Immune response and asthma

Published:

Role of Th2 T lymphocytes

Th2 T lymphocytes are sub group of lymphocytes. After, Proliferation of T cells these develop into effector T cells and differentiated into Th1 and Th2 cells. T cells bind to antigen presented by B cells and help in inducing B cells into proliferation and differentiate into B cell antibody class, antibody switching especially IgA and IgE isotype. (Figure1). (Epstein et.al.2006).They plays a pivotal role in allergic immunity. The suppression of Th2 cells can lead to alteration of balance between Th1 and Th2 immunity thereby causing autoimmunity. Th2 mediates humoral immunity and produces IL-4, IL-5, IL-6, IL-10, IL-13. (killer et.al.1987.,Mosmann et al.1986)

Transcription factors GATA- 3 -controlling T cell generation

GATA-3 is essential factor for T cell development and differentiation. GATA-3 belongs to family of transcription factor that binds to DNA sequence motif which is specific for Th2 transcription factor. GATA-3 expression is important for CD4 Th2 cells as GATA-3 mRNA is expressed in low level in naïve cell, it up regulates along Th2 lineage and down regulates in Th1. (Zhang et al.1997).GATA-3 does not regulate IL-13 and IL-4 directly but considered to be chromatin remodeling factor.(Ray and cohn,1997)

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

"Adapted from Michelle M. Epstein et.al, (2006) Targeting memory Th2 cells for the treatment of allergic asthma, Pharmacology & Therapeutics 109,107- 136 ".

Allergic immunity triggering the allergic asthma. A) Allergens are uptaken by antigen presenting cell in lungs. B) It is in future processed into peptides that are complexes with MHC class-II and are transported to cell surface. The interaction of complex with T cell receptor on naïve cell stimulation C) Th2 differentiation D) Expansion of Th2 effector and memory cells

IL-13 is central medicate of asthma and helps in the effective treatment which is done by neutralizing IL-13. These interlukins are effective on B cells and monocytes but studies conducted in animal models reveled that it involved in antibody neutralization and acts as potent antagonist. It induces IGE production (Wills-Karp et al. 1998).IL-13 expression was found in allergen induced late nasal response (Ghaffar O.et.al. 1997). Increased IL-13 was expression found in bronchial biopsies from atopic and atopic asthma. It is demonstrated that various signaling pathways are in regulation of IL-13 synthesis in human T cells. (Kotsimbos TC.et.al.1998) At present there is wealth of research underway on characterization of IL-13 inhibitor to be exploited to find a new drug for asthma.

Summarise what is known about a) the mechanism by which IL-13 expression is regulated and b) functional polymorphism in the IL-13 gene.

Regulation of IL-13 expression:

Mechanism of expression of IL-13 was regulated by various pathways such as Janus family Kinase and STAT6 pathway. The IL-13R is signaling human receptor which is hetero dimer. The IL-13R consists of interlukin-4 receptor chain an IL-4Ra and IL-13 binding chain. Association of IL-13 with its receptor STAT6 (Signal transducter and activation of transcription 6) and Janus family Kinase activation is induced due to interaction with IL-4Ra chain. (Franklin J. Moy et. al. 2001).

IL-13 promoter has GATA binding site and 2 GATA motifs.GATA- 3 is found to regulate the expression of IL-13 and up regulate the expression of Il-13 in transgenic mice model . (Cecile Lavenu-Bombled et.al. 2002).

Kiesler P.et al (2009), studies demonstrates that Oct-1 binds to C alleles at position -1512 of the IL13 promoter and enhances IL-13 activity. In animal model IL-13 expression is controlled by Oct-1 level in wild and mutated mice.

