsy in five anterior glands of the udder, after sows were feed withdrawal for 4 h at morning. The sows were anesthetized by i.m. administration of Azaperone. The udder were locally infused by 2% xylocaine (OLIC, Thailand) at the incision site which was performed approximately midpoint (4 to 5 cm) between the teat and the upper line of the udder. The incision was continued through the subcutaneous tissues and fascia layers to expose the underlining mammary tissues. Approximately 15-mm elliptical incision at a depth of 5-10 mm, mammary tissues (1-5 g) were collected and immediately placed in RNAlater tissue protection kit® (Qiagen, Hilden, Germany) to prevent RNA degradation and stored at -20°C for subsequent determination of gene-protein expressions. The subcutaneous tissues and skin were sutured with coated Vicryl® (Ethicon Division of Johnson & Johnson, NSW, Australia).

RNA isolation.

Total RNA was extracted from mammary tissues with AurumTM ; Total RNA Fatty and Fibrous Tissue Kit (BioRad, Hercules, USA) according to the manufacturer's protocol.

Reverse Transcription-PCR and Sequence of oligonucleotide primers

The total RNA samples were synthesized the first strand cDNA using iScriptTM Select cDNA Synthesis kit (BioRad, Hercules, USA). A 20-ml of reverse transcription reaction mixture, containing 10 mM random-primer, 1 pg to 1mg total RNA sample and 11 ml nuclease-free water, was sequentially incubated at 65°C for 5 min, at 25°C for 5 min. 5x iScript selected reaction mix (containing dNTPs, magnesium chloride, and stabilizers) and iScript reverse transcriptase were added for 4 ml and 1 ml in each reaction and incubated sequentially at 25°C for 5 min, at 42°C for 30 min, at 85°C for 5 min. The synthesized cDNA products were then amplified by PCR by using IQTM Supermix kit (BioRad, Hercules, USA). The PCR amplification in a final volume of 50-ml composed of 25 ml IQTM Supermix (containing 100 mM KCl, 40 mM Tris-HCl, 1.6 mM dNTPs, iTaq DNA polymerase, 50 units/ml, 6 mM MgCl2, and stabilizers), 0.5 ml of each primer, and 2 ml cDNA template. The PCR primers were designed from the published human LAT2, rat ATA2, and human ASCT1. The primer pairs used in the subsequent PCR and the expected size of the PCR products were summarized in Table 1.

Table 1. Sequence of oligonucleotide primers used for PCR amplification

Genes

Primer pairs

5' 3'

GenBank accession no.

Expected size(bp)

LAT 2

TTTCCAGGAACCTGACATCG (F)

ACATTGCAGTGACATAAGCG (R)

AF171669

200

ATA 2

AATCTGACCAATGCGATTGTG (F)

AATAAAGACCCTCCTTCGTTG (R)

BC040342

164

ASCT 1

GGACTCTTTCCTCGACCTG (F)

ATCTCAGTGCCTATGGGGATCT (R)

L14595

150

18S rRNA

CCGCGGTTCTATTTTGTTGGTTTT (F)

CGGGCCGGGTGAGGTTTC (R)

AF102857

399

Relative mRNA abundance of SNAT2/ATA2, LAT2 and ASCT1 in sow mammary cells by the Semiquantitative Reverse Transcription-PCR technique.

The relative abundance of some neutral amino acid transporters was determined by semiquantitative RT-PCR using IQTM Supermix kit. In multiplexed PCR, 18S rRNA was used as an internal control. Total RNA samples were reverse transcribed into cDNA using random-primer. The cDNA product concentration of each sample, which were diluted to 140 times, was measured the concentration using SPECTRONICÒ GENESYSTM spectrophotometer (Spectronic Instruments, INC,. N.Y.) at a wavelength of 260 nm (in the UV spectrum). The final DNA concentration of each sample was adjusted and equalized by diluted DNA sample to 1 mg/ml with autoclaved ultra pure water. Multiplexed PCR reactions were then set up with a gene-specific primer pairs and 18S rRNA primer to allow simultaneous amplification of the gene of interest and the internal control in a single tube. Preliminary experiments were conducted to determine both the optimal amount of internal control primers and interested gene primers ratio and the number of PCR cycles that would enable detected PCR amplification within the linear range of the PCR reaction for both groups of sows fed with deficient and normal protein diet. The protocol of multiplexed PCR reaction consisted of 3 minutes at 95°C, followed by 33 cycles of denaturing at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 60 seconds, and finally, stop reaction at 72°C for 10 minutes. The resultant PCR products were size-fractionated in 1.8% agarose gels, stained with ethidium bromide. The PCR products were loaded for 18 ml/well. The voltage of electrophoresis was set up at 70 voltage for 70 min. The intensities of both the amino acid transporter and 18S rRNA band for each sample were measured by densitometry using Scion Image software program (www.scioncorp.com). The data of expression levels of each transporter gene were reported as values normalized to the 18S rRNA.

Relative protein abundance of SNAT2/ATA2, LAT2 and ASCT1 in sow mammary cells by the western blot technique

The frozen sow mammary tissue was homogenized in lysis buffer containing protease inhibitor cocktail (Sigma, USA) and centrifuged, then the supernatant was collected. The amount of protein was measured with modified Lowry's assay using commercial test kit (Biorad Laboratories). Samples (50 - 75 mg protein/lane) were resolved by 9% SDS-PAGE and electrophoretically transferred to polyvinylidene difluoride membranes in Tris-glycine transfer buffer. Blotted membranes were then blockd with 5% nonfat powdered milk in Tris-buffered saline for 4 hours at room temperature. For identification of proteins, membranes were washed and incubated overnight at 4oC with the primary antibodies diluted in 1% milk. The primary antibodies were polyclonal anti-SNAT2/ATA2, anti-LAT2, anti-ASCT1 (Santa Cruz, USA), and anti-b-actin (Sigma, USA). Following the primary antibody incubation, the membranes were washed and then incubated in horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 hour. This incubation step was terminated with several washes and the immunoreactive protein bands were visualized using chemiluminescence technique (ECL Plus; Amersham Biosciences). Membranes were exposed to film (Hyperflim-ECL) for time adequate to visualize chemiluminescent bands. Differences in determined by scanning densitometry in proportion to b-actin immunoreative bands (Scion Image; Scion Corporation, USA). All samples were repeated in duplicate.

