Identification And Verification Of An Insertional Mutation Present Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The main objective of this study is to investigate the effect of insertional mutation on the gene of Arabidopsis thaliana. The DNA samples were extracted from the leaf of mutant plant. The gene-specific and insert-specific primers were used to amplify the region of DNA. The PCR products were than cloned, digested and sequenced. By comparing the sequence data, it was verified that the insertional mutation was a transposon element from Zea mays which was inserted in the second axon of Peptide Methionine Suphoxide Reductase 1 (PMSR1) gene of Arabidopsis. PMSR-1 which is a ubiquitous enzyme that repairs oxidatively damaged proteins present in the cell.

Arabidopsis thaliana, a member of mustard family, is a small dicotyledonous flowering plant that serves as a model organism for understanding the complex processes required for plant growth and development. It is the most widely used plant model for genetics, developmental biologists, and molecular biologists and also for all applied plant research (Lin et al., 1999). The Arabidopsis genome was the first plant genome to be completely sequenced allowing the identification of the complete set of Arabidopsis gene, this information is available through a comprehensive on-line resource called Arabidopsis information resource (TAIR) (Rhee et al., 2002)

In this work we used the mutant plant Arabidopsis thaliana for investigating the effect of insertional mutant on the gene and also the corresponding protein. By sequencing the genes it was known that from which organism they have been isolated. This particular gene sequence and its function can be identified by using the technique called insertional mutagenesis. Insertional mutagenesis is an alternative means of disrupting gene function and is based on insertion of foreign DNA in to gene of interest. In Arabidopsis, insertional mutation involves the use of either transposable element or T-DNA. The foreign DNA not only disrupts the expression of the gene into which it is inserted but also acts as a marker for subsequent identification of the mutation (Krysan et al., 1999).

The transposable element system Enhancer (En) of Zea mays was originally identified by (Peterson, 1965).The En or Spm transposable element system of Zea mays comprises of both autonomous and non-autonomous elements. The autonomous En/Spm element encodes functions that are required for transposition. The non-autonomous elements are deletion derivatives of En/Spm elements and have been termed defective (dSpm) elements or inhibitor elements. The dSpm elements cannot produce their own excision, rather they transpose only when an active Em/Spm is present in the same genome (Pereira et al., 1986 & Frey et al., 1990). The Spm (En) element responds to the signals that arise during plant development, its activity can undergo cyclic changes from active to inactive and again back to active stages during development of plant and tissues (Schwarz-Sommer et al., 1984). The non-autonomous Ds tansposon elements in maize can transpose only when Ac transpose is provided in trans. The Ac element has been stabilised and the expression of AcTPase has been derived from strong promoters (Nakagawa et al., 2000).

There were two functions which were genetically defined by the analysis of the interactions of products encoded by En/dSpm elements; they are the suppresser function and mutator function. The autonomous element can suppress expression of certain gene in which small dSpm element is inserted within the transcribed region. In the absence of En/Spm, these genes these genes are expressed because most of the dSpm sequence was removed by splicing due to splice site at the termini of the element dSpm. The mutator function is required for excision of dSpm and En/Spm (frey et al., 1990).

In this experiment an insertion line for Arabidopsis gene can be produced by inserting the non-autonomous element into the gene of insert using T-DNA. This insertion line has to be checked for the presence of insert in the gene of interest, which was done by using PCR technique. Further the effect of insertion mutant on the gene and the type of insertion and the exact position where it was inserted into the A.thaliana gene were analysed by doing blast against the obtained PCR product sequence.

Materials and Methods

Extraction of DNA from Arabidopsis plant

The DNA was extracted using the protocol followed by Kasasima et al (2004) & Keb-Llanes et al., (2002), with some modifications. About 1cm2 of leaf was cut from mutant Arabidopsis plant for DNA extraction. A 400µl of extraction buffer (200 mM Tris-HCl (pH 7.5), 250mM NaCl, 25mM EDTA and 0.5% SDS) was added to the leaf and grounded thoroughly, and then incubated at 65°C for 30 minutes. The solution was then centrifuged at 13400rpm for 10 minutes, to 300µl of supernatant an 300µl of chloroform was added and vortexed . This was then spun at 13400rpm for 15 minutes, a 250ml of aqueous phase was taken and the DNA was precipitated by adding 250µl of isopropanol and incubated at room temperature for 15 minutes. Then it was centrifuged at 13400 rpm for 15 minutes and the supernatant was discarded carefully, then the collected pellet was washed with 500µl of ice cold 70% ethanol and air dried for 30 minutes. The DNA was then resuspended by adding 100µl of RO water. The collected DNA fragments were electrophoresed in 0.8% TBE agarose gel and stained with ethidium bromide, then the genomic DNA was visualised under UV light.