Functional Polymorphisms in the IL13 gene

Research undergone by Arizone respiratory center in search of SNP across locus of IL-13 showed seven polymorphism and two promoters are found in the 5' end of the gene such as IL13-1512AC and IL13-1112CT.In 3'end of the gene extends from IL13+1923CT in third intron to IL13+2749CT in 3' untranslated region. Enhancement of IL13 activity in the asthma was observed after substitution of glutamine by arginine at position 130. (Donata Vercelli et.al 2002)

Adapted from "Donata Vercelli ( 2008) Discovering susceptibility genes for asthma and allergy Nature Reviews Immunology 8, 169-182"

Genetic variation in Interleukin-13 locus was analyzed by SNP.A) SNP block was formed to be present at 3' end of the gene extending from IL13+1923CT in third intron to IL13+2749CT .B) Illustrates SNP nomenclature in human and mice there was increased IL13 transcription and mouse Th2 cells in IL13-11112CT/re180029.C) Non synonymous SNP in 3'block IL13+2044GA results in IL13 Arg130Gln.D) Seattle SNPs which provides visual genotype. These are polymorphic site which has homozygous rare alleles (yellow), homozygous common allele (grey), heterozygous both alleles (purple) and genotype not determined.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

To test the functionality of the IL-13 HS4-1512C/A polymorphism in mouse Th2 and human T cells the authors made two type of construct. Describe these construct which allele at -1512C/A was more successful at enhancing expression of luciferase reporter, by how much, what controls were used?

2666IL13p/luc and HS4 luc Construct

Two reporters construct such as 2666IL13p/luc and HS4 luc was employed to analyze the role of IL13 HS4 1512A/C polymorphism located in the distal promoter region of IL13 gene. Reporter construct 2666IL13p/luc was generated by performing Polymerase chain Reaction with genomic DNA incurred from IL13-1512 variant as a PCR template. The construct was then cloned to pG13 basic luciferase vector (Cameron,L.,et.al.2006). pGL3 vector has good flexibility in cloning regulatory sequence as it lacks eukaryotic promoter and regulatory sequence. (Figure:3) (Schenborn,E.,et.al.1991).site directed mutagenesis which wuickly changes the base pair was applied to generate luciferase reporter construct -2666IL13p-1512c/luc from -2666IL13p/luc construct driven by the with major IL13-1512A promoter variant.HS6/luc comprising of a 363bp region which includes human IL13 proximal promoter was incorporated into pG13 vector for cloning.(Strempel,J.M.et.al.2007)

Amplification of HS4 was performed using template such as -2666IL13p/luc or -2666IL13p-1512/luc and HS4-1650(5'-ATACTCGTCGACATAAGGGGCGTTGACTCAC) and HS4-1435(5'-TTGATGTCGACTCTGACTCCCAGAAGTCTG) primers. These amplicons are inserted into multiple cloning site of Sal I restriction site of HS6/luc which generates HS4-1512A/luc and HS4-1512C/luc.

"Adapted from promega website"

Map of Vector pGL3-Basic vector : luc+CDNA which encods the modified firefly luciferase, AMpr -Amplicillin resistance in E.coli.Direction of transcription is indicated by arrows with luc+ and AMpr gene.

Three sets of experiments were performed to explore the activity of allele IL13-1512A/C polymorphism and significant effect on IL-13 expression. Murine Th2 were nucleofected construct such as HS6/luc (comprising proximal promoter region of IL-13), HS4/luc-1512A and HS4 luc-1512C respectively. HS6/luc was used as control. The results show 20 fold increase in the luciferase activity in cells carrying HS4-1512C/luc (P=0.0003) (Figure:4a) when carried with HS4-1512A/luc (p=0.0004) (Figure:4a). In another two experiments, Th2 cells taken from murine and human Tcells were nucleofected with -2666IL-13A/luc and -2666IL-13C/luc respectively. Approximately, an increase of 7 fold was observed in the reporter activity in human Th2 cells. These results illustrate that IL13-1512C allele increases the activity of luciferase reporter and IL-13 expression (Kiesler.et.al.2009).

"Adapted from Kiesler p.et al. (2009) Human Molecular Genetics 18,4513-4520"

IL13-1512C catalyses Hs4 dependent IL-13 expression. A) and C) Transfection with HS4 luc constructs after the proliferation of Th2 murine cell. A-2666IL-13p/luc construct C.)After post transfection, Harvesting of cells with -A or C at -1512 position was done. RLA is used to interpret the results. D)-2666IL13p/luc containing -A or C at -1512 positions are nucleofection of Jurkat T cells and statistical values are used to express the results in fold induction value.

