Identification and Characteristics of a Testis-Specific Gene, Ccdc38 in Mice

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Identification and Characteristics of a Testis-Specific Gene, Ccdc38 in Mice

Shouren Lin1#, Yuchi Li1,2# , Manling Luo1,2, Huan Guo1,3, Jianbo Chen1,4, Qian Ma1, Yanli Gu1, Fangting Zhang5, Zhimao Jiang1 , Yaoting Gui1*

1Guangdong and Shenzhen Key Laboratory of Male Reproductive Medicine and Genetics, Institute of Urology, Peking University Shenzhen Hospital, Shenzhen PKU-HKUST Medical Center, Shenzhen, 518036, P.R. China

2Shantou University Medical College, Shantou, 515041, P.R. China

3Guangzhou Medical University, Guangzhou, 510182, P.R. China

4Anhui Medical University, Hefei, 230032, P.R. China

5Department of Clinical laboratory, Peking University Shenzhen Hospital, Shenzhen 518036, P.R. China

#Shouren Lin and Yuchi Li have contributed equally to this work

Correspondence should be addressed to Y Gui; Email: guiyaoting2007@aliyun.com

Abstract

Characterizing and comparing the testis-specific genes in different species can reveal key genes related to testis-specific functions and provide supplementary information for study and treatment of human infertility. Here, we have identified a testis-specific gene, Ccdc38 (Coiled-coil domain containing 38), by screening of UniGene libraries databases. Systematic bioinformatics analysis showed CCDC38 is conserved in mammalian species. We found CCDC38 was exclusively expressed in mouse testes and its expression was increased in an age-dependent manner from postnatal 2 weeks to 8 weeks by using quantitative RT-PCR (qRT-PCR) and Western blot, which indicated that CCDC38 may be associated with the meiotic process. Further immunohistochemistry analysis revealed that CCDC38 was mainly expressed in the spermatogonia and spermatocytes. The most important, immunofluorescence and co-immunoprecipitation(Co-IP) assays validated that CCDC38 interacted with ubiquitinated H2A (uH2A) in mouse testis. Taken together, these results suggested that Ccdc38 is a testis-specific gene and may play a role in mouse spermatogenesis.

Keywords: Ccdc38, Testis, Spermatogenesis, Ubiquitinated H2A

  1. Introduction

Infertility has affected as many as 15% of couples worldwide, and males are known to be responsible for half of the instances [1]. As molecular mechanisms controlling male fertility remain poorly understood, the therapeutic approaches to male infertility are not well developed [2]. Therefore a more complete understanding of the physiological mechanisms in spermatogenesis is needed before solutions to the problem can be resolved.

Spermatogenesisis a complex developmental process in which undifferentiated spermatogonia are differentiated into spermatocytes and spermatids through two rounds of meiotic division and finally giving rise to mature sperm [3]. Defects in any one of these three processes could result in infertility. This complex process is orchestrated by the expression of thousands of genes encoding proteins that play essential roles during specific phases of germ cell development. Many of these genes are expressed predominantly or exclusively in spermatogenic cells, and their regulation can involve control at the transcriptional or post-transcriptional level. The identification of testis-specific or germ cell-specific genes involved in these unique events provides excellent tools to dissect the differentiation program and to study the mechanisms by which spermatogenesis is controlled. To date, many testis-specific genes have been identified in human and mouse, e.g. AKAP3 [4], Lfg5 [5], Fank1 [6], Prss41 [7], Spata33 [2], Tssk4 [8]. In addition to the genes mentioned above, other testis-specific genes may exist and serve unique functions in the testis.

Ccdc38 was chose from the expressed sequence tags (ESTs) obtained by comparing testis libraries with the libraries of other tissues and cell lines using the DDD program [9]. Its EST profile in Unigene (Mm.477086) showed that Ccdc38 transcript was detected only in mouse testis, which was consistent with its report at BioGPS.org [10]. Ccdc38 orthologs are present in other species including the rat (Gene ID: 500823), cow (Gene ID: 517752), and in various primates, including chimpanzee (Gene ID: 738083) and humans (Gene ID: 120935).

