Incidence Of Oral Cancer In The World Biology Essay


In many universities, hospitals, medical centers, and other institutions, important research into oral and oropharyngeal cancer is underway. Each year, scientists find out more about what causes the disease, how to prevent it, and how to improve treatment.

The 11th most common type of cancer in the world is oral cavity cancer with age standardize rate (ASR) of 6.3 and 3.2 per 100000 for male s and females respectively (Parkin et al., 2005). oral squamous cell carcinoma (OSCC) can occur at different intraoral sites including the lip, tongue, alveolus, floor of the mouth, buccal mucosa and hard palate.

The difference in distribution of oral cancer worldwide in influenced by their risk factors. Age, gender, ethnic are the factors which has great effects on incidence and distribution of oral cancer. Oral cancer associated with dietary intakes, chemical carcinogens, viral exposure, and environmental. there are so many factors which are well established as risk factors for (OSCC) and its is recognized to result from chewing of betel quid, tobacco smoking alcohol drinking. The etiology of oral cancer is multifactorial for example the extreme usage of alcohol with tobacco has been suggested to account for high percentage of the risk for oral cancer.

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Although the inter-ethnic variation in the prevalence of oral cancer may be attributed to environmental and lifestyle factors but it is not enough reason. Genetic susceptibility is the other risk factors for OSCC incidence. DNA changes are responsible for causing cells of the oral cavity and oropharynx to become cancerous. The development of oral cancer proceeds through several molecular genetics events with cumulative damage in specific genes initiated through loss of genomic integrity, often after long-term exposure to in environmental risk factors. Single nucleotide polymorphisms is kind of DNA sequences changes and one of the most common occurrences and it is great interest to know about polymorphic genotyping. There are so many method for SNP genotyping methods: Allele-specific hybridization (Taq Man assay), Flap endonuclease discrimination (Invader assay), Primer extension, Oligonucleotide ligation, PCR- restriction fragment length polymorphism (PCR-RFLP).

This study will carried out PCR- restriction fragment length polymorphism (PCR-RFLP) genotyping of S100A8 gene which is one of S100 gene family from the DNA sample extracted from case and control subjects and the association between the above mentioned risk factors and S100A8 polymorphisms in the development of oral cancer in three Malaysia ethics.

According to this study on genetic susceptibility and environmental risk factor in oral carcinogenesis could be helpful to indicate possible chemoprevention strategies .if such study of the Malaysian population was able to show association with these habits it may be to useful to stop these habits and also early detection would be able to reduction in the overall morbidity and mortality due to oral cancers so it could offer a cost-effective option.

The finding of such a study would also provide a data base for future assessment of treatment and the quality of life of oral cancer.

The objectives of this study are:

To determine the prevalence of S100A8 genotypes in oral cancer (cases) and non cancer (control) patients

To determine the risk of genetic polymorphisms of S100A8 in development of oral cancer in above population

To evaluate the influence of S100A8 on the association between risk habits and oral cancer.

Null hypothesis:

Polymorphisms in S100A8 is not a risk factor for oral cancer in Malaysia population.

Smoking is not a risk factor for oral cancer in Malaysia population.

Alcohol drinking is not a risk factor for oral cancer in Malaysia population.

Betel quid chewing is not a risk factor for oral cancer in Malaysia population.



2.1 Oral cancer

Oral cancer cause damage on different parts inside oral cavity such as the mucous, surface of the lip, tongue, palate ,floor of the mouth. the worldwide rank for this cancer is sixth, and in the developing countries is the third most common cancer .the major type of oral cancer is oral squamous cell carcinoma (OSCC) and it represents 90-95% of all oral damages (Dobrossy L , 2005; Dipak et al, 2008).

Oral cancer in contrast to other type of cancers does not have especial borders , so many studies about the anatomical structure of oral cavity have been done but in regard to all these studies about the oral cancer, the diagnosis procedure and the treatment researches the numbers of survival for this kind of cancer is low (<50%) (Moore et al.,2000; Parkin et al., 2005).