Write down 3 major conclusion drawn by the authors about protein factors that bind differentially to the HS4 alleles using the electromobility shift assay(EMSA) data presented in Figure 2. Make sure you explain where the data supporting each conclusion are shown in the Figure.

The characterizations of molecular mechanism of IL-13-1512 alleles, 3 conclusions were drawn by authors using EMSA analysis.

Firstly, A specific complex which binds with HS4-1512 C (lane 5-6 Fig 5a) but not with HS4-1512A (lane 1-2 Fig 5a). When oligonucleotide competitor containing an octamer motif (5'GGATGCAAATATGCAAATATGCAAATGG3') was added in the experiment, complex did not appear (lane 2 Fig 5b) but it appeared on addition of disrupted oligonucleotide (Lane 3 Fig 5b).

Secondly, from EMSA analysis it is also suggested that Oct-1 has possibility to form a direct complex with DNA as a result of interaction of recombinant Oct-1 with -1512C allele and octamer probe.(lane 11, Fig 5b).

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Thirdly,IL13-1512C allele was found to form Oct-1 binding motif due to replacement of A with C in IL-13 promoter. Specific binding of Oct-1 was confirmed by experiment with anti Oct-1 specific (absences of Oct-1 lane 11 Fig 5a) and control antibody IgG? (presences of Oct-1 lane 12 Fig 5a).

"Adapted from Kiesler p.et al. (2009) Human Molecular Genetics 18,4513-4520"

EMSA illustrating selective binding of Oct-1 after incubating with Th2 murine cells. A) Th2 human cells B) Details of experimental condition and EMSA probe are shown below the gel and competitor and supershifting of antibodies that were added is denoted above the lane.

Describe the TaqMan assay for quantitative PCR and explain how it was used in this study to demonstrate preferential binding of Oct-1 to the HS4 C-allele.

The TaqMan probe was developed by applying Biosystems named after a computer game called Pac Man which has similar principle to increase the specificity by replacing post amplification step with laser detection in real time PCR assay. The principle is based on 5'-3' exonuclease activity of DNA polymerase to cleave fluorescent dye labelled probe. The TaqMan probe comprises of two fluorescent tags namely reporter dye such as 6 carboxyfluorescein (FAM) attached to 5' end and quencher molecule e.g. 6-carboxy tetramethylrhodamine (TAMARA) attached to 3' end. (Figure: 6)

It helps in the degradation of the TaqMan probe, by enzyme called Taq DNA polymerase which helps the reporter dye eluding quenching activity of TAMARA. Hence fluorescent activity is proportional to final PCR product i.e., fluorescent activity increases with increase in cleavage of probe.

ABI prism 7900 monitors the position of 96 well micro titer plates at 8 times per minute. Data are stored in real time determination and at the end of 40 cycles all data are stored in SDS file for quantitative analysis. (Leutenegger.2001).

TaqMan SNP allelic determination assay and allele specific chromatin immunoprecipitation was employed to demonstrate binding of Oct-1 and HS4 allele. The chromatin isolated from peripheral blood CD4+ T cell heterozygous at IL-13 -1512A>C was crosslinked, sonicated and immunoprecipitated with anti Oct-1antibody or control IgG antibody. The quantification of sample was performed using TaqMan assay that amplifies 68 bp polymorphic region of distal promoter of human (-1517- 1479) TL13 and analyses the binding between HS4 and Oct-1 with two allele specific reporter probes namely VIC dye and FAM dye which identifies -1512A and -1512C alleles respectively. The signal ratio of two reporter dye VIM/FAM was consistently equal to 1 over different orders of input DNA. The results were interpreted in terms of relative copy number ie, the ratio between the number of HS4 target immunoprecipitation with Oct-1 and with control IgG Ab respectively. (Fig 6a and Fig 6b)

Kiesler p.et al. (2009) Human Molecular Genetics 18,4513-4520"

Allele specific recruitment of Oct -1 and HS4 allele. A) Results of VIC:FAM signal B) HS4 target ration with antiOct-1 and control IgAb preformed in 3 different experiment.