Amplification of genomic DNA

Polymerase chain reaction was done to amplify the region of interest from the extracted DNA. To each PCR tube, 5µl of DNA template was taken in different amounts; 5µl, 2µl, 1µl of undiluted DNA and DNA diluted 1:10 of 5µl, 2µl and 1µl, all the PCR samples made up to 5µl by adding water. About 15l of master mix was added to each PCR tube, which contained 9.5µl of water, 2µl of 10X PCR buffer, 2µl of DNTPs, 0.5µl of gene-specific primer, 0.5µl of insert-specific primer and 0.5µl of Taq polymerase. Therefore each PCR tube contained 20µl of reaction mixture. Then the PCR reaction was carried out, first denaturation at 94°C for 4 minutes, followed by 34 cycles of denaturation for 15 minutes at 94°C, annealing for 40 seconds at 60°C, extension for 2 minutes at 72°C and finally extension for 10 minutes at 72°C. The obtained PCR products were electrophoresed in 1.5% TBE agarose gel and stained with ethidium bromide, the PCR products were visualised under UV light.

TA cloning of PCR product

TA cloning of the PCR product was done by using the vector pCR2.1 from invitrogen. Ligation of PCR products in to pCR2.1 and the transformation into Top10 chemically competent E.coli cells were done by following the protocol from invitrogen http://tools.invitrogen.com/Content/SFS/ProductNotes/F_TOPO%20RD-MKT-TL-HL0506021.pdf with some modifications. For ligation reaction; 2µl of PCR product, 2µl of 25 ng/ml of concentrated PCR product, 1µl of 10X ligation buffer and 1µl of T4 DNA ligase. The content was made up to 10µl by adding distilled water and incubated over night at 14°C.

For transformation 2µl of ligation reaction was added to 50µl of Top10 competent E.coli cells and it was incubated on ice for 15 minutes. Then the cells were subjected to heat shock at 42°C for 30 seconds and transferred immediately on ice. A 250µl of SOC medium was added to the cells and it was incubated at 37°C for 1 hour. Plating was done to confirm the transformation, 50µl of the cells were spread onto each of two LB agar plates, and incubated overnight at 37°C.

Isolation of plasmid DNA

Three independent transformed white colonies and one blue colony which have not contained an insert in PCR 2.1 were picked and separately cultured overnight in 5 ml of LB medium. Plasmid DNA was isolated by following the protocol by Fermentas (http://www.fermentas.com/). 2 ml of each culture was centrifuged at maximum rpm for 1 minute, supernatant was discarded and the collected pellet was resuspended using buffers and centrifuged at maximum rpm for 10 minutes, supernatant was collected in the column and centrifuged for 1 minute. The collected samples were continuously washed with wash buffer. Plasmid DNA samples were obtained by eluding samples from the column by adding 50µl of water and centrifuged for 2 minutes.

Restriction endonuclease digestion and analysis of cloned product

Restriction digestion was done by adding 5 µl of master mix (5µl of 10X buffer, 5μl of EcoRI and 15μl of sterile water) to 5µl of plasmid DNA and the samples were incubated at 37°C for 1 hour. The collected products were electrophoresed in 1% TBE agarose gel and stained with ethidium bromide, the restriction digestion products were visualised under UV light. This was done to confirm that the plasmid DNA isolated from white colonies contained cloned PCR product and the plasmid DNA isolated from blue colony does not contained cloned product.

DNA sequence analysis

The plasmids that contain the cloned PCR products were sequenced. Using the two set of sequence information, one is for M13 primer and other one for T7 promoter specific primer a blast was done to confirm that the DNA sequence that was amplified by the PCR was specific to the DNA sequence across the point of insert. These sequences were compared with the genomic DNA sequence of A. Thaliana from the Arabidopsis information resource (TAIR) through BLAST tool which was done to confirm that the PMSR1 gene of Arabidopsis has been amplified. The other unmatched sequences were compared against all the known genome sequence by doing a BLAST, using NCBI.