2.2 Epidemiology of oral cancer

2.2.1 Global epidemiology of cancer

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

In cancer epidemiology case, some measures such as incidence, mortality, prevalence, and survival are needed to know to get the impact of cancer in population group. According to the research on estimation of worldwide cancer by Parkin et al. (2005) which summarized the global estimation in world until the year 2002, by measuring the incidence and mortality for 26 cancer in men and women in the world, the five common cancer in males was lung, colon/rectum, prostate, stomach, and liver cancer, and breast, cervix uteri, colon, lung, and stomach cancer was the highest five cancer in females (Parkin et al., 2005). Prostate cancer (218.890 cases) in men and breast cancer in women (178.480) were the highest level of cancer in USA. Pharynx and oral cancer was estimated as one of the top ten cancers in men in USA (Jemal et al, 2007).

2.2.2 Incidence of oral cancer in the world

Oral cancer is the 11th common cancer in the world, and according sexes categories it was 8th in male and 13th in female (Parkin et al., 2005).The highest rate of oral cancer reported in India in female and in related to betel chewing habit and smokeless and smoked tobacco, whereas the highest amount is in Bas-Rhin, Northern France in regard to usage of crudely distilled spirit (Stewart et al., 2003; Reichart., 2001).

2.2.3 Incidence of oral cancer in Malaysia

Malaysia is one of the developing countries with the Malay, Indian and Chinese ethic. According to the report from the Malaysian National Cancer Registry (NCR) in 2003 the frequency of gum, floor the mouth, palate and other non specific sites of mouth (ICD 10 CO3-CO6) in Malaysia was 19th for men and 16th in females. Although it does not contain the lip and tongue cancer (Lim et al., 2004).

If all sites were combined the calculating of standardized incidence rate (ASR) was higher at i.e. 3.7 per 100,000 for male and 4.7 per 100,000 female. Among the three races of Indian, Malaya and Chinese, in Indian ethic the frequency of gum, floor of the mouth, palate and other part of mouth were highest.

2.2.4 Oral cancer mortality

The ranges of the death caused by oral cancer have increased in many countries. In refer to result of the research which was done by Pisani et al., (1999) the rate of global death which caused by cancer of 'mouth' (lips and oral cavity) was about 100,000 deaths and totally the rate of death from oral cavity and pharyngeal was 197,000 in year 1990 (Johnson., 2003). In year 2002 this rate was going up in range to 127,259 cases with ASR of 1.5 per 100,000 for females and 2.9 per 100,000 for male. It was shown an increased amount for oral cancer mortality for 28 European countries from 1955-1989 in the group aged 35-64 (Parkin et al., 2005).

2.2.5 Gender distribution of oral cancer

The oral cancer distribution in tongue, floor of the mouth and pharyngeal cancer between male and female is differ from 2-15:1 and depend on the anatomical sub-site The other factor which effects on sex distribution according to studied done by Johnson et al.,(2003a) was risking factors for oral cancer that the rate of cancer among male as they used more alcoholic drink and tobacco were higher compare to female in western country although this could vary from region to region and types of risking factors for oral cancer (Johnson, 2003).

In France and Brittany coast the highest amount of oral cancer incidence reported for male whereas India is one of the country in which highest rate of oral cancer occur among females where smoking, chewing were most common habit among the (Johnson, 2003; Blot et al., 1996).

2.2.6 Age distribution of oral cancer

Oral cancer mostly incidence in older persons, as in India the rates of incidence were as high as 30-40% (Parkin et al., 2005; Neville et al., 2002). But the incidence of oral cancer has been occurred in younger men in both western and Indian sub-continent (Gupta et al., 1999a; Gupta and Nandakumar, 1999b).

The 4-6% of oral cancer happens in people younger than 40 years old (Llewellyn et al., 2004). Using of risking factor material for oral cancer has great effect on decreasing of age for this disease. for example according to Gupta et al.,(1999a) and Warnakulasuriya (2005) researches, in India the range of incidence to oral cancer were increased in younger people under 40 years of age due to increasing in use of areca products which cause oral submucous fibrosis (Gupta et al., 1999a; Warnakulasuriya et al., 2005).

