Facultative Anaerobic Gram Positive Coccus Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Staphylococcus aureus is a facultative anaerobic Gram-positive coccus; it is catalase and coagulase positive and non-motile. S. aureus is carried by approximately 25% of humans in their nasal cavities, which serves as a major reservoir for this pathogen. Carriage of S. aureus is associated with certain genetic and environmental factors (Wertheim et al., 2005). It is an importantly significant pathogen due to its combination of invasiveness, toxin-mediated virulence and antibiotic resistance. Resistance to antibiotics has increased the consequences of S. aureus infections, particularly those due to methicillin-resistant S. aureus (MRSA), which is an important cause of nosocomial infections (Shopsin et al., 2000) and also a community-associated infection in humans. MRSA has also now become increasingly more recognised as a pathogen in companion animals (Hanselman et al., 2009). Several studies describing carriage of undifferentiated MRSA strains in humans and animals have been found and interspecies transmission of MRSA between these two hosts has been suspected (Weese et al., 2006); however the interspecies staphylococcal transmission dynamics are still poorly understood. The spectrum of staphylococcal infections ranges from pimples and furuncles to sepsis and toxic shock syndrome, most of which depend on numerous virulence factors. Staphylococci can cause disease both through their ability to multiply and spread widely in tissues and through their production of many extracellular substances (Jawetz et al., 1987).

S. aureus produces an extensive variety of exoproteins which include the classical staphylococcal enterotoxins (SEA, SEB, SEC, SED, SEE, SEG, SEH and SEI), exfoliative toxins (ETA and ETB), toxic shock syndrome toxin-1 (TSST-1) and Panton Valentine Leukocidin (PVL) (Bergdoll et al., 1973). Other staphylococcal enterotoxins (SEG to SER and SEU) have recently been described (Letertre et al., 2003; Llewelyn and Cohen, 2002). In total there are now more than 18 serologically distinct SEs to date and they are low molecular weight proteins which are stable at boiling temperature and resistant to proteolysis. They also show similar three-dimensional structures (Lina et al., 2004). The role in pathogenecity and causing human disease is however still unclear in some of these enterotoxins e.g. SEG to SEJ and SEU (Jarraud et al., 1999). SE genes are carried on mobile genetic elements; genes encoding for SEB and SEC are localised on the chromosome while SEA is carried by a temperate bacteriophage (Holtfreter and Broker, 2005).

Staphylococcal enterotoxins (SEs) are also known as pyrogenic toxin superantigen as they have the ability to stimulate proliferation of T lymphocytes without regard for the antigen specificity of the cells (Fleischer and Schrezenmeier, 1988) and they show some structure, sequence and function similarities as well as phylogenetic relationships between each of them (Balaban and Rasooly, 2000). SEs were mainly discovered in studies of S. aureus involved in food poisoning outbreaks and were then classified in distinct serological types. Thus, SEA to SEE and SEH have been demonstrated as being capable of more or less potent emetic activity, with SEA and SED being the most common serotypes associated with food poisoning. SEA and SED are the only superantigens that possess emetic activity (Dinges et al., 2000). The correlation that exists between superantigen and emetic activity of the SEs are high despite of them being on two separate functions localised on separate domain proteins. Genetic mutations resulting in a loss of emetic activity will also result in a loss of superantigen activity (Harris et al., 1993). The emetic activity of SEs is however not as well characterised as superantigen activity and little is known about how SEs cause symptoms of food poisoning. The toxins may have a direct effect on intestinal epithelium and also on the vagus nerve which in turn stimulate the emetic centre and of gut transit (Arbuthnott et al., 1990).