Does Oct-1 binding to HS4 enhance or repress IL13 expression? Explain your reasoning.

HS4 present in IL-13 distal promoter acts as cis-regulating element which regulates the IL-13 expression. The enhanced activity of HS4 can be found upon binding of transcription factor such as NF90 and NF45 (NF-nuclear factor) to 3' end of this element. (Agarwal,S.et.al.2000). Oct-1 is expressed everywhere in T lymphocyte which triggered tissue specific gene transcription by interacting specifically with NFAT family protein within hypersensitive (HS) site. (Kym et.al.1997) .However, the IL-13-1512C alleles of distal IL-13 promoter creates a binding site for Oct-1 and endogenous level of Oct-1 was dependent on enhance HS4 sites. Collectively, these results illustrate that Oct-1 binding to HS4 enhances IL-13 expression.

Explain the assay the author used to demonstrate that differential expression of the HS4 A and C-alleles is sensitive to levels of Oct-1 in the cell.

Polarization process was used to generate Th2 cells from C57B2/6 wild type or Oct+/1 heterozygous mice for 9-10 days.

CYTOKINE STAINING

Th2 cell polarization was then assessed by intercellular cytokine staining to determine the pattern of cytokine expression in differentiated CD+ Tcells in which IL-4, IL-13 and IFN-? were stained intracellularly. (Webster et.al., 2006).These colour coded beads are covalently attached to specific monoclonal antibodies against IL-13 and IL-4 (taken as control) in order to bind with mice IL-13 in the sample. The conjugated beads are allowed to react with a sample comprising of a known standard or unknown amount of cytokines. After incubation, unbound cytokines are removed by washing, biotinylated detection antibodies to different epitope on each cytokines are added to the reaction. After addition of streptavidin phycoerthrin which has fluorescence property to distinguish from the beads. The concentration of cytokines of sample is detected by flow cytometry which measured fluorescent intensity of conjugate which is directly proportional to the levels of IL 13 and IL4. The expression level of IL 13 and IL-4 are nearly the same in both Oct+/+ and Oct+/- as shown in figure 8 A and 8 B. After staining cytokines, from Oct+/+ and Oct +/- amice, Th2 cells are taken and subjected to nucleofection with Hs4/luc (Fig. 8C) having A or C at -1512 site and 2666IL13p/Luc(fig 8D) constructs.

LUCIFERASE AND BCA ASSAY

Luciferase assay was used to assess the luciferase activity in the cell and BCA (Bicinchonic activity) was used to estimate the total protein concentration of the cell.

Luciferase assay is used to catalyze a cheiluminiscent oxidation reduction reaction in the presence of luciferase:
       " luciferase substrate (luciferin) + ATP + O2 →
        oxyluciferin + light (560 nm) + AMP + PPi + CO2"

"Adapted from stratagene"

The emission of light is the measure of luciferase activity which is detected by luminometer. (Stratagene protocols) .Although, estimation of the protein by BCA is based on principle of formation Cu2+ complex and reduction of Cu++. Then the level of protein in the sample is proportional to reduction reaction. The relative luciferase activity units (RIA) is used to express the sensitivity of HS4-1512C and HS4-1512A to the level of Oct-1. Relative Luciferase activity and total protein content are assessed by luciferase and Bicinchoninic assay respectively (fig 8E and 8F).

HS4 -1512A/C alleles increased expression in the nuclear environment to the level of Oct-1. Immunofluorescence assay showed expression of il-13(A ) and IL-4(B)(taken as control) on nucleofection of Th2 cells taken from Oct+/+ and Oct +/- mice with HS4/ luc construct (c) and -2666Il13p/luc construct(D). The transfection efficiency and total protein content were expressed as relative luciferase activity (E and F). Less activity was observed in -1512A alleles than -1512C allele towards the level of Oct-1 in both wild type and mutated cells because -1512A did not octamer binding motif (reference). RLA results show that the cells were nucleofected with HS4/luc (E) and -2666IL13p/luc (F).