2.2.7 Ethnic distribution of oral cancer

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

In refer to meaning of ethic as a word that the group of individuals as a result of habit or beliefs and also combine with other factors which may affect health such as diet, may has effect on disease incidence (Scully et al., 2000).

Oral cancer seems most prevalent in Asian population (Warnakulasuriya et al., 1996).according to confirmation of National Cancer Report on 2004 the Indian ethic living in Malaysia were more susceptible to oral cancer compare to Chinese and Malay subjects.

2.3 Oral cancer genomic study

As mentioned before oral cancer effect on the mucous surface of the lip, floor of the mouth, tongue and it is one of the sixth common cancers (Dobrossy L , 2005). important research about oral cancer is underway in many university, hospitals, research institutions. early diagnosis of procancer would be great effect on reducing the incidence oral cancer carcinoma.

Genomic study of oral cancer has led to identify different types of oral cancer, molecular mechanisms of cancer progresses and find out points to what causes the disease, and how to improve treatment (Aswini YB, 2009).

There are so many single nucleotide polymorphism studies have done on different genes in related to oral cancer accession for example alcohol dehydrogenase gene polymorphisms, xenobiotic metabolizing agents such as P4501A1, glucathione S transferase gene (GSTM1), p15 and p56 as transcription factor subunits (Pavanello S et al., 2000; Friedlander PL et al., 2001).

Although there are some researches and reviews which have been done on S100 gene family and as well S100A8 gene such as review study of the S100 proteins in cancer done by Salama et al., (2007); function and regulation study of S100A8 gene done by Robert J et al., (1999), an study which done by Christoffer Gebhardt et al., (2007) on S100A8 and S100A9 in inflammation and cancer, Molecular Mechanisms of S100-Target Protein Interactions study done by Danna B (2003) ,researches done by Dipak Sapkota et al., (2008) about different members of S100 gene family and their expression of those gene in oral cancer cell carcinoma, proteomic profile study of S100A8 and S100A9 in colorectal cancer by Hye-Jung Kim et al., (2008) and also there is so limited study which have done on Single nucleotide polymorphisms genotyping in S100 genes in related to other disease such as periodontitis diseases and SNPs of S100A8, S100B gene polymorphism in depressive disorders done by Kun Yang et al., in 2009 but there is no study on SNPs study of S100 genes and S100A8 gene and its relation to oral carcinoma cell cancer ( I. Salama et al., 2008; Robert J et al., 1999; Christoffer Gebhardt et al., 2006; Danna B et al., 2003; Hye-Jung Kim et al., 2009; Kun Yang et al., 2009) .

In this study I am going to study single nucleotide polymorphisms genotyping in S100A8 gene and risk rate of oral cancer susceptibility in Malaysia.

2.4 S100 family

Two classes of genes are known to participate in cell cycle progression and growth. One is cancer-causing gene (oncogene) while the other is cancer-inhibiting gene (tumor suppressor gene). Activation of onco genes and inactivation of tumor are frequently observed in human cancer. Quantitative or qualitative alterations in the expression of such genes have been shown to hold great promise for using such markers in the diagnosis, treatment or even management of human cancer patients. However, no specific marker useful in the prognosis or diagnosis of early-stage oral SCC has yet been identified (Li-Wha Wu et al.,…….).

Recently, molecules of the S100 family have attracted great interest in tumorigenesis due to their cellular and tissue expression in some of human disease , association with inflammatory disorders, utility in clinical diagnostics, and potential as novel therapeutic targets. The 18 S100 family members so far described are 10 to 14 kDa in size and contain two EF hand motifs capable of binding calcium (Heizmann, C. W , 2002).

Many cellular processes, including cell proliferation, differentiation, motility, secretion, membrane permeability, protein synthesis, and extracellular signal transduction, are regulated by members of this family (Donato R , 2003). Sixteen of the 20 members are tightly clustered on human chromosome 1q21. In this chromosome region, S100A2 together with 13 other S100 members are located within the epidermal differentiation complex. This region encodes many other genes that are expressed in epidermal keratinocytes (Marenholz I, 1996). Among these genes, expression of involucrin is highly correlated with epidermal differentiation (Li ER et al., 2000). The location of S100 genes in epidermal differentiation complex has heightened interest in their role in differentiation of the epidermis.