TSST-1, which is used to be known as SEF (Bergdoll et al., 1981) is a causative agent of toxic shock syndrome (TSS) and is another staphylococcal toxin that has been widely investigated and shown to have superantigenic properties. TSS is an acute disease that is characterised by a rapid onset of high fever, hypotension, diffuse erythematous rash, and multiorgan failure (Kreiswirth et al., 1983) . It is most frequently seen in young women (Todd et al., 1978) who use tampon during menses. TSS has therefore been extensively studied especially after the occurrence of major outbreaks when the new superabsorbant brand of tampon was introduced (Berkley et al., 1987). As a result these tampons were withdrawn from the market, and most TSS now occur in non-menstrual cases although non-menstrual TSS is normally secondary to S. aureus infections (Jarraud et al., 1999). SEB and SEC have also been found to be responsible in 50% of non-menstrual cases (Schlievert, 1986). SEB triggers toxic shock at low serum concentration and can cause profound hypotension and can also trigger multiple organ failure (McCormick et al., 2001).

SEB has been associated with ulcerative colitis (Yang et al., 2005), a disease which is characterised by inflammation and ulcers in the mucosa of large intestine. SEB increases the epithelial permeability thus compromising the intestinal barrier function and initiate inflammation in the intestinal mucosa. Sinusitis-derived SEB may be swallowed down to the gastrointestinal tract and consequently induce lesions to the intestinal mucosa (Yang et al., 2005).

It has also been suggested that pyrogenic toxins of S. aureus are involved in some cases of sudden infant death syndrome (SIDS) which include TSST-1 and SEC (Malam et al., 1992). Zorgani et al (1999) shows that intravenously injected SEB, SEC, SED and TSST-1 are all concentrated in the proximal convoluted tubular cells of the kidney. This is not surprising as it has been known that low molecular weight proteins are filtered by the glomerulus and then taken up by the proximal convoluted tubular cells. The finding of antigens in the proximal convoluted tubular cells of the kidney which react with anti-TSST-1 (Newbould et al., 1989) and anti-SEC is of interest in relation to the pathogenesis of SIDS, particularly as this is the site at which many bacterial toxins are concentrated (Zorgani et al., 1999). Therefore there is sufficient circumstantial evidence to conduct further study of the kidney in SIDS and this should be done prospectively using a wide range of antisera to bacterial toxins (Malam et al., 1992).

An association between staphylococcal infection and pathogenesis of airway diseases is now being studied as the airway disease is greatly influenced by immune-modulatory and pro-inflammatory cells (Bachert et al., 2002). There is now increasing evidence that staphylococcal toxins particularly SEA and SEB triggers airway recruitment of several pro-inflammatory cell types. They act as allergens and studies have also shown that S. aureus can induce the release of histamine from leukocytes. They play a role in modulating chronic inflammatory airway disease, both via non-IgE and IgE-mediated mechanisms and have the potential to influence the etiopathogenesis of upper and lower airway disease including bronchial asthma, allergic rhinitis and chronic sinusitis (Bachert et al., 2002). The lymphocytes of patients suffering from perennial allergic rhinitis was shown to proliferate to a significantly greater degree than the lymphocytes of control subjects when in vitro evaluation of the response of peripheral blood lymphocytes to SEB or TSST-1 was carried out (Shiomori et al., 2000). All of these evidences however are preliminary and at the best of times circumstantial. More basic studies are required to elucidate the role of S. aureus and its superantigens in the etiology of these diseases (Bachert et al., 2002).

Some strains of S. aureus have also been shown to produce exfoliative toxins (ETs) in addition to those most commonly occurring superantigenic toxins. ETs are the causative agents of staphylococcal scalded skin syndrome which is a blistering skin disorder that predominantly affects children (Ladhani et al., 1999). The Panton Valentine Leukocidin (PVL) toxin causes tissue necrosis and leukocyte destruction and is responsible for many of the severe clinical symptoms associated with S. aureus infections including necrosis of the skin and severe necrotising pneumonia (Bergdoll et al., 1973). It is however only produced by fewer than 5% of S. aureus strains. PVL induces lysis of polymorphonuclear neutrophils, macrophages and monocytes and is also known to induce the opening of calcium channels leading to calcium influx and inflammatory mediators are massively released (Lina et al., 1999). Neutrophils destruction promotes disease as they are the main host cellular defence against bacterial infection. PVL is reportedly the most common virulence factor associated with community acquired MRSA and is responsible for the high mortality rate associated with necrotising pneumonia (Tristan et al., 2007).

