Function Of Elk1 In Neurodegenerative Diseases Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The Human Nervous system is one of the most complex networks that the human body possesses. It is composed of specialized cells that coordinate the actions between different parts of the body. Elk-1 belongs to the ternary complex (TCF) subfamily of the ETS- domain transcription family. Researchers have found that 4 different degenerative brain disorders have been linked by a toxic form of the same protein. Elk-1 has been found in clumps of misshaped protein that have been proven to be the source of Parkinson's, Alzheimer's, and Huntington's diseases. In vitro, Elk-1 functions as a transcriptional activator via its association with serum response factor in a ternary complex on the serum response element. De-regulation of Elk-1 expression has been associated with cancers of the prostate and breast, as well as certain T-cell malignancies. Elk-1 is a key player in the integration of mitogenic and stress mediated signaling pathways. These results suggest a molecular link between the presence of inclusions and neuronal loss that is shared among a spectrum of the diseases stated earlier. Identifying the links between the diseased environments will open doors for intervention and maybe a cure.

Introduction 

Neurodegenerative diseases all take place in the brain. The brain has nerve cells which are responsible for our motor functions as well as our muscle functions. In the nerve cell it contains an important chemical called dopamine. Dopamine can be supplied as a medication that acts on the sympathetic nervous system, producing effects such as increased heart rate and blood pressure. However, because dopamine cannot cross the blood-brain barrier, dopamine given as a drug does not directly affect the central nervous system. Dopamine sends signals to the brain which allows us to move. The Elk-1 protein resides in multiple areas of the brain, in both the nucleus and cell body. When the Elk-1 is active in the dendrites of the nerve cell, it can cause the cell to die. Neurodegenerative diseases are characterized by a number of features including Protein Clumps called inclusions; decline of nerve cell synapses; and the selective loss of the nerve cells themselves. Some Neurodegenerative diseases are Parkinson's, Alzheimer's, and Huntington's. All of these diseases occur as a result of neurodegenerative processes. As research progresses, many similarities appear which relate these diseases to one another on a sub-cellular level. Elk-1 could be that relation.  

How does Elk-1 initiate death of a nerve cell?

Researchers found out that mRNA (messenger RNA) and protein encoding Elk-1, a transcription factor, were found in the dendrites of intact rodent neurons. This is unique because transcription factors normally function in the nucleus. These factors are proteins that bind to DNA and play a role in the regulation of gene expression by promoting transcription.  

Materials and Methods

Neuronal Cell Culture

Primary neurons from E18 rat hippocampi were plated in MEM (Gibco 11095-080) supplemented with 0.6% wt/vol glucose, 1 mM sodium pyruvate, and B27 (Invitrogen). The cells were placed on to some spiegelglas cover slips (Carolina Biological) coated with 80 µg/ml Poly-D-Lysine MW 70-150,000 (Sigma) in borate buffer and 1 /ml Laminin (BD Bioscience) in borate buffer.

Site-Directed Mutagenesis

Single amino acid substitutions were placed at sites of post-translational modification using the QuikChange Site-Directed Mutagenesis kit. A pcDNA3.1A plasmid vector (Invitrogen) containing Elk-1 cDNA (derived from IMAGE # BC054474) was amplified using a high-fidelity DNA polymerase and PCR primers with specific single codon mutations. For the S383A mutant, the following primers were utilized: ccatttctggagcactctggcgccaattgcaccccgtagt and actacggggtgcaattggcgccagagtgctccagaaatgg​. For the T417A mutant, the following primers were utilized: atcagtgtggatggcctctcggcgcccgtggtgctctccc and gggagagcaccacgggcgccgagaggccatccacactgat​. Following PCR, DNA sequencing was used to verify that site-specific mutations had been created.

Phototransfection

The capped Elk-1 mRNAs were synthesized and verified through a Bioanalyzer. Prior to phototransfection, the concentration of mRNA placed in the cellular bath was 40-80 ug/ml. Phototransfection was performed on a multi-photon upright microscope with a Ti: Sapphire laser. Based on the transmitted light gradient contrast image or weak cellular autofluorescence of 2-3 wk IV primary hippocampal neurons, we selected three distinct regions of interest (2Ã-2 pixel each) over a dendrite for phototransfection. Without more ado following bath application of mRNA,  they then used the Ti:Sapphire laser to make transient poration sites by delivering pre-chirped pulses (100 fs pulses, 80 MHz repetition rate) at 35 mW power (at the back aperture of the lens) for 25 µsec per pixel. The pulses were delivered in order over the pixels within the regions of interest. After phototransfection, cell viability was assessed up to 6 hours later by determining the presence of clear cellular morphological changes such as somatic swelling, dendritic fragmentation and nuclear compaction.