Expression levels of S100 proteins vary considerably in different tumors and with respect to the progression of malignancy (Heizmann, C. W, 2002, Donato R. , 2003). Multiple sequence alignments clearly show that S100 proteins can be divided into four subgroups (Marenholz I et al., 1996). S100A2, S100A3, S100A4, S100A5, and S100A6 are in the same subgroup, indicating that these proteins are evolutionarily related. Although these proteins display high levels of sequence similarity, their characteristics are distinct. S100A4 is over expressed in many types of tumors and is considered a well-established marker for tumor progression, invasion, metastasis, and poor survival prognosis (60). S100A6 ismarkedly up-regulated in many types of tumor cells, including melanoma, adenocarcinoma, and neuroblastoma .

2.5 S100A8 gene

S100A8 is one of the S100 calcium binding protein family which located on chromosome 1q21 which contain three exons that encode S100A8 protein with 93 amino acids. This protein expressed in neutrophils, monocytes and activated macrophages (Kligman D et al., 1988; 61, Zwadlo G et al., 1988).

There is some intracellular and extracellular function for this protein such as cell migration rearrangement of myeloid cytoskeletal , metabolism of arachidonic acid metabolism, neutrophilic NADPH oxidase regulation (Foell D et al., 2004; Tugizov S et al., 2005).

The S100A8 gene codes the light subunit of calprotectin protein which is expressed by neutrophils and is present in gingival crevicular fluid (GCF) .its existence is depend on periodontal inflammation that S100A8 cells are appear in inflammation sit which is due to extracellular release of this heterodimer protein (Li J et al., 1998; Wang R et al., 2002) .

This secreted protein need some structure such as CD36 and receptor of advanced glycation end products (RAGE), multiligand receptor of the immunoglobulin superfamily , on target cells to stimulate intracellular signaling response and also there is interaction of heparin sulfate proteoglycans and carboxylated glycans with this protein (Arumugam T et al., 2005). RAGE plays role in functional innate immune responses and chronic inflammation that S100 proteins stimulate this event, in case S100A8/A9 by increasing binding of ICAM-1 to Mac-1 or RAGE-Mac-1 has its function in inflammatory condition (Eue I et al., 2000).

In tumor cells there is increasing in concentration of RAGE and AP-1 and NF-KB-mediate gene transcription following increasing of S100A8/A9 which is discovered in colorectal, prostate and skin cancer (Hermani A et al., 2005). There is usually kind of relation between immune cells and carcinogenesis process. chronic infection along with activated innate immune cells that cause increasing in concentration of chemokines, cytokines, growth factors, reactive oxygen species (ROS) and nitric oxide (NO) which each has effect on proliferation ,prevention of apoptosis, cause morphogenesis and damage of the DNA (Mueller MM et al., 2004; de Visser KE et al., 2006).

2.6 Carcinogenesis and risk factors

2.6.1 Carcinogenesis

Any changes in genes structure and collection of this genetic alternation in the genes which responsible for coding different types of essential vital proteins such as regulating gene expiration, cell division, cell differentiation and cell death, may cause some disease such as different types of cancer (Warnakulasuriya et al.,1996; Almadori et al., 2004). The terms which are expressing the development of cancer are carcinogenesis, oncogenesis or tumorigenesis (Grizzi et al., 2006). carcinogenesis contain 3 stage: initiating event that permanent mutation occurs in gene then second stage is promotion in which the cells divide and the development of over time mutation in divided cells is called progression.

Genetic susceptibility, environmental risk factors and herited genomic changes of cancer gene, are together involved to carcinogenesis, but the response of cells to risking factors of environmental agents is different. Inherited factors effects on Mendelian transmition models but the herited syndrome which occur by mutation of cancer's gene play small roll in cancer process in human, cause of rare incidence of mutation on cancer genes in general population, but the effects of environmental factors on gene polymorphisms is more to incidence of cancer in many cases (Nasca ., 2001).