1.1 Aims and objectives

The aim of this research project is to screen clinical S. aureus for the presence of genes encoding SEA to SED, TSST-1 and PVL toxin. PCR will be used in an attempt to identify the toxin genes present within the strains. The test stains will also be screened for the presence of antibiotic resistance genes.

2.0 Materials and Methods

2.1 Bacterial strains

Test strains of Staphylococcus aureus were supplied by Harrogate hospital and were isolated from faecal samples from patients suffering from diarrhoea, though it has not been ascertained that the presence of these pathogens was the cause of illness. Fifty three strains of S. aureus , both methicillin-sensitive S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) were selected randomly from the database provided by the hospital and consisted of both the hospital and the community. In total, 27 hospital isolates and 26 community isolates were obtained.

Reference strains used in this study were obtained from the Health Protection Agency Culture Collections specifically the National Collection of Type Cultures (NCTC). The S. aureus reference strains used were NCTC 10657 (positive for sea and seb), NCTC 11962 (positive for sea and tsst-1), NCTC 10655 (positive for sec) and NCTC 10656 (positive for sed). A PVL positive clinical isolate from Pakistan was used as a reference strain for the pvl toxin gene.

2.2 Growth and storage of bacteria

Bacterial isolates were grown and maintained on Iso-Sensitest agar (Oxoid, Basingstoke, UK) and were prepared according to the manufacturer's instructions. The media was autoclaved at 121oC, at a pressure of 1.08kgFcm-2 for 20 minutes before the plates were poured. Once the plates had set they were dried using a fan assisted drying cabinet for 15 minutes. All the fifty three isolates were plated out and then incubated at 37oC for 24 hours.

2.3 Antibiotic susceptibility testing

Antibiotic susceptibility was tested by the agar disc diffusion method on IsoSensitest agar (Oxoid) according to the British Society for Antimicrobial Chemotherapy (BSAC) guidelines Version 8, 2009 (Potz et al., 2004; Williams, 1993). Bacterial suspensions were prepared in 1ml of sterile distilled water to match 0.5 McFarland standard and were applied with a sterile swab to produce a semi-confluent growth on the agar. An antibiotic dispenser (Oxoid) was used to stamp the paper discs impregnated with antibiotics (Oxoid) onto the agar. List of antibiotics used and the amount of the antibiotic each disc contained are listed in Table 1. Plates were then incubated at 37oC for 24 hours and results were analysed by using the BSAC guidelines for Staphylococci.

Table 1. Antibiotic discs used and their specific absolute concentrations

Antibiotic

Amount on disc (µg)

Chloramphenicol

10

Ciprofloxacin

1

Clindamycin

2

Erythromycin

5

Fusidic acid

10

Minocycline

10

Neomycin

10

Oxacillin

1

Penicillin G

1 unit

Rifampicin

2

Tetracycline

10

Vancomycin

5

2.4 DNA extraction

NET buffer (50µl) (10mM Tris, ImM EDTA, 10mM NaCl) was pipetted into Eppendorff tubes. 4-5 colonies of test S. aureus strains and reference strains were transferred into each Eppendorff. Enzyme - achromopeptidase (10µl) (Sigma, Aldrich, UK) was added to each tube and were incubated at 50oC for 20 minutes or until cells have lysed, indicated by the viscosity of the solution.

2.5 Polymerase Chain Reaction (PCR) assay

Detection of the toxin genes (sea, seb, sec, sed, tsst-1 and pvl) was conducted by PCR. DNA amplification was run in C100 thermal cycler (Bio-Rad, USA). Different sets of forward and reverse primers used along with individual PCR conditions are listed in Table 2. A reaction mix which contained 20µl of PCR mixture was prepared for each strain, consisting of 2µl of thermo polymerase buffer (New England Biolabs, Herts, UK), 2µl of dNTP mix (New England Biolabs) at 200µM, 1µl of each of the primers (Sigma, Aldrich, UK), 1µl of Taq polymerase (units) (New England Biolabs) and 12µl of PCR ultra grade water (Eppendorf, Hamburg, Germany). DNA template (1µl) was added to each PCR reaction tube. A master mix of all the solutions above except DNA was initially prepared, and the amount of master mix was adjusted accordingly depending on the number of samples required; 19µl of master mix was then pipetted into the PCR tubes. A positive control which contained DNA of reference strains and a negative control which contained no DNA (replaced with PCR ultra grade water) were included in each run.