Statistical Analyses.

All assays were conducted in duplicate or triplicate. Statistic significance of relative differences in mRNA expression was presented as means±SE. Differences between groups were analyzed by unpair t-test using the commercially computer program GraphPad Prism (Prism3) at p-value p < 0.05.

Results

Plasma amino acid concentration.

The plasma amino acid concentrations in sows fed with dietary protein deficiency, most essential amino acids were significantly decreased such as arginine (1.11% to 0.47%), threonine (0.61% to 0.30%), tyrosine (0.43% to 0.18%), isoleucine (0.62% to 0.26%), leucine(1.27% to 0.60%), valine (0.74% to 0.38%), and phenylalanine (0.65% to 0.29%) compared to those fed with dietary protein sufficiency (p£0.05). In contrast, most of plasma nonessential amino acid concentrations were constantly remained in response to dietary protein deficiency (p>0.05).

Visible mammary gland conformation.

The visible mammary gland conformation of sows fed with deficient protein diet seemed to be smaller when compared to those fed with normal protein diet.

The relative mRNA abundance of some neutral amino acid transporters in sow mammary tissues.

Sows fed with deficient protein diet expressed less abundance of ASCT1 and LAT2 than those fed with normal protein diet (p<0.05). The mRNA abundance of an amino acid transporter: ATA2 in lactating mammary tissues was not different between both groups of sows fed with normal and deficient protein diets. (p > 0.05).

The relative protein expression of some neutral amino acid transporters in sow mammary tissues.

Sows fed with deficient protein diet expressed less abundance of LAT2 protein than those fed with normal protein diet (p<0.05). The protein expression of ATA2 and ASCT1 in lactating mammary tissues were not different between both groups of sows fed with normal and deficient protein diets. (p > 0.05).

Discussion and Conclusion

Deficient protein diet had negative effects on body weight change of lactating sows which consequently affected growth performance of their piglets by decreasing in body weight and average daily gain, especially at last period of lactation (unpublished data). These results agree with previous study of Guan et al. (2004a), sows fed with deficient protein diet (7.8% CP) lost their weight for 25.8 kg. Lactating sows often lost their body proteins to support milk production. Nutritional insufficiency can cause an excessive body protein loss and consequently retards litter growth rate. Main effect of reduction in piglet growth is sow's milk production and composition. Severe protein restriction during lactation decreased milk production of sow (Jones and Stahly, 1999) and also decreased proteins composed in sow's milk (Guan et al., 2004a). Consequently, piglets did not receive sufficient nutrients including amino acids for body protein synthesis to support rapid growth at early stage of life. The result of reduction in piglet growth may be confirmed by the level of plasma amino acid concentration found in plasma of sows. The investigation of plasma amino acid concentrations may be used as an indicator of available plasma amino acid supply to mammary gland at peak lactation accounting from d 15-21 of lactation (Trottier et al., 1997). The plasma essential amino acid concentrations in sows fed with dietary protein deficiency, whereas most of plasma nonessential amino acid concentrations were constantly remained. The nonessential amino acids can be mobilized from the body protein, particularly skeletal muscle (Jones and Stahly, 1999). Further supported by Guan et al. (2004a), they found that the arterial plasma essential amino acid concentrations were lower in sows fed with deficient protein diet (7.8% CP) compared with those fed with normal protein diet (18.2% CP).

In relation to the significantly decrease of plasma concentrations of some essential amino acids in sows fed with deficient protein diet, the quantitative mRNA and protein expressions of some neutral amino acid transporters were also affected by dietary protein insufficiency. In this study, the quantitative mRNA expressions of ASCT1 and LAT2 as the same expression of LAT2 protein were down regulated significantly (p<0.05) in response to dietary protein deficiency meanwhile the quantitative mRNA expressions of ATA2 as the same expression of ASCT1 and ATA2 protein did not differ between two experimental groups (p>0.05). The possible explanation might be caused of amino acid substrates of LAT2 (System L) such as branched-chain amino acids were significantly decreased in plasma of sows fed with deficient protein diet. Consequently, substrate availability of sow's mammary gland was decreased, which then affect on the decreasing in gene-protein expression of this amino acid transporter. In contrast to LAT2 gene-protein expression, ATA2/SNAT2 of system A was not change in response to dietary protein deficiency when compared to normal protein diet group. This phenomenon was likely to occur in order to compensate for amino acid by regulating through enough capacity of this transporter as supported by plasma amino acid concentrations of most neutral amino acid substrates such as methionine, glycine, proline were not significantly decreased in plasma of lactating sows fed with deficient protein diet.

The result can be concluded that dietary protein insufficiency had the effects on impairment of sow mammary gland conformation during peak lactation, decrease in plasma concentrations of essential amino acids, and down regulating gene-protein expression of some neutral amino acid transporters. Consequently, these effects are an important cause to retard growth performance of piglets such as body weight at weaned day. To the best of our knowledge, it is useful for further studies on substrate dietary amino acid or protein supplementation to optimize amino acid composition in sow's milk. In addition, the effect of dietary protein deficiency on expression of other gene and protein amino acid transporters in lactating porcine mammary cells remains to be investigated.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.