High Activity Catechol 1 2 Dioxygenase Biology Essay


This is the first report of catechol 1,2-dioxygenase with extremely high activity against catechol and its methyl derivatives. That is why this enzyme can be use as a tool in production of cis,cis-muconic acid and its derivatives. This enzyme was optimally active at pH 8.0 and 40 °C and the half-life of the enzyme at this temperature was 3 hours. Kinetic studies showed that the value of Km and Vmax was 12.8 µM and 1218.8 U, respectively. During our studies on kinetic properties of catechol 1,2-dioxygenase substrate inhibition at > 80 μM was observed Nucleotide sequence of gene encoding catechol 1,2-dioxygenase in strain KB2 has high identity with other catA genes from Pseudomonas genus. The deduced 314-residue sequence of enzyme corresponds to a protein of molecular mass 34.5 kDa. This enzyme was inhibited by competitive inhibitors only in 30%. High tolerance against condition changes is desirable in the industrial processes.

Keywords: cis,cis-muconic acid production, Stenotrophomonas, catechol 1,2-dioxygenases

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service


Adipic acid is an important industrial compound, which production is necessary for the manufacture of nylon, polyurethane, insecticides and bactericides. One of the most important intermediate during synthesis this acid is cis,cis-muconic acid, which easily converts to adipic acid by hydrogenation [1]. Moreover, cis,cis-muconic acid with regard to the reactive carboxylate groups and the conjugated double bonds with the unique configuration can be useful as a raw material for new functional resins, pharmaceuticals and agrochemicals [2,3].

However, there have been no secure and economical methods to synthesize cis,cis-muconic acid. Several reports have described the preparation of this compound starting with straight-chain compounds, but the product has been more thermodynamically stable trans,trans isomer and for that reason in recent years biological methods are used more often to produce cis,cis-muconic acid [3]. For example, Schmidt and Knackmuss [4] described Pseudomonas sp. strain B13, which produced cis,cis-muconate and 2-fluoro-cis,cis-muconate from benzoate and 3-fluorobenzoate. Kaneko et al. [5] used recombinant Escherichia coli cells expressing the catA gene for high-yield production of cis,cis-muconic acid from catechol. This gene codes catechol 1,2-dioxygenase (C12O), which plays key role in catalyse aromatic ring cleavage in ortho position to cis,cis-muconate.

Until recently several catechol 1,2-dioxygenases, generally from genus Arthrobacter, Acinetobacter, Pseudomonas, Sphingomonas, and Rhodococcus have been described [6-14]. Most of them are enzymes with molecular mass 30.5-34 kDa, which consists of two either identical or non-identical subunits. Nonheme iron in the ferric state is used as a cofactor for intradiol dioxygenases [8,15-18]. The iron is ligated by two histidines and two tyrosines. The initial coordination geometry is trigonal bipyramidal with tyrosine, histidine and a bound hydroxyl in the equatorial plane, and the other tyrosine and histidine as axial ligands [6]. The catalytic cycle of the intradiol dioxygenases involve binding of the catechol as a dianion, binding of dioxygen to the metal, in sequence formation of a peroxo and hydroperoxo intermediate. In the next step occurs the Criegee rearrangement and O-O bond cleavage, that involve acyl migration to yield the cyclic anhydride and an iron-bound oxide or hydroxide take place. Hydrolysis of the anhydride leads to the formation of final acyclic product [16,18-20].

Comprehensive studies on substrate diversity and catalytic properties of catechol 1,2-dioxygenase are essential for the cheap and safe cis,cis-muconic acid synthesis. We now report novel catechol 1,2-dioxygenase, characterized with extremely high activity, isolated from Stenotrophomonas maltophilia strain KB2 which converted benzoic acid to cis,cis-muconic acid. We have identified gene encoding catechol 1,2-dioxygenase in Stenotrophomonas maltophilia KB2. Moreover, we have deduced a putative three-dimensional (3-D) amino acid sequence of this enzyme.