2.6 Agarose gel electrophoresis

Agarose gel (1.5%) was prepared by mixing 200ml of 1x TAE buffer (40mM Tris, 20mM acetate and 2mM EDTA) and 3g of agarose (Invitrogen, Paisley, UK). Mixture was melted in microwave oven until completely clear and was allowed to cool to about 50oC. Ethidium bromide (30µl of 1µg/ml solution) was added just before pouring and was then submerged in 1x TAE buffer solution in gel tank when the gel had set. 5µl of loading buffer (0.25% bromophenol blue and 15% Ficoll) (Sigma) was added to each PCR sample and 15µl of sample were loaded into each well. 15µl of 1kb DNA ladder (New England Biolabs) was used to determine the PCR product size. The gel was run in an electrophoresis gel tank (geneflow midi electrophoresis tank, Staffordshire, UK) and was visualised using a gel documentation system (U:Genius, Syngene).

Table 2. Primers and PCR reaction conditions

An initial 94oC for 4 minutes to denature DNA followed by the programmed detailed below:

Gene

Primer

5' - 3' Sequence

Reference

PCR Conditions

Product size

sea

SEA-F

AAAGTCCCGATCAATTTATGGCTA

(Nashev et al., 2004)

94oC for 120s, 55oC for 120s, 72oC for 60s

~ 30 cycles

216bp

SEA-R

GTAATTAACCGAAGGTTCTGTAGA

seb

SEB-F

TCGCATCAAACTGACAAACG

(Nashev et al., 2004

94oC for 120s, 55oC for 120s, 72oC for 60s

~ 30 cycles

278bp

SEB-R

GCAGGTACTCTATAAGTGCC

sec

SEC-F

GACATAAAAGCTAGGAATTT

(Nashev et al., 2004

94oC for 120s, 55oC for 120s, 72oC for 60s

~ 30 cycles

257bp

SEC-R

AAATCGGCTTAACATTATCC

sed

SED-F

CTAGTTTGGTAATATCTCCT

(Nashev et al., 2004

94oC for 120s, 55oC for 120s, 72oC for 60s

~ 30 cycles

317bp

SED-R

TAATGCTATATCTTATAGGG

tsst-1

TSST-F

ATGGCAGCATCAGCTTGATA

(Nashev et al., 2004

94oC for 120s, 55oC for 120s, 72oC for 60s

~ 30 cycles

350bp

TSST-R

TTTCCAATAACCACCCGTTT

pvl

PVL-1

ATCATTAGGTAAAATGTCTGGACATGATCC

(Lina et al., 1999)

94oC for 30s, 55oC for 60s, 72oC for 60s

~ 35 cycles

433bp

PVL-2

GGATCAACTGTATTGGATAGCAAAAGC

3.0 Results

3.1 Antibiotic Susceptibility

The susceptibility of fifty three Staphylococcus aureus strains, isolated from faecal samples from patients suffering from diarrhoea was investigated to determine the phenotypic characterisation of the isolates. Antibiotic susceptibility results as shown in Table 3 were interpreted by referring to the BSAC guidelines (Version 8, 2009). The data in Table 3 is accumulated from two separate experiments; antibiotic susceptibility disc diffusion for twelve antibiotics (chloramphenicol, ciprofloxacin, clindamycin, erythromycin, fusidic acid, minocycline, neomycin, oxacillin, penicillin, rifampicin, tetracycline and vancomycin) and detection of toxin genes by PCR.