Suggest one additional experiment that could have been used to investigate the influence of Oct-1 levels in the cell on IL-13 expression?

siRNA (coding for oct1) mediated transfection of murine and Th2 cells using the liposomesor miRNA (coding for oct1)to investigate the influence of oct 1 level in the cells on IL13 expression can be used. It is then transfection by using GATEWAY recombination vector. In this vector, the gene of interest is amplified with attB tagged primer pair.The PCR which has attP site results in formation of clones. The resulting clone has gene of interest. This vector has various advantages such as supports site directed mutagenesis and Mutiple gene can be transfected. As the CD4+ and stem cells are very difficult totransduce with vectors. Lentiviral vectors can also be used in this case with TET ON/OFF system (high level of expression) containing oct1 construct. (Yin.et.al.1996). Fluorescent assay can be used for protein detection/ expression.

Summarise the significance of the HS4-1512C/A polymorphism in asthma/allergy predisposition.

Previous findings emancipates that In asthma, the genetic and environmental factor plays an essential role in the pathogenesis as it is considered to be hereditary and familial disease. H Li et.al, investigated children of Chinese Han nationality for the development asthma. The research was carried out to find the association between the single and combined association between 8 SNP loci in 5 genes. Results suggest that Only little contribution is made in development of asthma with 6 loci (IL-13, IL-12T,IL-Bl1923T,IL-590T). Findings show that carrier of both T/T or A/A are more to predisposited to asthma than either single or no SNP. Hypersensitive site 4(HS4) cis regulating element present in the distal promoter region of IL13 gene HS4 site (-1650 to-1435,numbering is relative to IL1ATG) up regulates the IL13 expressions and has a SNP of IL13-1512A/C which is linked with Ig E levels. Cui et.a,l has as found a similar result and thus confirms that homozygosity for -109T alleled associated with increased IgE level in asthma. Association between IL-13 1512A>C in atopic asthma children in Korea is being noticed and also shows high IgE levels. To summaries, researches done so far are exploited to find the contribution of asthmatic phenotype to elucidate the cause of disease.