Materials and methods

Media and culture conditions

Stenotrophomonas maltophilia KB2 (VTT E-113197) was enriched in mineral salts medium (MSM), as described previously [21] in the presence of 6 mM benzoic acid. Cultures were incubated at 30 °C and agitated at 130 rpm.

Preparation of cell extracts

Cells were harvested in the late exponential growth phase and centrifuged at 4,500 g for 15 min at 4 °C. Next, the cells were washed with 50 mM phosphate buffer, pH 7.0, and resuspended in the same buffer. Cells were sonicated 6 x for 15 s and centrifuged at 9,000 g for 30 min at 4 °C. The supernatant was used as crude extract for enzyme assays.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Enzyme assays

Benzoic acid was used as the inducer of catechol 1,2- dioxygenase in the growth medium. Enzymatic activity of enzyme was measured spectrophotometrically [21]. After the addition of the enzyme, vials were incubated at 30 °C in water-bath with shaking. At certain time intervals, 1 ml aliquots were withdrawn and used to monitor the reaction progress by measuring the product cis,cis-muconic acid at 260 nm. The extinction coefficient of the oxidation product of catechol was determined as 260nm=16,800/ M cm. One unit of enzyme activity was defined as the amount of enzyme required to generate 1 μmol of product per minute at 35 °C. The protein concentration was determined by the dye-binding procedure of Bradford using bovine serum albumin as a standard [22].

pH and temperature optima of catechol 1,2-dioxygenase

The effect of pH on the enzyme activity was determined by measuring the activity at 30 °C over the pH range 2.2 - 12.0 using the following buffers: 0.05 M glycine (pH 2.2), 0.05 M phosphate-citrate (pH 3.0 to 5.0), 0.05 M Sörensen (pH 6.0 to 8.0), 0.05 M borate (pH 9.0-10.0), and 0.05 Britton-Robinson (pH 11.00 to 12.00).

The optimum temperature was determined by assaying the enzyme activity at various temperatures (4 to 60 °C) in 50 mM phosphate buffer solution (pH 7.2).

Determination of kinetic constants of catechol 1,2-dioxygenase

The catalytic parameters (Michaelis-Menten constant, Km, and Maximum velocity, Vmax) for enzyme were calculated by measuring the initial linear rates of the enzymatic reaction after the addition of different concentrations of catechol ranging from 0 to 100 μM at 30 °C. Three independent measurements were carried out for each substrate concentration. Km, and Vmax, were calculated from Michaelis-Menten equation.

Substrate specificity

Impact of various substituted derivatives of aromatic compounds on enzyme activity was evaluated by incubating the enzyme with the respective aromatic compound for 3 min and assaying the activity. Dihydroxy-substituted derivatives of arene studied were 3- and 4-methylcatechol, 4,5- and 3,5-dichlorocatechol, and hydroquinone and at 1 mM concentration. The molar extinction coefficient used for the product from hydroquinone was 11,000/M ·cm (at 320 nm) [23,24]. Catechol 1,2-dioxygenase activities for chlorinated and methylated derivatives of catechol were determined by the procedures of Dorn and Knackmuss [25].

Activity in the presence of inhibitors

Impact of various phenols and chelators on enzyme activity was evaluated by incubating the enzyme with the respective inhibitor for 3 min and then assaying the residual activity. At certain time intervals, 1 ml aliquots were withdrawn and used to monitor the reaction progress by measuring the product cis,cis-muconic acid. Assay of catechol 1,2-dioxygenase was proceed in the same way as in the case of non-inhibited enzyme. The phenols studied were 2-methylphenol, 3-methylphenol, 4-methylphenol, 2-chlorophenol, 4-chlorophenol, 2,4-dichlorophenol at 0.1 mM, 0.2 mM, and 0.3 mM concentration. Chelators studied were phenanthroline, EDTA, and 2,2'-dipirydyl (1 mM, 2 mM, and 3 mM).

