Identification Of Human Parechovirus In Clinical Sample Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The identification of Human Parechovirus in the clinical sample taken from a child with mild diarrhoea was being diagnosed by using various molecular techniques. The Parechovirus is RNA virus which consists of 14 genotypes HPeV1 to HPeV14. Recombination plays an important role in the diversity of Parechovirus. The viral infections are seen mostly in children under 3 years various symptoms of gastric, respiratory, neurological illness which can be fatal. In this study the viral genome is found to be RNA which is isolated from the given clinical sample and analysed using gel electrophoresis. The DNA obtained from RNA involved by the reverse transcriptase activity was used for RT-PCR amplification. The amplicon had undergone TA cloning by Transformation in the competent E.coli cells. The plasmid DNA was isolated and undergone restriction enzyme digestion. The DNA is sequenced and analysed using Bioinformatics tools. The genomic analysis done by multiple sequence alignment and calculated phylogenetic tree showing the genetic relationship with the sequences of various Parechovirus type. The result had shown the presence of similarity with HPeV1 type Parechovirus. The significance in the study of this virus is that the clinical manifestation of Parechovirus is found all over the globe which needs to be under investigated to reveal more hidden facts regarding this virus.

Introduction

The viral genus Parechovirus belongs to the family of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of rodents, were isolated from bank voles in Sweden from a patient infected with myocarditis. It shares similarity with Human Parechoviruses.

The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to produce the diversity in Parechoviruses.

The viruses are 7100 to 8500 nucleotides long which are enclosed in an icosahedral capsid made up of 60 copies each of capsid proteins VP1 to VP4. Formerly the HPeV1 and HPeV2 were known as echovirus 22 and 23 respectively. HPeV2 has 87.9% aminoacid identity with HPeV1 genotype. Both were first isolated in1956 during an epidermic of summer diarrhoea.

The genome has four distant domains. The 5' untranslated region (UTR) precedes a single open reading frame, towards downstream there is a 3'untranslated region and a poly (A) tail. The genome encoding a single protein is processed by many virus encoded enzymes which produces precursors that function in virus replication to produce protein finally.

Figure 1: The genome of Picorna virus with schematic representation of poly protein in Parecho virus. The peptide covalently bound to 5'end. The vertical arrows indicate the virus encoded activities for processing proteins. The positions of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein respectively

(Source: Stanway, G.et al (1999) Parechoviruses.Journal of Virology, 73, 5249-5254).

In general, all Picorna viruses have same basic genomic organization, but different genotypes show specific characteristics in 5'UTR structure, L and 2Aproteins and 3'UTR. There exists similarity in 5'UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the evolution of parechoviruses. (Stanway,G. et al, (1998) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650)

The Parechovirus shows various responses in host cells. The cleavage of capsid protein VP0 seen in other Picorna viruses are not found in Parechovirus. It has a unique extension at N-terminal of capsid protein, VP3 and 2A protein which is highly basic in character.

(Stanway, G. et al,(2000)Human parechoviruses- biology and clinical significance, Reviews in Medical Virology,10,57-69.)

Many recent studies shown that the Parechoviruses are having high rate of pathogenicity which causes gastroenteritis, respiratory illness, febrile illness, exanthema,' hand, foot and mouth disease', aseptic meningitis, herpangia. The more prevalence of Parechovirus infections are found in children less than 3 years.

According to a research done by Miyabi Ito.et al on clinical stool samples from a random population in Aichi, Japan suggests that the nucleotide and aminoacid sequence of Japanese HPeV-3 was similar to that found in Canada and Netherlands. The study confirms the worldwide prevalence of Human Parechovirus infection. Also they concluded that 97% of patients were younger than 3 years old, and among them 86.2% were under 12 months old.

The determination of nucleotide sequence and phylogenetic analysis of VP1 region and 5'UTR region revealed that majority were having HPeV1 infection, then comes HPeV3, then HPeV4 and finally less number with HPeV6. They also found some seasonal variation influencing the clinical manifestation of Parechovirus. HPeV1 detected predominantly during fall and winter while HPeV3 cases detected in summer and fall. They came to a conclusion that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. (Miyabi Ito et al (2010) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688)

Based on the study of the antigenic properties of human Parechoviruses done by Paivi Joki Korpela. et al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal region. The immunological characteristics of HPeV1 capsid protein was also found out using the peptide scanning techniques. (Korpela, P.J et al (2000) Antigenic properties of human parechovirus1, Journal of General Virology, 81, 1709-1718)

Studies reveal that HPeV infects the central nervous system (CNS) in children associated with severe neonatal sepsis like illness, meningitis or paralysis. A group of scientists under the guidance of S.Rangraj has done studies on HPeV-CNS infection in United States. This was the first multiyear prevalence report of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of children around the Kansas City for 3 years 2006 to 2008. HPeV RT-PCR was used and studies done by sequencing VP3/VP1 junction. They could detect the HPeV in 7% cerebrospinal fluid samples taken from patients, and the detection was seasonal from June to October. HPeV3-CNS infection was found in 71% of male infants. Most common clinical symptoms were sepsis like illness (66%), irritability (98%), fever (95%) and non-specific rashes (58.6%).(Rangaraj.S et al (2010) Human parechovirus3 causing sepsis like illness in children from Midwestern United States, The Pediatric Infections Disease Journal, www.journals.iww.com)