Bibliography

  1. Agarwal, S., Avni, O. and Rao, A. (2000) Cell-type-restricted binding of the transcription factor NFAT to a distal IL-4 enhancer in vivo. Immunity, 12, 643-652.Biol., 24, 1022-1032.
  2. Cameron, L., Webster, R.B., Strempel, J.M., Kiesler, P., Kabesch, M.,Ramachandran, H., Yu, L., Stern, D.A., Graves, P.E., Lohman, I.C. (2006) Th2-selective enhancement of human IL13 transcription by IL13-1112C.T, a polymorphism associated with allergic inflammation.
  3. Christian M. Leutenegger (2001) The Real-Time TaqMan PCR and Applications in Veterinary Medicine Veterinary Sciences Tomorrow
  4. Cohn, L., Homer, R. J., Marinov, A., Rankin, J., & Bottomly, K. (1997). Induction of airway mucus production By T helper 2 (Th2) cells: a critical role for interleukin 4 in cell recruitment but not mucus production. J Exp Med 186, 1737-1747.
  5. Donata Vercelli (2008) Discovering susceptibility genes for asthma and allergy Nature Reviews Immunology 8, 169-182
  6. Franklin J. Moy, Elizabeth Diblasio2, James Wilhelm and Robert Powers, Solution Structure of Human IL-13 and Implication for Receptor Binding J. Mol. Biol. (2001) 310, 219±230
  7. Ghaffar O, Laberge S, Jacobson MR, et al. (1997) IL-13 mRNA and immunoreactivity in allergen-induced rhinitis: comparison with IL-4 expression and modulation by topical glucocorticoid therapy. Am J Respir Cell Mol Biol;17:17±24.
  8. GruÈ nig G, Warnock M, Wakil AE, et al. (1998) Requirement for IL-13 independentlyof IL-4 in experimental asthma. Science; 282:2261±2263.
  9. Patricia Kiesler,Arvind Shakya,Dean Tantin and Donata vercelli.(2009), Functional Characterization of an Allergy-Associated Regulatory J. Immunol., 177, 8633-8642.in allergen-induced rhinitis: comparison with IL-4 expression and modulation by topical glucocorticoid therapy. Am J Respir Cell Mol Biol ;17:17±24.
  10. Killar, L., MacDonald, G., West, J., Woods, A., & Bottomly, K. (1987).Cloned Ia restricted T cells that do not produce IL4/BSF-1 fail to help antigen specific B cells. J Immunol 138, 1674± 1679.
  11. Kim, H.B., Lee, Y.C., Lee, S.Y., Jung, J., Jin, H.S., Kim, J.H., Kim, B.S.,Kang, M.J., Jang, S.O.,
  12. Kim, J. et al. (2006) Gene-gene interaction between IL-13 and IL-13Ralpha1 is associated with total IgE in Korean children with atopic asthma. J. Hum. Genet., 51, 1055-1062.
  13. Kotsimbos TC, Ghaffar O, Minshall EM, et al (1998). Expression of the IL-4 receptor alpha-subunit is increased in bronchial biopsy specimens from atopic and nonatopic asthmatic subjects. J Allergy Clin Immunol; 102:859±866.
  14. Kym N. Duncliffe, Andrew G. Bert, Mathew A. Vadas, and Peter N. Cockerill(1997)A T Cell-Specific Enhancer in the Interleukin-3. Locus Is Activated Cooperatively by Oct and NFAT Elements within a DNase I-Hypersensitive Site. Immunity, Vol. 6, 175-185
  15. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A., & Coffman, R. L. (1986). Two types of murine helper T cell clone: I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol 136, 2348± 2357
  16. Schenborn, E. and Goiffon, V. (1991) Optimization of Transfectam®-mediated transfection using a luciferase reporter system. Promega Notes 33, 8-11.
  17. Strempel, J.M. and Vercelli, D. (2007) Functional dissection Identifies a CNS-1 core that mediates IL13 and IL4 transcriptional enhancement. J. Biol. Chem., 282, 3738-3746.
  18. Thomas A. Wynn (2003) IL-13 effector functions, Annual Review of Immunology Vol.21:425-456
  19. Wang, V.E., Schmidt, T., Chen, J., Sharp, P.A. and Tantin, D. (2004) Embryonic lethality, decreased erythropoiesis, and defective octamer-dependent promoter activation in Oct-1-deficient mice. Mol. Cell.
  20. Webster, R.B., Rodriguez, Y., Klimecki, W.T. and Vercelli, D. (2007).The human IL-13 locus in neonatal CD4þ T cells is refractory to the acquisition of a repressive chromatin architecture. J. Biol. Chem., 282, 700-709.
  21. Wills-Karp M, Luyimbazi J, Xu X, (1998) Interleukin-13: Central mediator of allergic asthma. Science; 282:2258±2261.
  22. Wills-Karp, M., Luyimbazi, J., Xu, X., Schofield, B., Neben, T. Y., Karp,C. L., (1998). Interleukin-13: central mediator of allergic asthma. Science 282, 2258- 2261.
  23. Yamashita, M., Shinnakasu, R., Nigo, Y., Kimura, M., Hasegawa, A., Taniguchi, M., (2004). Interleukin (IL)-4-independent maintenance of histone modification of the IL-4 gene loci in memory Th2 cells. J Biol Chem 279, 39454- 39464.
  24. Yin,D.X.,Zhu,L.&Schimke,R.T(1996) Teracycline controlled gene expression system achieves high level and quantitative control of gene expression
  25. Zhang, D. H., Cohn, L., Ray, P., Bottomly, K., & Ray, A. (1997).Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression
  26. Zhang, D. H., Yang, L., Cohn, L., Parkyn, L., Homer, R., Ray, P.(1999). Inhibition of allergic inflammation in a murine model of asthma by expression of a dominant-negative mutant of GATA-3. Immunity 11,473- 482.
  27. Zhu, Z., Zheng, T., Homer, R. J., Kim, Y. K., Chen, N. Y., Cohn, L., (2004). Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678- 1682.