2.6.2 Risk factors on Oral Cancer

According to world report on 2003 and also studied done before Tobacco, alcohol drinking, betel chewing, diet and nutrition, poor oral health, poor immune system are risking factor of oral cancer (Stewart et al., 2003). Tobacco as a risk factor

Tobacco is the main factor cause disease for oral cancer .its produce kind of free radicals which cause in antioxidant enzymes such as, glutathione reductase glutathione-S-transferase (GST), , superoxide dismutase, catalase, and glutathione peroxidase as well as lipid peroxidation and total thiol. so , it is of basic importance to assess the role of this kind of risk factor in oral carcinogenesis (Beena et al.,2008).

Tobacco contains many carcinogenic compounds like 4-methyl-N-nitrosamines-1-(3-pyridyl)-1-butanone (NNK), benzene, radioactive polonium that these last two compounds are categorised as polyaromatic hydrocarbones (PAHs).one of the other carcinogenesis compound is 4-(nitrosomethylamino)-1-butanone (TSNs), one kind of nitrosamine, which can cause mutation in guanidine nucleotide to thymidine nucleotide which has effect on DNA replication (Scully et al.,2000; Walker et al.,2003). So as there is different type of compound as well there is different type of damage which may cause by usage of tobacco (Kupper et al., 2002).

There is two phase of enzyme (phase I and phase II) are important in accruing damage that by inactivating phase II enzyme, the phase one substrate which are the reactive electrophilic metabolites which converted from tobacco compound by oxidative phase I enzyme are more damageable for DNA (IARC, 1986).

The range of death from usage of different types of tobacco products in the year 2000 was 4.9 million and estimate to increase to 10 million deaths per year by 2020s (WHO, 2000).

According to Haniza et al., (1999) study it was shown that the prevalence of smoking is 24.8% in age 18 and above and most in male and Malay ethic especially in Sabah and Sarawak (Haniza et al., 1999).

Betel quid, bidi, are usual form of tobacco product which is major factors in increasing of oral cancer incidence. Although the estimation effect of smoking on oral cancer is very in different population but according to one studied it was showed that in laryngeal and oro/pharyngeal cancer, smoking is responsible in 15% in women and 41% in men (Stewart et al., 2003). Betel quid as a risk factor

Any kind of substances which get contact with mouth mucosa in reason of chewing is called quid (Zain., 2001).

Any types of quid which contain tobacco, nut areca include betel leaf is called betel quid which is most common in Asia for long time and among women and children, although it has different combination in different countries (Gupta et al., 2004). In some studies there is shown the relation between betel-quid chewing and cancer in different countries for example in India betel-quied chewing is common and is one of major risk factor for oral cancer (Gupta., 1999a) . Usually betel-chewing may cause some changes in structure of oral mucosa which is as a result of reactive oxygen species ,which produced by chewing, that could cause gene mutation and also may effect on salivary proteins (Walker et al., 2003).

According to some studied the betel-quid chewing habit among the Malaysia people was about 22% and most among female of Indian ethic and mostly among malay ethic but it was not reported in Chinese ethic as a habit (Zain et al., 2001; Muttalib et al., 2002). Alcohol drinking as a risk factor:

Alcohol is one of the major risk factor of head and neck cancer especially incidence of 75% of oral cancer in developed countries (Vecchia et al., 1997; Llewellyn et al., 2001).

The carcinogenesis effect of alcohol depend on the dose and how many times of usage of alcohol which heavily drinking of alcohol has effect on nutritional deficiencies and also cause suppression of immune system . The most effect is on oral cavity, pharynx and oesophagus (Stewart et al., 2003; Das et al., 2002).

Alcohol cause dryness of mouth mucosa so its lead to ease of penetration of other risk factor of carcinogensis into oral mucosa (Das et al., 2002).

The harmful effect of alcohol is related to increasing in production or low range of removal of acetaldehyde from the body, acetaldehyde is one major metabolite of usage of alcohol which produces by means of alcohol dehydrogenase (ADH).this metabolite inhibits the 6-methylguanitransferase, one kind of repairing enzyme, so interferes with DNA synthesis and repairing. Strongly usage of alcohol cause highly present of ADH and as well highly production of acetaldehyde in oral mucosa and so highly tissue damage and incidence of oral cancer (Ogden ., 2005; Figuero-Ruiz et al., 2004).