The prevalence of worldwide pathogenesis shown by Parechovirus is evidently proved by Pham et al by doing the research in 362 faecal samples for the detection of HPeV types in one year 2005 to 2006. They have done the study in many children who got infected with gastroenteritis in Srilanka. Out of 362 samples, 30 were positive with HPeV (8.3%).The genotypes isolated were HPeV1, 3,4,5,10,11. (Pham.N.T.K et al (2010) Human Parechovirus infection in children hospitalized with acute gastroenteritis in Srilanka, Journal of clinical microbiology, www.mdlinx.com).

The viral RNA replication complex in HPeV1 infected cells would contain the viral protein and membrane alterations. The structural changes in virus infected cells include the Golgi apparatus disintegration and loss of ribosomes from endoplasmic reticulum. The viral plus strand RNA and 2C viral proteins were found as clusters of small vesicles in cells. The membrane binding properties of protein 2C resulted in the finding of its presence in Golgi apparatus and endoplasmic reticulum. HPeV1 replication complex is formed by Golgi marker vesicles forms a unique structure among other Picorna viruses. (Krogerus.C et.al (2003) Replication complex of human Parechovirus 1, Journal of Virology, 77, 8512-8523)

In this study, the clinical sample from a child with mild diarrhoea is taken which is analysed using various molecular techniques, in particular RT-PCR. The study included the detection and analysis of viral RNA, suspecting it as HPeV by diagnosing the specific symptoms shown by the patient. The RT-PCR is done by using HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations using Gene service.T7 and SP6 RNA polymerase transcription initiation sites of pGEM (R)-T Easy vector is used for this purpose. The Analysis of DNA sequence is done further using Bioinformatics tools. It offers a quick method of detecting Parechovirus and identifying which of its genotype is present in the clinical sample.

Materials and Methods

All the molecular methods were done on the basis of protocol given in Stanway, G. (2009) Practical Handbook. The RNA being isolated from the clinical sample using commercial kit, 'QIA amp(R) viral RNA mini kit' produced by Qiagen. The kit works on the principle of selective binding properties of silica gel.

(http://www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp).

The RT-PCR has done along with negative control and marker DNA (supplied by Invitrogen). Two primers OL993A and OL994A were used that are complimentary to the 3'end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by using the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective plates containing Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 restriction digestion. The sample was then commercially sequenced using Geneservice. The analysis of DNA sequence has been done with Blast program (http://www.ncbi.nlm.nih.gov/BLAST) and alignment with Clustalw program (http://www.ebi.ac.uk/tools/clustalw/index.html).

(Stanway, G. (2009) BS934 Practical Handbook- Molecular Medicine Pathway)

Result

Isolation of RNA from clinical sample:

RNA band

DNA marker band

Figure 2: The Agarose gel electrophoresis photograph of isolated RNA sample.

The RNA was isolated using Qiagen viral RNA isolation kit. The electrophoresis was done along with DNA marker (1kb ladder supplied by Invitrogen) and visualized the RNA band using gel documentation equipment. The RNA material was seen as a smear on the Agarose gel.

RT-PCR DNA:

Negative Control

RT-PCR product

DNA Marker

Figure 3: The photograph of Ethidium bromide stained RT-PCR DNA after Agarose gel electrophoresis.

As per the protocol given in Stanway, G. (2009) Practical Handbook, the RT-PCR has done along with negative control and marker DNA (supplied by Invitrogen). It is found out that the RT-PCR DNA band has been visualised using gel documentation equipment. The presence of band confirmed the presence of HPeV in the clinical sample. There was no band seen in the negative control showing the genuine result without any sort of contamination. The approximate size of the product is obtained by comparing with the 1kb size standard DNA marker band.

RT-PCR calibrated plot for determining the molecular weight of DNA sample:

Distance migrated by unknown DNA sample= 37mm

Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel electrophoresis.

The unknown molecular weight of the RT-PCR sample is calculated from the graph (fig: 4) which was migrated to a distance of 37mm was found to be approximately 1000 bp (inverse log 3).

Final gel result:

1 2 3 4

Figure5: The Agarose gel photograph

obtained in 2010 practical.

In the fig: 5, the bands were obtained for the RT-PCR DNA and EcoR1cut DNA from white colony (Lane 2 and 4 respectively).

There was no band formed for the EcoR1 cut DNA from the blue colony (Lane 3).

DNA marker

RT-PCR DNA from white colony

EcoR1 cut DNA from blue colony

EcoR1 cut DNA from white colony

Figure 6: The Agarose gel photograph

from 2009 practical for

comparative study. The band

formed by EcoR1 cut DNA

from blue colony can be seen.