Previously, we characterized the gene expression profiles of 2058 spermatogenesis-related genes in mice by performing large-scale cDNA analysis using GeneChip Mouse Genome 430 2.0 [11], and a number of novel genes were identified and characterized [12-14]. Here, as an ongoing study on testis-specific genes, we identified a gene, Ccdc38, which was only expressed in mouse testis. The protein of this gene is mainly expressed in spermatogonia and spermatocytes. Moreover, we found that CCDC38 can interact with uH2A in mouse testis. To the best of our knowledge, this is the first report on the study of Ccdc38, a testis-specific gene with a potential role in mouse spermatogenesis.

2. Materials and Methods

2.1. Samples. Male and female Balb/c mice (aged 4 - 6 weeks) were obtained from Laboratory Animals Center of South Medical University (Guangzhou, China) and maintained in a temperature and humidity controlled room. All the animals had free access to standard mouse chow and water. Male and female mice mated naturally, and the day of birth was designated as day 1. Testes were individually collected from the mice 1, 2, 3, 4, 6, 8 weeks and 6 months old. Other organs including brain, heart, lung, liver, kidney, spleen, epididymis, and bladder from adult mice and all samples immediately frozen in RNA stabilization reagent RNAlater (QIAGEN, Valencia, CA, USA). Animal experiments were approved by The Ethics Committee of Peking University Shenzhen Hospital.

2.2. Antibodies. The rabbit polyclonal anti-CCDC38 antibody (ab170231) and the mouse monoclonal anti-GAPDH antibody (ab8245) were purchased from Abcam (Abcam, Cambridge, UK). The mouse anti-ubiquityl-histone H2A antibody was purchased from Millipore (Millipore, Billerica, MA, USA). Anti-rabbit-Alexa Fluor 488 and anti-mouse-Cy3 were purchased from Invitrogen (Carlsbad, CA, USA).

2.3. Plasmids Construction and Cell Culture. The full length of Ccdc38 cDNA was amplified by PCR with the primers 5’- ATGGCATCCCAGATGC -3’ (forward) and 5’- ACTAAAAAAGTACTCTTCGTC -3’ (reverse), and then inserted into pCDNA3.1/HA plasmids via BamH1 and Xhol. The full length of H2A cDNA was amplified by PCR with the primers 5’- ATGTCTGGACGTGGCAAACAG -3’ (forward) and 5’- TTATTTCCCCTTGGCCTTGTGG -3’ (reverse), and then inserted into pEGFP-C1 plasmids via BamH1 and EcoR1. The PCR products were cloned and sequenced. Two cell lines, TM4 and HEK293T were obtained from the American Type Culture Collection (ATCC). The cells were maintained in Dulbecco Modified Eagle Medium (Life Technologies, Rockville, MD) supplemented with 10% fetal bovine serum at 37 ËšC in a humidified atmosphere with 5% CO2.

2.4. RT-PCR and Quantitative Real-time PCR. Total RNAs were extracted from mouse tissues using the TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNAs (1ug) were used as templates for the reverse transcription using the oligomer (dT) 20 as a primer and PrimeScript RT Enzyme Mix I (Takara, Shiga, Japan). Reverse and forward oligonucleotide primers, specific to the chosen candidate genes, were designed using Primer Express 2.0 Software (Applied Biosystems, Foster City, CA, USA) as described by the manufacturer. The primer sequences were as follows: mouse Ccdc38 forward primer: 5’- CTTGTCCTGTTAGTCCTGTATAG -3’, reverse primer: 5’- CGTAGAGATGAAGTGTGATGAT -3’; mouse Gapdh (as an internal control) forward primer: 5’- AGTGGCAAAGTGGAGATT -3’, reverse primer: 5’- GTGGAGTCATACTGGAACA -3’. The following PCR conditions were used: 98 °C for 2 min; 32 cycles of 98 °C for 10 s, 55 °C for 30 s and 72 °C for 30 s; followed by 72°C for 5 min. All samples from various date testes and other organs were plated in triplicate PCRs. We performed the quantitative real-time PCR experiments using Quantitative RT-PCR system with the primers (as above primers). Data were calculated according to the Applied Biosystems Comparative Ct Method (ΔΔCT Method).

2.5. Western Blot. The protein extracts of mouse various tissues (20 ug) were subjected to 12% SDS polyacrylamide gel and transferred to PVDF membrane. After being blocked in 5% nonfat milk, the membrane was incubated with anti-CCDC38 antibody (1:500) overnight at 4 °C, the membrane was treated with HRP-labeled secondary antibody for 1 h at room temperature. Positive bands were detected using the ECL kit. (Thermo Scientific, Waltham, MA, USA).