Amplification of catechol 1,2-dioxygenase gene

Genomic DNA, plasmid DNA isolation and other DNA manipulations were carried out according to the established procedure [26]. Oligonucleotides for the PCR were purchased from IBB PAN (Warsaw, Poland). Detection of the Cl2O gene was carried out with primer designed by Guzik et al. [8] 1,2D_zewF (GATGGATCCGTGAAAATTTCCCACATGC) and 1,2D_zewR (TGGATCCAGTAACGTTGCAGGTGCT). The PCR mixtures contained 0.5 µM of each primer, 10 x Pfu buffer + MgSO4 (2 mM Mg2+), 10 mM K+, 3% DMSO, 0.2 mM of each deoxynucleoside triphosphate, 1.25 U Pfu DNA polymerase (Sigma) and plasmid or chromosomal DNA as a template. For the Cl2O genes, the annealing temperature was 61 °C (30 s) in the first 10 cycles followed by a step down to 59 °C (30 s) in the next 15 cycles, and 57 °C (30 s) in the last 15 cycles. Aliquots (10 µl) of the PCR products were analyzed by electrophoresis on a 1.0% agarose gel stained with 0.5 ug ml-1 ethidium bromide. Gene sequencing was performed by using Big DyeR Terminator Cycle Sequencing Kit (Applied Biosystem) and AbiPrism®3100 Genetic Analyzer. Computer analysis and processing of sequence information were performed by using Chromas LITE software (Technelysium Pty, Tewantin, Australia). Obtained nucleotide sequence of the catechol 1,2-dioxygenase gene from S. maltophilia strain KB2 has been deposited in the GeneBank database of NCBI under the accession number EU000397.1.

Molecular modeling of catechol 1,2-dioxygenase enzyme

Amino acid sequence of catechol 1,2-dioxygenase was deduced using the CLC Free Workbench 4.0.1 software. The deduced structure of the catechol 1,2-dioxygenase was modeled using the interactive mode of the 3D-JIGSAW protein comparative modeling server (http://bmm.cancerresearchuk.org/~3djigsaw/). Structure models as x.pdb data files were analyzed using RasMol 2.6 software package.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Results and discussion

Production of cis,cis-muconic acid by catechol 1,2-dioxygenase

It is known that the key enzyme in the cis,cis-muconate biosynthetic pathway, catechol 1,2-dioxygenase, is induced by benzoate [1,9]. Earlier study shown that catechol 1,2-dioxygenase from S. maltophilia KB2 was observed after growing of strain in the presence of benzoate [21]. This enzyme catalyses catechol cleavage to cis,cis-muconic acid. We claimed that the formation of this compound is dependent on substrate concentration. Fig. 1 shows that the rate of cis,cis-muconic acid synthesis averaged 10 μM/min. The molar conversion yield based on the amount of consumed catechol was the theoretical value of 100% (mol/mol). Similar results was obtained by Kaneko et al. [5] during production of cis,cis-muconic acid by recombinant Escherichia coli cells. This strain possessed catA gene, which encodes catechol 1,2-dioxygenase from Pseudomonas putida mt-2.

Sequence analysis of catechol 1,2-dioxygenase gene

Genes encoding catechol dioxygenases are located on plasmid or/and on the chromosome [18,21,27,28]. Our research indicate that strain KB2 contains plasmid DNA [21] and we thus performed PCR with chromosomal and plasmid DNA as a template. To amplify catechol 1,2-dioxygenase gene from Stenotrophomonas maltophilia KB2 we used 1,2D_zewF and 1,2D_zewR primers [8]. PCR product was obtained only with chromosomal DNA as a template. These results indicate that gene encoding catechol 1,2-dioxygenase, an enzyme involved in degradation of aromatics, is located on chromosomal DNA. Sequencing of above-mentioned PCR product resulted in a 1243 nucleotide sequence (deposited in the GenBank sequence database under accession number EU000397). As a result of this study, a phylogenetic tree was created (Figure 2), based upon the catechol 1,2-dioxygenase catabolic gene sequences found in the GenBank and the new sequence published in this study. It was found high homology with other intradiol dioxygenase genes. Similarity among genes encoding catechol 1,2-dioxygenase may suggest that aromatic-degrading bacteria have evolved from the same ancestor and they could obtain their dioxygenases through evolutionary events such as horizontal gene transfer among microorganisms [8,11,27].