Results

Extraction of DNA from Arabidopsis plant

The DNA fragments were electrophoresed in 0.8% TBE agarose gel. The genomic DNA corresponding to 12000 bp was extracted shown in figure 1. The huge amount of contamination was also found along with the extracted DNA, this contamination was due to presence of RNA.

Figure 1: Extraction of DNA from Arabidopsis. The genomic DNA was run on a 0.8% agarose gel and visualised under UV light. The genomic DNA about 12kb was extracted. Lane 1: Marker DNA, Lane 2: DNA sample.

Amplification of genomic DNA

A region of interest approximately 800bp of the genomic DNA was amplified. Each of the different amounts of both diluted and undiluted genomic DNA was used as a template for PCR reaction. The PCR products were run on a 1.5% agarose gel and all the visualised bands correspond to 800bp approximately was shown in figure 2. Thus all the obtained PCR products were efficient and used for cloning.

Figure 2: The PCR products were run on 1.5% agarose gel at 140V and visualised under UV light. The amplified genomic DNA of about 800bp was obtained. Lane 1: 1 kb Marker DNA. Lanes 2-7: Different amount of both diluted and undiluted genomic DNA.

TA cloning of PCR product

The TA cloning kit used for cloning of genomic DNA was found to be more efficient. The amplified DNA was mixed with vector pCR2.1 and ligated. Then the recombinant DNA was successfully transformed into E.coli cells. These transformed cells were grown overnight in LB agar plates at 37°C. As a result more numbers of white and blue colonies were observed and some white with blue colonies were also seen. Number of white colonies was approximately 256 and white colonies were approximately 78, by using this data mean transformation efficiency can be calculated.

Figure 3: Luria agar plates containing transformed E.coli cells.

Analysis of cloned product

The transformed white and blue colonies were cultured. The plasmid DNA was isolated and digested using EcoR1 restriction enzyme, this was done to confirm the presence of PCR product in the plasmid DNA. The digested products were then run on 1%TBE agarose gel. The digested plasmid DNA isolated from the white colonies shows two bands; the upper band corresponds to 4000bp which was the pCR2.1 vector and the lower band corresponds to 800bp which was the PCR product. Thus we can confirm that the cells from white colonies were transformed with a plasmid inserted with the PCR product. The digested plasmid DNA isolated from blue colonies which was considered as negative control, in this single band were obtained which was the plasmid DNA. From this it was confirmed that the plasmid DNA isolated from blue colonies does not contained cloned PCR product.

Figure 4: the plasmid DNA digested with EcoR1. The digested products were run on 1%TBE gel and the bands were visualised under UV light. Lane1: Marker DNA, Lane2-4: Restricted plasmid containing insert of PCR product from white colonies. Lane5: Restricted plasmid with no insert of PCR product from blue colonies.

DNA sequencing analysis

The plasmids containing the cloned products were sequenced. The obtained sequence information was compared against Arabidopsis genes using BLAST. The forward strand was sequenced from M13 reverse priming site and the reverse strand was sequenced from the T7 promoter.

The M13 sequence was compared against the genomic data base of A.thaliana using BLAST. It was found that except 1-93 base pairs all other bases were matching with the Peptide Methionine Sulphoxide Reductase 1 (PMSR1) gene of A.thaliana. This was shown in figure 5.1.

>AT5G61640.1 | Symbols: PMSR1, ATMSRA1 | PMSR1 (PEPTIDEMETHIONINE SULFOXIDE

REDUCTASE 1); oxidoreductase, acting on sulfur group of

donors, disulfide as acceptor /

peptide-methionine-(S)-S-oxide reductase |

chr5:24775035-24776390 FORWARD

Length = 1356

Score = 56.0 bits (28), Expect = 1e-07

Identities = 28/28 (100%)

Strand = Plus / Minus

Query: 94 attgctggtgatgttcctcagctctata 121

||||||||||||||||||||||||||||

Sbjct: 1033 attgctggtgatgttcctcagctctata 1006

Figure 5.1: BLAST result obtained using the sequence of M13

The T7 promoter sequence was compared against the genomic data base of A.thaliana using BLAST. It was found that all the bases were completely matching with the PMSR1 gene which was shown in figure 5.2.