Multiple sequence alignment of DNA sample using Clustalw program:

HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59

HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59

Consensus ---GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57

HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59

HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59

HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59

HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59

HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59

HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59

** ** * ** ** ** * * * ** *** * ** * ** **

HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119

HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119

Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117

HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119

HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119

HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119

HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119

HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119

HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119

** ** ** ***** ** * ** ** ** ***** ** * ** ** * *

HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179

HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179

Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177

HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179

HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179

HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179

HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179

HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179

HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179

* **** ** ** ** ** * ** ** ** ** ** ** * ***** * **

HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239

HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239

Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237

HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239

HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239

HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239

HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239

HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239

HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239

**** ** * * * * *** * **

HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299

HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299

Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297

HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299

HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299

HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299

HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299

HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299

HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299

** * ** ** ** * * * ** * ** * * ** ** * **

HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359

HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359

Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357

HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359

HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359

HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359

HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359

HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359

HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359

* *** * * * * ** ** * * ** ** * ******

HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419

HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419

Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417

HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419

HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419

HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419

HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419

HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419

HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419

* * * ** * ** * ** ** * ** ** ** **

HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479

HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479

Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477

HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479

HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479

HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479

HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479

HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479

HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479

** *** * * ** * ** * ** ** * ** * * ** * *

HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539

HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539

Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537

HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539

HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539

HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539

HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539

HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539

HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539

* ** * * ** ** * ** ** *

HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599

HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599

Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597

HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599

HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599

HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599

HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599

HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599

HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599

** * * * ** * ** ** ** ** * ** ** ** ** ** ** *

HPeV1 TAC---------G---AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647

HPeV6 CACACCACGCTCG---CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656

Consensus AAC---------A---ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645

HPeV4 TGC---------A---ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647

HPeV5 GAA---------A---ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647

HPeV2 AGC---------------AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644

HPeV7 AATTAATACTACA---CCAATAGGC---TACAGTAACGAAAGCCCATATGGTCAAGAACA 653

HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG---AAGCACC 656

HPeV3 AACTGGTTCAAGG--GCTACAGCAC----TTTCTGATGAG-------------------- 633

**

HPeV1 G-------- 648

HPeV6 G-------- 657

Consensus ---------

HPeV4 G-------- 648

HPeV5 G-------- 648

HPeV2 A-------- 645

HPeV7 AGTGACAAC 662

HPeV8 AAT------ 659

HPeV3 ---------

Discussion:

I have started the experiment with an assumption of HPeV virus infected the child showing mild diarrhoea. The isolation of viral genome from the clinical sample using Qiagen kit (principle: selective binding properties of silica gel) and Agarose gel electrophoresis proved that the viral genome was RNA. From analysing the Agarose gel photographic image it clearly showed that the RNA isolation was successful (Fig: 2).

From the gel photographic image of RT-PCR(Fig:3), we can assume that the PCR product DNA is having a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel(Fig:4), I could prove the approximate molecular weight of DNA sample after PCR which is closer to the assumed value got from gel electrophoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to amplify under specific thermal cycles. The absence of band in the negative control shows the RT- PCR done was correct without any contamination. The RT-PCR has helped to reveal quick DNA amplification which is advantageous over traditional PCR. It also collects data in the exponential growth phase whereas traditional PCR is measured at the end point.

The cloning of PCR product done using pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase promoters. A group of scientist under Smeekens.S.P has done their study on T7 promoter sequence. T7 RNA polymerase which has specific binding properties with T7 promoters determines the replication of bacteriophage. The promoter specific binding was shown to be insensitive to variation in the ionic strength of incubation solution but found sensitive to DNA helix. The efficiency of polymerase-promoter open complexes are determination factors of transcription. (Smeekens.S.P et.al(1986)Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford journal on Nucleic acids Research,14,2811-2827)

The main purpose of using the pGEM R -T easy vector is that, it is having multiple cloning regions. It has ampicillin resistance gene which would make the host cell to survive in ampicillin rich medium. There are EcoR1 restriction enzyme recognition sites on both sides of ligated RT-PCR product in the vector. Thus the plasmid isolation after the Transformation is done using EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR product into vector. The DNA with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to make it competent using CaCl2 .

If the whole process was successful we would have got blue and white colonies of cloned cells in the LB broth plates. But the blue colonies were not able to distinguish properly in the midst of other ampicillin sensitive colonies. The reason for the over growth of unwanted colonies might be due to the low concentration of Ampicillin added as experimental error. Thus the ampicillin sensitive cells also multiplied along with cells containing vector and gene of interest. As a result there was no band produced in the Agarose gel electrophoresis from the blue colony cells.

The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The DNA sequence is analysed using the software program. The determination of direct or indirect orientation of DNA sequence is done using Blast nucleotide searches. The T7 belonged to human parechovirus1 (length7380) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 (length 7380) was found to be indirect with +/- strands. The reverse compliment for SP6 was taken and the alignment done using Clustalw. Then with different HPeV type sequences the consensus sequences are compared using Clustalw. By analysing the sequences and phylogenetic tree the sequence isolated from clinical sample has similar ancestral origin with HPeV1 type Parechovirus. Hence it is identified that the child is infected with Parechovirus type1 infection.

Acknowledgement:

I would like to extend my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and guidance for my practical work.

I am also extending my thanks to Ms. Maysoon, PhD student for her support during the practical work.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.