2.6.3 Genetic susceptibility as risk factors

Although there are so many acquisitive risk factors as mentioned above but it is not enough reason whom smoking or chewing or drinking alcohol are getting oral cancer. Most of the external risk factors need to convert to biological active forms and then they could have effect on host DNA. Besides of acquisitive factors there are hereditary factors which appear by deletion of single gene or mutation, that often follow by Mendelian transmission but as the cancer gene mutation is rare it is just play a small role in cancer incidence. On the other hand gene polymorphism is other kind of gene mutation which happen in more than 1% of population which give rise to allelic variations and involved in metabolic activation or detoxification of carcinogens (Nasca., 2001;Park et al., 2000). Single Nucleotide polymorphisms (SNPs)

Single nucleotide polymorphisms (SNPs) is kind of DNA sequences changes which arise because of mutations. This type of polymorphism is one of the most common occurrences which its incidence is about 1 in 1000 base pairs (Barkur et al., 2002).

SNPs are single base pair positions in genomic DNA that happen when a single nucleotide differs between members of a species (or between paired chromosomes in an individual). For example, two sequenced DNA fragments from different individuals, TTCGACA to TTCGGCA, contain a difference in a single nucleotide. In this case we say that there are two alleles : A and G. Almost all common SNPs have only two alleles (Anthony et al., 1999; Barkur et al., 2002).In the past, SNPs with a slight allele frequency of larger than 1% were given the title "SNP". SNPs are categorized in to two groups of synonymous and nonsynonymous according to whether the encoded amino acid is changed or not. SNPs that do not change encoded amino acids are called synonymous. On the other hand, nonsynonymous SNPs are divided in missense and nonsense, where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon (Anthony et al., 1999).

SNPs that are not in protein-coding regions may still have consequences for gene splicing, transcription factor binding, or the sequence of non-coding RNA. As SNPs incidence in human DNA sequence is frequently accurate so can serve as genetic markers, especially to detect gene associated to disease (Anthony et al., 1999; Barkur et al., 2002). According to Jenkins et al. (2002) comparative studies on identical twins, fraternal twins show that SNP is one of the factors associated with susceptibility to many common diseases as well as every human trait such as tallness, curly hair (Barkur et al., 2002). In pharmacogenomics researches to avoid adverse effects SNPs are useful to understand the response of individuals to drug (Wang et al., 2005). SNP genotyping methods PCR- restriction fragment length polymorphism (PCR-RFLP)

Variations in the human genome caused by substitution, addition or deletion of bases can create or destroy restriction enzyme's recognition site. This leads to the use of PCR-RFLP method to detect polymorphisms. PCR-RFLP is a genotyping method based on existence of alternative alleles detectable by visualizing DNA of different fragment sizes obtained after digestion whit restriction enzymes (Snustad et al., 2006). The resulting DNA fragments of different molecular sizes are subjected to gel electrophoresis. Primers containing mismatches adjacent to the polymorphic site have to be constructed if there is no restriction enzyme recognition site available at the wild type nucleotide sequence to enable the detection of SNP alleles (Grove et al., 1997). Allele-specific hybridization (Taq Man assay)

This method uses two allele specific probes labelled with fluorescent dye and generic quencher for allelic discrimination (Jenkin et al., 2002). The probes will only bind to the target sequence when they match perfectly. The probes complimentary to the DNA sequence bearing the SNP will be cleaved by 5' exonuclease activity of Taq polymerase during amplification and resulted in separation of dye and quencher. This cause an increase of probe specific florescence which will be detected by a plate reader. The advantage of Taqman assay is that sample processing can be reduced as the PCR amplification and genotyping assay are incorporated into single step (Shui., 2007). Flap endonuclease discrimination (Invader assay)

This method includes nuclease cleavage of single probe when two overlapping oligonucleotides hybridize to a complementary DNA target. The two oligonucleotides (allele specific primary probe and invader probe) overlap at SNP site and form triplex structure. Flap endonuclease recognizes and cleaves the structure and the resulting fragment can be detected by fluorescence (Jenkin et al., 2002). Primer extension

This method uses an extension primer attached to 5' region of SNP (not including the SNP) which will then be extended for one or several nucleotides to include the SNP site. The identity of the polymorphic nucleotide will be determined by detection system such as fluorescence labeling or mass spectrometry (Jenkin et al., 2002). Oligonucleotide ligation

This method is based on specific activity of DNA ligase and it involves ligation of two oligonucleotides, hybridized to DNA template, one of them is allele-specific such that it will form ligated product only if it is complimentary to the template.