Patient Information and Tissue Inclusion

Tissue used in the study was all possible by postmortem organ donation of the patients of the University of Rochester Medical Center Neuropathology Unit. The program is carefully watched by the Autopsy Unit of the University of Rochester Medical Center Pathology Department. HIPPA policy is in effect for the patients and their families and, as such, the cases reported here have been coded to prevent patient identification. The University of Rochester Neuropathology Unit got permission from the Institutional Review Board at the University of Rochester Medical Center for this study. Following a broad screening procedure, cases were chosen on second thoughts based on their final postmortem diagnoses. Cases designated "Lewy body disease" or "Alzheimer's disease" was looked at only if they showed disease-specific pathology. Cases with severe pathology were expelled due to the low number of neurons to assess co-localization. Age-matched controls lacking pathological changes in substantia nigra, hippocampus, and basal ganglia were also included for comparison.

Observations and Results

T417 and Elk-1

The Elk-1 transcription factor is not possible without T417.The transcription factor Elk-1 resides in both nuclear and extranuclear neuronal compartments. They have shown that extranuclear Elk-1 functions in regulating neuronal viability. In this experiment, they identified the phosphosite T417 being necessary for Elk-1 mediated neuronal death. They documented the co-localization of extranuclear T417+ Elk-1 with multiple types of neuronal inclusions from three major neurodegenerative diseases. Their findings raise the interesting possibility that Elk-1 impacts neuronal viability within the context of neurodegeneration.

Elk-1 and Alzheimer's disease

Alzheimer's disease is characterized by the number of neuropathological lesions, including neurotic plaques, neurofibrillary tangles, and neuropil threads. These plaques and tangles are very harmful to the brain. T417+ Elk-1 Co-localizes in these lesions and plaques causing what we know as Alzheimer's disease.

Elk-1 and Huntington's disease

Huntington's disease is defined as a progressive, degenerative disease that causes certain nerve cells in your brain to waste away. As a result, you may experience uncontrolled movements, emotional disturbances and mental deterioration.  Elk-1 interacts with a protein called Ubiquitin. Ubiquitin is A polypeptide found in all eukaryotic cells including plant cells that participates in a variety of cellular functions including protein degradation. Elk-1 co localizes with the Ubiquitin and Huntington's disease is the outcome.

Prevention

There is really no way to prevent these diseases from happening to you. All the diseases are genetically passed down form parent to child. In Alzheimer's disease if your mother had the disease then there is a 50/50 chance of you getting the disease. However, if your chances are good and you don't get the disease then you offspring will not get the disease.

Conclusion

Elk-1 has been associated in the degradation of many neuronal cells and has been found in many inclusions and tangles of the brain. The way it interacts and transcribes itself into many forms is unique and very interesting. The co-localization of T417+ Elk-1 with multiple neuronal inclusions suggests a common mechanism of pathogenesis and neuronal loss among distinct neurodegenerative diseases. The inclusions may sequester T417+ Elk-1 as it is being enriched, preventing its transport to other sub cellular regions and its association with other components in the cell death pathway. However, the enrichment of this neurotoxic protein may exceed the sub cellular capacity of containment resulting in the liberation of active molecules of T417+ Elk-1. Alternatively, the inclusions could serve as sub cellular pathogenic sites that actually enhance the local enrichment and activation of T417+ Elk-1. T417+ Elk-1 molecules could then dissociate from these sites and initiate neuronal death. The fact that a subset of inclusions from Parkinson's Disease and Huntington's Disease show co localization with T417+ Elk-1 likely reflect both disease and detection processes. Not all the neurons containing inclusion pathology likely undergo cell death or show Elk-1 enrichment at a given time. Alternatively, because limited and localized levels of Elk-1 enrichment can induce changes in cell viability, it's possible that extranuclear Elk-1 may be biologically active even where signal cannot be detected. 

 

 

 

 

 

 

 

 

 

 

 

Reference Page

1) Sharrocks AD (2001) The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2: 827-837.

2) University of Pennsylvania School of Medicine (2006, June 8) Penn researchers reveals inner workings of cell death-could play role in neurodegenration and Schizophrenia. Sciencedaily. Retreived March 2, 2010, from http://www.sciencedaily.com/releases/2006/060608090633.htm

3) Marais R, Wynne J, Treisman R (1993) The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73: 381-393

4) Wishart TM, Parson SH, Gillingwater TH (2006) Synaptic vulnerability in neurodegenerative disease. J Neuropathol Exp Neurol 65: 733-739.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.