Of the fifty three isolates, 45 isolates (85%) were found to be penicillin resistant thus showed the most resistant antibiotic to S. aureus. Twelve isolates (23%) were ciprofloxacin resistant, 8 (15%) were fusidic acid resistant, while 7 (13%) were oxacillin resistant. Tetracycline and neomycin confer resistance to 1 (2%) and 2 (4%) isolates respectively. 12 isolates (23%) were erythromycin resistant, 10 (19%) of which expressed inducible resistance to clindamycin. Vancomycin, rifampicin, minocycline and chloramphenicol on the other hand did not give resistance to any strains tested. The percentage of multiply resistant strains was relatively low in methicillin-sensitive S. aureus strains; Nine (16.9%) strains were resistant to two substances, and four (7.5%) were resistant to three agents. Eighty nine percent of methicillin-resistant S. aureus strains showed multiply resistance to three or more substances.

Table 3. Summary results for antibiotic susceptibility testing and detection of toxin genes by PCR.

Strain No

Uni Lab No

Age (years)

Sex

Strain

Hospital or Community

Antibiotic Resistance

Presence of Toxin Gene

1

2316

2M

M

MSSA

Community

Pen

-

2

2317

39

F

MSSA

Community

Pen, Ery, Clin

-

3

2318

41

M

MSSA

Community

Pen

-

4

2336

15

M

MSSA

Community

Pen, Ery, Clin

-

5

2337

15

M

MSSA

Community

Pen, Fus

-

6

2339

8M

M

MSSA

Community

Pen

-

7

2342

1

M

MSSA

Community

Pen

-

8

2357

2

M

MSSA

Community

Pen

seb

9

2361

71

M

MSSA

Community

Pen

sec

10

2365

10M

M

MSSA

Community

Pen

-

11

2374

12

F

MSSA

Community

Pen, Ery

sea

12

2379

72

M

MSSA

Community

Pen, Cip, Fus

-

13

2395

3M

M

MSSA

Community

Pen

seb

14

2403

64

F

MSSA

Community

Pen

seb

15

2409

43

F

MSSA

Community

Pen, Ery

-

16

2417

10M

F

MSSA

Community

Pen

-

17

2437

44

M

MSSA

Community

NONE

-

18

2468

1M

F

MSSA

Community

Pen

-

19

2483

72

M

MSSA

Community

Pen

-

20

2487

42

F

MSSA

Community

Pen, Fus

tsst-1

21

2426

7M

M

MSSA

Community

Pen, Cip, Tet

-

22

1207

85

F

MRSA

Community

Pen, Cip, Ery, Clin, Fus, Oxa

-

23

2619

79

F

MRSA

Community

Pen, Cip, Ery, Clin

-

24

2739

3M

F

MRSA

Community

Pen

-

25

2496

17

M

MSSA

Community

Pen

-

26

2412

1M

M

MSSA

Hospital

Pen

-

27

2486

1M

F

MSSA

Hospital

Fus

-

28

2542

95

F

MSSA

Hospital

Ery, Clin, Fus

-

29

2624

82

F

MSSA

Hospital

Pen, Cip, Oxa

tsst-1

30

2633

2M

F

MSSA

Hospital

Pen, Fus

-

31

2685

4M

M

MSSA

Hospital

Pen

-

32

2687

84

F

MSSA

Hospital

Pen, Fus

-

33

2794

85

F

MSSA

Hospital

Pen

tsst-1

34

2803

85

F

MSSA

Hospital

Pen

tsst-1

35

975

18

F

MSSA

Hospital

Pen

-

36

993

2

M

MSSA

Hospital

Pen

-

37

1008

4

M

MSSA

Hospital

NONE

-

38

1016

4

M

MSSA

Hospital

NONE

-

39

1026

21

F

MSSA

Hospital

NONE

-

40

1055

40

F

MSSA

Hospital

Pen

sec

41

1064

1M

M

MSSA

Hospital

Pen

sed

42

1094

10

F

MSSA

Hospital

Pen, Cip, Ery, Clin

-

43

1132

83

F

MSSA

Hospital

NONE

-

44

1176

47

M

MSSA

Hospital

Pen

-

45

1250

11M

F

MSSA

Hospital

Pen

-

46

2377

67

F

MRSA

Hospital

Pen, Cip, Oxa

-

47

2383

86

F

MRSA

Hospital

Pen, Cip, Ery, Clin, Neo, Oxa

-

48

2455

53

M

MRSA

Hospital

Pen, Cip, Ery, Clin, Neo, Oxa