Structural properties of catechol 1,2-dioxygenase

The knowledge of the catechol 1,2-dioxygenases 3-D structure can provide the same important information into the molecular mechanism of these enzymes. The deduced 314- residue amino acid sequence of Stenotrophomonas maltophilia KB2 (deposited in the GenBank sequence database under accession number ABS86780.1) enzyme corresponds to a protein of molecular mass 34.5 kDa. Similar molecular weight of dioxygenase from Acinetobacter calcoaceticus and Pseudomonas putida N6 was obtained by Neidle et al. [27] and Guzik et al. [8], respectively.

We predicted the 3-D structure of catechol 1,2-dioxygenase from KB2 strain based on deduced amino acid sequence by using the interactive mode of the 3D-JIGSAW protein comparative modeling server. Catechol 1,2-dioxygenase from KB2 strain (Figure 3A) probably possesses N-terminal domain with five  helises and C-terminal domain consisted of -sheets - the structures typical for other intradiol dioxygenases as reported previously [8,29,30]. Similar molecular structure was also noted in another study for Rhodococcus opacus 1CP 4-chlorocatechol 1,2-dioxygenase and P. arvilla C-1 catechol 1,2-dioxygenase [6,31]. The  helises localised within N-terminal domain of the enzyme of C-1 strain, like the other known intradiol enzymes, were found to be involved in dimerization of enzyme subunits [16,18,21].

According to knowledge intradiol dioxygenases coordinate ferric ion by two histidine, two tyrosine residues and one hydroxyl ion in a trigonalbipyramidal geometry [6,10,15,19,31]. Within the active site of Rhodococcus opacus 1CP catechol 1,2-dioxygenase the coordination residues were identified at positions His-194, His-196, Tyr-134, and Tyr-169 [31]. Our work predicts His-226, Tyr-166, and Tyr-200 to be involved in ferric ions coordination (Figure 3B, and C). However, as a fourth ligand of iron ion we predicted Gln-224. Displace one of the key iron bound ligand can cause changes in catalytic properties of enzyme and that is way we checked it in our study.

Kinetic properties of catechol 1,2-dioxygenase

The pH-activity and temperature-activity curves showed that the maximum catechol 1,2-dioxygenase activity was at pH 8 and 40 °C, respectively (Fig. 4A and B). On the other hand, examined enzyme was not very stable in this temperature (Figure 4C). The half-life of the enzyme at 40 °C was 3 hours (Fig. 4B). Interestingly, the enzyme lost 16.5% of its enzymatic activity at 50 °C and the activity rapidly declined at 55 °C (Figure 4B). Similar effect was observed by Wang et al. [14] and Murakami et al. [11] for catechol 1,2-dioxygenase from Pseudomonas aeruginosa and Arthrobacter species BA-5-17, respectively. The enzyme isolated from strain KB2 lost 100% of its original enzymatic activity at pH 2.2 and about 83% at pH 12.0 (Figure 4A). The optimal pH of catechol 1,2-dioxygenase is comparatively higher with that of catechol 1,2-dioxygenase from Pseudomonas fluorescens, Pseudomonas aeruginosa and Rhodococcus sp. NCIM2891 [12-14].