>AT5G61640.1 | Symbols: PMSR1, ATMSRA1 | PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of

donors, disulfide as acceptor /

peptide-methionine-(S)-S-oxide reductase |

chr5:24775035-24776390 FORWARD

Length = 1356

Score = 244 bits (123), Expect = 3e-64

Identities = 123/123 (100%)

Strand = Plus / Plus

Query: 1 ctgcttgatttgttctggtctaagcatgatcccaccactttgaatcggcaggtaacgaaa 60

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct:379 ctgcttgatttgttctggtctaagcatgatcccaccactttgaatcggcaggtaacgaaa 438

Query: 61 gttttgctctttagaatgtctgattttgtgagttttaagttttgattttggtgattgagg 120

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct: 439 gttttgctctttagaatgtctgattttgtgagttttaagttttgattttggtgattgagg 498

Query: 121 aag 123

|||

Sbjct: 499 aag 501

Figure 5.2: BLAST result obtained using the sequence of T7

The sequences 1-93 from the M13 strand sequence did not match with any Arabidopsis genome sequences. To identify this 1-93 sequence, a BLAST was done against the entire nucleotide sequence data base through NCBI. It was found that the sequence 1-93, matches with the transposon element from Zea mays called Enhancer-1 (En-1) which was shown in figure 5.3.

>emb|X02332.1| Zea mays DNA fragment for deletion derivative Spm-I8 of En-I

transposable element

Length=2241

Score = 172 bits (93), Expect = 2e-40

Identities = 93/93 (100%), Gaps = 0/93 (0%)

Strand=Plus/Minus

Query 1 GGTGCAGCAAAACCCACACTTTTACTTCCATTAAGAGTGTCGGCCCCGACACTCTTTAAT 60

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 93 GGTGCAGCAAAACCCACACTTTTACTTCCATTAAGAGTGTCGGCCCCGACACTCTTTAAT 34

Query 61 TAACTGACACTCCTTTGACGTTTTCTTGTAGTG 93

|||||||||||||||||||||||||||||||||

Sbjct 33 TAACTGACACTCCTTTGACGTTTTCTTGTAGTG 1

Figure 5.3: BLAST result for the unknown insert sequence.

Discussion

The genomic DNA extracted from the Arabidopsis leaves was found to be efficient. The genomic DNA extracted was about 12KB. Using gene-specific and insert-specific primers a region about 800bp was amplified and the products obtained was about 800bp which was then successfully cloned with plasmid pCR2.1 which has multiple cloning sites inserted into LacZα gene which facilitates blue white screening of colonies.

The plasmids containing the PCR product were transformed into E.coli cells; it was then grown in LB agar plates. As a result many white and blue colonies were grown which was due to presence of LacZα gene on X-gal, used in screening of transformants. The presence of PCR product in the plasmid was confirmed by restriction digestion using EcoR1 as a result two clear bands were visualised. From these bands it was confirmed that the cells from white colonies were transformed with a plasmid inserted with the PCR product and the blue colonies did not contained cloned PCR product.

The DNA sequence was analysed, from the obtained information it was found that the non-autonomous dSpm element of the Spm (En) transposon element had inserted into the PMSR1 gene of A.thaliana. Using the obtained plasmid sequence data a blast was done to identify the insertion gene and the exact position where it was inserted into the mutant gene. From the blast result it was found that the size of the product amplified by PCR was found to be 654bp.

The sequence data obtained for transposon shows that 1-93bp of the PCR product matches with first 1-93bp of dSpm of Zea mays in reverse direction. The 94th bp of the PCR product matches with the 1033bp of the Peptide Methionine Sulphoxide Reductase 1 (PMSR1) gene. The last bp of the PCR product matches with the 379th bp of the PMSR1 gene.

It was found that, at 1034th position the non-autonomous dSpm element was inserted in to the PMSR1 gene which means that the insertion was found in the second axon of PMSR1 gene which was located at the chromosome 5 of A.thaliana genome. This PMSR1 gene is responsible for the synthesis of protein called Peptidemethionine Sulfoxide reductase-1. This insertion of dSpm element into the gene does not affect the protein synthesis and it also does not disrupt the gene expression only in the absence of Spm element. If the autonomous element is present then the gene expression is suppressed, this was because the transpose encoded by Spm binds to the end of the dSpm and stops the transcription (Pereira et al., 1986 & Frey et al., 1990).

In this experiment only the non-autonomous element dSpm was inserted and the autonomous Spm was not inserted in the inserted in the insertion lines used. Thus it can be concluded that the insertion of dSpm element in to the PMSR1 gene does not affect the gene expression and protein synthesis in A.thaliana.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.