-

49

2464

67

F

MRSA

Hospital

Pen, Cip, Oxa

-

50

2625

79

F

MRSA

Hospital

Pen, Cip, Ery, Clin

-

51

1276

6

M

MSSA

Community

NONE

-

52

1282

1M

M

MSSA

Hospital

Pen

-

53

2707

79

F

MRSA

Hospital

Pen, Cip, Ery, Clin, Oxa

-

Abbreviations used are as follows: cip- ciprofloxacin, clin- clindamycin, ery- erythromycin, fus- fusidic acid, oxa- oxacillin, neo- neomycin, pen- penicillin G, tet- tetracycline, MSSA- methicillin sensitive S. aureus, MRSA- methicillin resistant S. aureus and (-) gene not detected.

3.1 PCR assay

PCR was conducted to identify the toxin genes present within the strains. All strains were screened for the presence of six toxin genes; sea, seb, sec, sed, tsst-1 and pvl. Of the fifty three strains screened for these toxin genes, only a few toxin genes were detected, as represented in Table 3; 1 (2%) sea, 3 (6%) seb, 2 (4%) sec, 1 (2%) sed, and 4 (9%) tsst-1 gene. The presence of these genes was indicated by a band which was in alignment to the bank of the positive control, which was visualised on the agarose gel as illustrated in Figure 1. It was found that none of the fifty three isolates had pvl toxin gene, as indicated by the persistent absence of banding on the agarose gel. Multiplex PCR was also attempted for simultaneously detecting toxin genes sea, seb and sec to confirm the results generated from the single detection of toxin gene, as illustrated in Figure 2.

The analysis of this study is combined with the results generated from a similar study counducted by Rashid (2009) to create a greater range of statistical analysis; One hundred and six S. aureus strains were therefore collated in total. The combined results of these studies are presented in Table 4.

Table 4. Summary results for the total number and percentage of toxin genes detected in two combined studies.

Toxin Gene

No. of positive strains

Percentage (%)

sea

3

2.8

seb

9

8.5

sec

6

5.7

sed

1

0.9

tsst-1

12

11.3

pvl

0

0

1 2 3 4 5 6 7 8

(Lanes)

Figure 1. PCR analysis of sea toxin genes. The content of each lane was as follows: Lane 1) DNA 100bp ladder, 2) sea positive control 3) strain 11, 4) strain 12, 5) strain 13, 6) strain 14, 7) strain 15, 8) negative control.

1 2 3 4 5 6 7 8

(Lanes)

Figure 2. Multiplex PCR analysis of sea, seb, and sec toxin genes. The content of each lane was as follows: Lane 1) DNA 100bp ladder, 2) sea positive control 3) sea and seb positive control, 4) sec positive control, 5) strain 1, 6) strain 2, 7) strain 3, 8) negative control.

4.0 Discussion

Fifty three strains of Staphylococcus aureus, supplied by Harrogate Hospital were selected randomly to detect the presence of genes encoding the toxins sea, seb, sec, sed, tsst-1 and pvl. These strains were isolated from faecal samples of patients suffering from diarrhoea in conjunction with a survey conducted by Harrogate Hospital themselves. The one year survey was conducted to gather the prevalence of S. aureus in faecal samples from patients with diarrhoea; hence the strains were of intestinal origin. However it has not been determined that the presence of these pathogens was the cause of illness as some other pathogens alongside S. aureus were also isolated e.g. Salmonella spp, campylobacter spp, E. coli 0157 and adenovirus. The absolute status of these isolates is therefore unknown.

