Human Genome And A Look Into Schizophrenia Biology Essay

Published:

Unphased determine whether a genetic variant is associated with a disease or trait. If association is present, a particular allele, genotype or haplotype of a polymorphism or polymorphism(s) will be seen more often than expected by chance in an individual carrying the trait. case (Schizophrenia) and control (normal). frequency of alleles or genotypes is compared between the cases and controls. One problem with the case-control design is that genotype and haplotype frequencies vary between ethnic or geographic populations.

After the gel electrophoresis, the PCR products were added with 40μl of 100% ethanol and put into -20℃ refrigerator, for at least 2 hours, this is to precipitate out the amplified fragment of DNA. Then, the mixture was centrifuged at 3000rpm for 30 minutes. After removal of the liquid waste, 24μl of 70% ethanol was added to wash the sample, and centrifuged at 3500rpm for 20 minutees. The washing process was repeated once more. After that, the samples were dried under 10Pa of pressure for 20 minutes. 10μl of Milli Q water was added to each of the dried sample and heated at 60℃ for 1 minute for mixing the water and PCR product.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

DNA Sequencing

The material used in the DNA sequencing reactions include: primer, either forward or reverse; 5X Seuqencing buffer (Applied Biosystems); PCR product; and Milli Q water that to make the total volume into 15μl.

The DNA sequencing initiated at 95℃ for 5 minutes. Each cycle contains 30 seconds at 95℃ for denaturation, 30s at annealing temperature for each pairs of primer for annealing of primer to template DNA, 1 minute at 72℃ for elongation of the product. In the experiment, 30 cycles were completed for each pairs of the primers. Following the reaction cycles, there was 5 minutes at 72℃ as final elongation time. And the reaction products were temporarily stored in the machine at 4℃ as the final hold temperature.

0.72μl of primer, 3μl of sequencing buffer, 0.75μl of Big Dye Terminator version 3.1 (Applied Biosystems), 1.5μl of PCR product sample and 9.03μl of Milli Q water were made up into reaction mixture.

Primer

Sequence

B22f1S

TTAAGCACAGCTACTAGATC

B22r2

CAGGGAGGTAGGAATGAGAATCTG

B22r2S

TTCCCTGGGATTATACATAT

B22f3

TCTTTGAGTTATCAGGATTGGG

B22f4S

ACCATTCTTAATGAATTCCA

Table 2: Primers used in sequencing.

http://wpcontent.answers.com/wikipedia/commons/thumb/d/df/DNA_Sequencin_3_labeling_methods.jpg/220px-DNA_Sequencin_3_labeling_methods.jpg

Figure 2: Schematic drawing of DNA sequencing.

Sequencing Product Purification

The sequencing products were added with 48μl of 100% ethanol and put into -20℃ refrigerator, for at least 30 minutes, this is to precipitate out the DNA fragment. Then, the mixture was centrifuged at 3000rpm for 30 minutes. After removal of the liquid waste, 24μl of 70% ethanol was added to wash the sample, and centrifuged at 3500rpm for 20 minutes. The washing process was repeated twice more. After that, the samples were dried under 10Pa of pressure for 20 minutes. 10μl of Hi-Deionized formamide was added to each of the dried sample and heated at 95℃ for 3 minute to denature.

Results

Results generated by Genepop [2],[3]

By using Hardy-Weinberg equilibrium, we try to test if the population (Beijing) used in the experiment is in equilibrium. Control sample from normal persons was used to run the Genepop program.

Locus

P-value

Standard Error

W&C

R&H

Steps

rs252973

1.0000

0.0000

-0.0395

-0.0398

14657 switches

rs10050588

1.0000

0.0000

-0.0055

-0.0056

68379 switches

rs171677

1.0000

0.0000

-0.0282

-0.0284

7920 switches

rs252975

1.0000

0.0000

-0.0337

-0.0339

10920 switches

rs173767

1.0000

0.0000

-0.0440

-0.0442

17820 switches

rs153298

0.6843

0.0035

-0.0583

-0.0586

83991 switches

rs153299

1.0000

0.0000

-0.0440

-0.0442

18138 switches

rs252976

1.0000

0.0000

-0.0444

-0.0447

18232 switches

rs1849173

0.8343

0.0016

-0.0430

-0.0432

83419 switches

Table 3: Results generated from Genepop. Two estimates of Fis: Weir & Cockerham's (1984) estimate (W&C), and Robertson & Hill's (1984) estimate (R&H)[1]. All (Fisher's method): Chi2 : 1.1210; Df : 18.0000; Prob : 1.

Under the principle of probability, if the p value is less than 5 percent, the two numbers are said to be significantly different, the null hypothesis, in this case the random union of gametes, is rejected. From the above table we can see that all SNPs tested have p-value larger than 0.05; that is the population at the selected loci is expected to be in equilibrium. As we will compare the differences of SNPs between Schizophrenia patients and normal persons, the results generated by Genepop can exclude the variation between ethnic or geographic populations.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

The standard error of this estimate is much less that 0.01, and the results from the estimation are expected to be reliable.

Results generated by Haploview [4]

Linkage disequilibrium describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.[5]

Fig3: Haploview display of Schizophrenia patients

Fig 4: Haploview display of control group

Discussion

Sample size