3.1 Study Design

This is cross sectional study with case-control study to determine the association between betel quid chewing, alcohol drinking, smoking as environmental risk factors, S100A8 polymorphisms and oral cancer.

3.2 Population and Sample

3.2.1 Reference Population

All the oral cancer patients in Malaysia in which the results of this study would be inferred was used as the reference population

3.2.2 Source Population

The normal and case samples were obtained from Oral Cancer Research and Coordinating Center (OCRCC) ,University of Malaya Database which chosen as the source of population for this study. The OCRCC database is an oral cancer data bank which comprises information of related parameters extracted from patients who attended nine selected centers: Dental Faculty University of Malaya, University of Sains Malaysia, University Kebangsaan Malaysia and the ministry of health Malaysia specialists clinic at the General Hospital of Kuala Lumpur Selangore. Perak, Kelantan, Sabah and Sarawak. Risk habits, socio-demographic data diet, diagnosis, histological grading, gene expression and information for future verify accounts against assessments of disease outcome and behaviour were investigated for OCRCC data collecting.

3.2.3 Sampling Frame

Sampling frame has formed by the patients whom fulfilled both the inclusion and exclusion criteria for the study. Inclusion Criteria

For cases, included:

Patients whom selected from nine centers that overwhelmed by squamous cell carcinoma of the oral cavity

Patients with genomics DNA in the nuclei acid bank ( at OCRCC-UM and CARIF- cancer Research Initiatives Foundation) or blood samples

For controls, included:

Patients whom not overwhelmed by oral cancer potentially malignant lesions or other kind of cancers.

Patients with no prior history of cancer

Patients with no family history of cancer

Patients with genomics DNA in the nuclei acid bank ( at OCRCC-UM

and CARIF- cancer Research Initiatives Foundation) or blood

samples Exclusion Criteria

Cases are excluded as follows:

Non-Malaysian citizens

Cases with recurrence

Controls are excluded:

Patients with history of cancer.

For both case and control groups, patients and non cancer individuals without genomic DNA from the nuclei acid bank (OCRCC-UM and CARIF) are also excluded.

Non Malaysian citizens patients whom already had cancer and they have been under treatment were keep out for cases .this is so important to eliminate patients with recurrence cancer

3.3 Sample Size Estimation

For this study the sample size was determined by using Power and Sample Size Calculation version 3.0.12 software. The factors which used to get the proper number of sample size by the mentioned software were significance level of 0.05 , 80% at least as the study power , the ratio of control to cases was 1:1, the odd ratio (OR) of exposure among cases for detection was 0.24 (with 95% confidence interval (CI)) and R was 0.4. So the estimated sample size was 215 participants in each case and control group, total 238 subjects. Some points likes limited time to cover experiments, higher cost of reagents which use to run the experiments for this study also considered in estimating sample size.

3.4 Variables In This Study

In this study all three ethics of Chinese. Malaya and Indian population were chosen as ethnic group from Malaysia patients in database .The other variables in this study were categorized into information from database which collected via interview by using structured questionnaire such as age ,gender , tobacco smoking, alcohol drinking, betel-quid chewing .

3.5 Determination of S100A8 Genotype

One single nucleotide polymorphism (rs3795391) in the upstream region of S100A8 from the gene bank database is selected. rs3795391 is an adenine (allele A) to guanine (allele G) replacement in the S100A8 gene, in which alellel A is in TfiI cutting site. There is one obligate TfiI site, in which the second one is depending on the genotype.