2.6. Immunohistochemistry and Immunofluorescence. Paraffin sections were prepared as described previously [15]. After being blocked in 10% goat serum, the sections were incubated with rabbit anti-CCDC38 antibody (1:300), rabbit anti-uH2A (1:100) antibody overnight at 4°C. The sections were washed with PBS and incubated for 1 h at 37°C with the secondary antibodies. The slides were then treated with 0.5 μg/ml DAPI for 5 minutes at roomtemperature, washed in PBS, mounted, and observed under a x100 LSM 710 oil lens (Zeiss Instruments Inc.). DAB staining was carried out according to the manufacturer’s recommended protocol (ABC kit; MAB). The DAB slides were observed under x40 LEICA DM4000B lens. In all the immunostaining protocols, the level of nonspecific staining was determined by omission of the incubation step with the primary antibody.

2.7. Co-immunoprecipitation (Co-IP) assay. Whole testis extracts were prepared with lysis buffer (10 mM Tris pH 7.4, 1.0% Triton X-100, 0.5% NP-40, 150 mM NaCl, 20 mM NaF, 1 mM EDTA, 1 mM EGTA, and 0.2 mM PMSF) supplemented with protease inhibitors. After centrifugation, the supernatant was incubated with anti-CCDC38 and anti-uH2A antibodies overnight at 4 °C. Protein A/G beads (60 μl) were then added to each sample, and the mixtures were incubated at 4 °C for 1 h. The beads were washed three times with lysis buffer, boiled in sample buffer containing 0.2 M dithiothreitol, and analyzed by Western blot as described above.

2.8. Statistical Analysis. Each of the experiments was repeated at least three times, and data were plotted as the mean ± standard deviation. Student’s t-test was used to compare the difference between two groups. Probability (P) values equal to or less than 0.05 were considered to be statistically significant.

3. Results

3.1. Identification of Ccdc38 by in Silico Screen. From UniGene libraries databases we identified a testis-specific gene Ccdc38. To further characterize expression of this gene, we firstly analyzed its structure and function by using systematic bioinformatics methods. The Ccdc38 encodes a predicted protein of amino acids with a molecular weight of about 65KD. Further homology search of other vertebrates in GenBank showed several predicted homologues only in other mammals (Figure. 1A). An amino acid alignment revealed that the mouse CCDC38 shared a high sequence homology with the mammalian homologues. The CCDC38 protein showed three coiled-coil domains by searching the Pfam database. Sequence analysis indicated that CCDC38 was a serine-rich protein. Post-translation modification analysis showed that CCDC38 had two potential sites: twelve Ser phosphorylation sites and one Thr phosphorylation site (Figure. 1B).

3.2. Expression of CCDC38 in Mice. To investigate expression pattern of Ccdc38 in adult mouse tissues, the mRNA level of Ccdc38 was examined by semi-quantitative PCR and quantitative real-time PCR in adult mouse tissues. Ccdc38 was exclusively expressed in testis (Figure. 2A). To determine its protein level, a polyclonal anti-CCDC38 antibody against the coding region of CCDC38. Western blot analysis showed an unique band at 65KD in mouse testis, comparable to the predicted molecular weight by Computing pI/Mw [16]. The protein level of CCDC38 was consistent with its mRNA (Figure. 2B). These results indicate that the expression of CCDC38 is testis-specific in mouse. We further examined the timing of mouse CCDC38 expression during postnatal testis development in both mRNA and protein levels. As shown in Figure. 2C, expression of Ccdc38 was detected after 2 weeks and gradually increased from 2 weeks to 6 months. Western blot analysis showed that the CCDC38 protein first appeared at 2 weeks and gradually increased from 2 weeks to 6 months, which was coincident with its expression of mRNA (Figure. 2D). These results suggest that CCDC38 is developmentally regulated during spermatogenesis.

3.3. CCDC38 Protein is Predominantly Expressed in Spermatogonia and Spermatocytes. In order to investigate the cell types of the CCDC38 protein in testis, we performed immunocytochemical staining on sections of the juvenile and adult mouse testes using the rabbit polyclonal antibody. CCDC38 was predominantly expressed in the nucleus of the spermatogonia and spermatocytes from 2 weeks to adults (Figure. 3).