In order to calculate values of Km and Vmax parameters, the activity of catechol 1,2-dioxygenase from S. maltophilia KB2 was measured at different substrate concentrations as detailed in materials and methods. The Km and Vmax values were 12.18 μM and 1218.8 U, respectively (Figure 4D). Of note, Km value was 2-fold higher than obtained by Wang et al. [14] and Nadaf and Ghosh [12]. This result may therefore indicate lower affinity of enzyme to the substrate.

During our studies on kinetic properties of catechol 1,2-dioxygenase substrate inhibition at > 80 μM was observed (Figure 4D). In line with our results Sauret-Ignazi et al. [28] for Alicaligenes eutrophus CH34 1,2-dioxygenase which catalyse tetrachlorocatechol degradation, observed inhibition activity of enzyme.

Influence of various substrates on catechol 1,2-dioxygenase activity

Differences in substrate specificity is one of the interesting characteristics noted among the isofunctional dioxygenases from various sources.

The relative activities of the catechol 1,2-dioxygenase from KB2 strain towards various substrates are given in Table 1. It was found that the enzyme showed activity against catechol, 3-methylcatechol, and 4-methylcatechol. No activity was observed for 3-chloro- and 4-chlorocatechol, 3,5-dichloro- and 4,5-dichlorocatechol, and hydroquinone. It could be interpreted that haloatom might prevent dioxygenase from attacking the ring. Similar results was obtained by Murakami et al. [11] and Briganti et al. [32] for intradiol dioxygenases isolated from Arthrobacter species BA-5-17and Acinetobacter radioresistens. Remarkably broader substrate specificity described Wang et al. [14] and Gou et al. [7] during characterization of catechol 1,2-dioxygenase from Pseudomonas aeruginosa and Sphingomonas xenophaga QYY, respectively. Generally, similarity among substrate specificity of catechol dioxygenases from different bacteria suggests similar structure and catalytic features.

Enzyme activity in the presence of inhibitors

Phenols substituted in the ortho position, which structurally mimic catechols, are known as competitive inhibitors of catechol 1,2-dioxygenase because they coordinate to the iron (III) ion in the enzyme active site [28,30,33]. Most of phenols studied affected enzyme activity at all tested concentrations (Table 2). Sauret-Ignazi et all [13] observed more sensitive of catechol 1,2-dioxygenase in the presence of para substituted phenols. However catechol 1,2-dioxygenase form KB2 strain did not reveal dependence activity changes on substituents position.

Sensitivity of catechol 1,2-dioxygenase form KB strain to both ferrous and ferric iron chelators (Table 2) may reflect the fact that iron of enzyme active site is more weak bound than in the enzyme from Arthrobacter species BA-5-17 [11], Trichosporon cutaneum [34], Pseudomonas aeruginosa [14] or Acinetobacter calcoaceticus [17]. Varga and Neujahr [34] suggested correlation between substrate specificity and affinity of iron to catechol 1,2-dioxygenase. They described that dioxygenases with strongly bound iron had narrow substrate specificity and vice versa. Our results are at variance with this suggestions because catechol 1,2-dioxygenase from KB2 strain has narrow specificity and weak bound iron. Sensitive of our enzyme on the chelators can be connected with untypical ligand (Gln-224) of iron in the active site of dioxygenase (Figure 3C).

In conclusion catechol 1,2-dioxygenase from Stenotrophomonas maltophilia strain KB2 can be useful tool in production of cis,cis-muconic acid and its derivatives because of its high activity. This enzyme characterize probably unique iron bound ligand in catalytical site, which can influence on properties changes. Extremely high activity of enzyme in the presence of methylcatechols enables it to use to production of methyl derivatives of cis,cis-muconic acid. Moreover in the industrial processes the desirable features of catechol 1,2-dioxygenase form KB2 strain are temperature and pH tolerance or competitive inhibitors resistance.


We thank Dr Renata Zub (Department of Molecular Biology, Institute of Oncology, Warsaw, Poland) for DNA sequencing. Aleksandra Bury is acknowledged for their excellent technical assistance.