3.5.1 The S100A8 PCR Amplification:

The substantial amount of extracted DNA by using the QIAamp Blood Mini Kit (Qiagen) from the buffy coat of the blood sample from the nuclei acid bank ( at OCRCC-UM and CARIF- cancer Research Initiatives Foundation were used for standard PCR-RFLP amplification.

A 25 μl PCR reaction mix was prepared as shown in table 3.5.1. The forward and reverse nucleotides sequence shown in table 1.

Table 1: PCR mixture

Reagent working Amount

Concentrarion 30 μl reaction

DNA template 100 to 500 ng DNA

10 Ã- reaction buffer 1Ã- 6 μl

20 mM MgCl2(pH 9.0) 1.5 mM 1.8 μl

0.25 mM dNTP 200 uM 0.8 μl

1.0 U GoTag DNA polymerase, 5 U/ μl 0.2 μl

1.0 μM forward primer 25uM 1.2 μl

1.0 μM reverse primer 25 uM 1.2 μl

Total 30 μl

The final volume of 30 μl PCR reaction mix were then placed in GeneAmp PCR system 2727(pekrin- Elmer,Applied Biosystems) . PCR Condition

The Amplification was performed for one cycle at 94â-¦C for 5 minutes, 35 cycles each at 94â-¦C for 30 seconds, at 30 seconds an optimum annealing temperature (Table 2) and 72â-¦C for 30 seconds, and one cycle at 72â-¦C for 7 minutes.

Table 2: Genotyping of the rs3795391 single nucleotide polymorphisms in the S100A8 Gene

Polymorphic Primer sequences PCR Digestion

Variants (5_→3_)

Size (bp) Tm Enzyme T

rs3795391 Fw: GTGTGCACATGTCTCTGTGTG 248bp 58â-¦C Tfi I; A = Tfi I (+), 65â-¦C


†Tm : Annealing temperature.

‡T : Incubation temperature. Gel Electrophoresis for PCR Product

The PCR products were checked in 2% (w/v) agarose gel electrophoresis and visualized with ethidium bromide under uv transmition.

Then,10 μl of a different target fragment was digested by which is the most common way to isolate PCR and PCR amplification. the result of reaction visualized as the bands under the UV transmition Criteria for Evaluation of S100A8

The amplify DNA was checked with 2% agarose gel and the 248bp DNA fragment illustrate the presence of S100A8 gene (figure 1).

3.6 Restriction Fragment Length Polymorphism Analysis (FRLP)

Restriction enzyme digest was used to determine the genotype of S100A8. The PCR product were used for restriction enzyme Tfi I digestion. Digestion was done in 20l reaction with Tfi I (500 U/µl) at 65°C for four hours . there was no need any procedure for enzyme inactivation. The master mix for restriction enzyme was prepared as table 3.

Reagent Amount for 20 µl reaction volume

PCR product 15 µl

10 Ã- NEBuffer buffer 2 μl

Tfi I 0.2

dH2O 2.8

Total 20 μl

3.6.1 Gel Electrophoresis for RFLP Digestion Products

The digestion products were electrophoresed with 2% agarose with ethidium bromide staning and visualized under uv transmition.

3.6.2 Criteria for evaluation of S100A8 polymorphisms

The Sl00A8 polymorphisms were shown in the PCR product which was digested by TfiI . the target was contained one obligate cutting site with the GATTC sequence and the second variable cutting site is GAA*TC in which the SNP located inside this cutting site .in case there was no single nucleotide polymorphism incidence ,in means the allele A is presence so the gene is in wild type and there was presence of 147bp, 54bp and 47bp band size after electrophoresis. The presence of 194bp and 54bp yields product illustrate the presence of allele G so there was just one cut in obligate site for related restriction enzyme. Additional band illustrate the presence of Heterozygous individuals.

The criteria for statistical analysis in this study is divided in to 2 category:

wild type if the band present as three band size 147bp, 54bp, 47bp

polymorphism is considered if the band present at two band size 194pb and 54 bp.

Table 4: Determination of S100A8 genotype

Wild type (normal) Polymorphism

(homozygote) (heterozygote) (homozygote mutant)

194 bp

194 bp

147 bp

147 bp

54 bp

54 bp

54 bp

47 bp

47 bp

3.7 Statistical Analysis