3.4. CCDC38 Protein interacts with uH2A. CCDC38 and uH2A was examined by immunofluorescence in the testes from adult mice. The results indicated that CCDC38 and H2A ubiquitination protein partially co-localized in the nucleus of spermatogonia and spermatocytes (Figure. 4A). Further, in vivo and vitro Co-IP experiments were performed to determine whether CCDC38 can interact with uH2A. We found that CCDC38 protein could be pulled down by anti-uH2A antibody, which strong demonstrated CCDC38 interacted with uH2A in mouse testis (Figure. 4B and C).

4. Discussion

Spermatogenesis is characterized by successive periods of regulated cell proliferation, meiosis, and haploid differentiation. Abnormalies during any step of spermatogenesis could cause male infertility. It is estimated that approximately 2,000 genes regulate the process of spermatogenesis, and only a small proportion of them has been identified in infertile men so far [17]. Molecular mechanisms and detailed functions of most of these genes remain largely unknown. Thus, identifying key genes that regulate this process will undoubtedly lay a solid base for our further understanding and better manipulation of spermatogenesis.

In the process of spermatogenesis, protein phosphorylation participates in many cellular processes including meiosis, cell cycle regulation, gene transcription regulation, cell energy metabolism, and DNA damage reparation. CCDC38 is a Ser-rich protein with many potential phosphorylation sites, which indicates that this protein may exert its roles through kinase signaling during spermatogenesis. Identification of the gene Ccdc38 in the list of spermatogenesis genes is a new progress in male reproduction. The following evidences supported association of Ccdc38 with spermatogenesis. First, multiple tissue analysis of Ccdc38 indicated that it was exclusively expressed in testis. The testis-specific expression of CCDC38 implied its potential roles in spermatogenesis. Further immunohistochemistry analysis indicated that CCDC38 protein was mainly localized in nucleus of spermatogonia and spermatocytes of the seminiferous tubules. Second, RT-PCR and Western blot analysis indicated that both the mRNA and protein levels of CCDC38 were increased from postnatal 2 weeks to 8 weeks in mouse testis. In the previous reports germ cells are known to enter the meiotic prophase around postnatal day 10 and then proceed through a successive processes of the first wave of meiosis during the following 10 days in mouse [18, 19]. So it is noteworthy that the developmentally regulated expression pattern of CCDC38 may be related to spermatogenic events.

Spermatogenesis involves one of the most dramatic chromatin remodeling processes, including synapsis and transcriptional silencing. Meiotic chromatin silencing involves differential histone modifications, including ubiquitination, phosphorylation, methylation and acetylation. H2A is the first protein to be identified as being ubiquitinated [20]. Ubiquitinated H2A (uH2A) represents the most abundant ubiquitination substrate in mammals, comprising 5-15% of total H2A. Previous work has shown that a high amount of uH2A was detected in pachytene spermatocytes by immunoblot and immunohistochemical analysis of wild-type mouse testis [21]. Our experiments showed that CCDC38 protein localized in nucleus of spermatogonia and spermatocytes. Using support vector machine combined with auto covariance to predict protein-protein interactions from protein sequences [22] and combining with the previous experimental results, we speculated that CCDC38 maybe interact with uH2A in mouse testis. In order to testify this suppose, we perform immunocolocalization and Co-IP assays in the next experiment. We found that CCDC38 and uH2A partially co-localized in the nucleus of spermatogonia and spermatocytes. As expected, CCDC38 can interact with uH2A in vivo and vitro. In addition, H2A ubiquitination that occurs at lysine 119 leads to gene silencing or repression, which plays various roles in cellular processes such as transcriptional regulation and DNA damage repair [23-25]. In our study, we found CCDC38 associated with the meiotic process and interacted with uH2A in mouse testis. So, we supposed that CCDC38 may play a role in transcriptional silencing during spermatogenesis.

5. Conclusion

This study has identified a testis-specific gene Ccdc38 which was conserved in mammalian species. The expression and localization of CCDC38 protein indicated that it may play a role in spermatogenesis. In addition, CCDC38 may regulate spermatogenesis by interacting with uH2A. Further investigation is required to determine the molecular mechanisms of CCDC38 in spermatogenesis.

1

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.