Very few toxin genes were detected in these studies. The results revealed that the seb gene was the most prevalent among the classical staphylococcal enterotoxin (8.5%). sec gene was the second most detected (5.7%). Yang et al., (2005) shows that SEB could be associated with an autoimmune disease, ulcerative colitis. SEB increases the epithelial permeability thus compromising the intestinal barrier function and initiate inflammation in the intestinal mucosa. Sinusitis-derived SEB may be swallowed down to the gastrointestinal tract and consequently induce lesions to the intestinal mucosa (Yang et al., 2005). SEB has been well characterised in one of the toxic substances in the secretions from chronic sinusitis. It is known to be able to down regulate intestinal barrier function (Lu et al., 2003). The relationship between staphylococcal infection and pathogenesis of airway diseases e.g. cot deaths is also being studied. SEA and SEB triggers airway recruitment of several pro-inflammatory cell types and induce the release of histamine from leukocytes (Bachert et al., 2002). The toxins present in this study however may not be high enough to be the causative agent of the disease.

Methicillin-sensitive S. aureus strains in both hospital and community had low antibiotic exposure, which shows that they are commensal and are not pathogenic as they do not seem to have been treated with antibiotics for causing infection. MRSA strains on the other hand were not clonal as the strains showed variety of antibiotic resistance and Rashid (2009) showed the presence of different toxin genes in one of the strains. Although several recent studies have suggested that lasting colonisation of S. aureus in the human intestinal tract occurs and may have important clinical implications, it has been sparsely studied as compared to nasal carriage. Intestinal S. aureus carriage was first studied in the 1950s and 1960s as a potential cause of antibiotic associated diarrhoea (Williams, 1963), however after the identification of Clostridium difficile, the role of gastrointestinal colonisation as a risk factor for S. aureus infection has been neglected. The rise in the incidence of MRSA strains, as opposed to MSSA has contributed to the recent interest in intestinal S. aureus colonisation (Acton et al., 2009).

A high rate of enterotoxin would be expected in food poisoning outbreak. In a study of staphylococcal enterotoxin (SE) in S. aureus isolates from food poisoning cases in Taiwan, it was demonstrated that 91.8% were positive for at least one SE or tsst-1 gene and sea were the major ones found in those cases (Chiang et al., 2008). For strains with tsst-1 gene, as high as 59.1% of the strains harbored this gene. The incidence for TSST-1 strains found in Taiwan isolates seems to be high when compared to the food poisoning outbreaks reported in Japan (Omoe et al., 2005). Reports for S. aureus isolates from sheep and goat bulk tank milk samples (Scherrer et al., 2004) also showed high ratios of tsst-1 strains. It has been known that certain superantigenic toxin and tsst-1genes are associated with mobile genetic elements, such as pathogenicity islands, plasmids and prophages. Such fact imply that the SE or superantigen genes are transferred horizontally between staphylococcal strains (Omoe et al., 2005). Although only 11.3% of the strains in this study were positive for tsst-1, it can be concluded that colonisation with a TSST-positive strain does not result in illness because tsst-1 production may not be high enough or because tsst-1 alone may not be sufficient to cause the disease. Studies have also shown that tsst-1 is related to relapses of Wegener's granulomatosis (WG) (Popa et al., 2007), which is a form of idiopathic small-vessel vasculitis. tsst-1 positive S. aureus strains produce lower amounts of haemolysin and have a survival advantage within endothelial cells hence more difficult to eradicate and are therefore related to relapses of WG (Popa et al., 2007).

The pvl genes were strongly associated with skin and soft tissue infections, such as boils, skin lesions and abscesses when isolates were grouped according to type of staphylococcal infection. These results confirm and expand on the findings of Lina et al (1999). High prevalence of pvl genes (90%) was detected in MSSA strains isolated from wound, burns, and from abscesses of patients from Pakistan; no pvl gene was detected in MRSA strains (Chikaonda 2008). Isolates from patients with invasive infections, such as endocarditis and osteomyelitis, did not harbor the pvl genes, nor did isolates from patients with food poisoning and toxic shock syndrome (Holmes et al., 2005). These results, again are similar to the findings of Lina et al., (1999). Therefore all the studies carried out on pvl toxin gene have revealed that the pvl genes are carried by a relatively low number of S. aureus isolates. No pvl toxin gene is detected in this study.

Individuals affected in the community (where the rate of disease is low) may represent those most genetically predisposed to S. aureus infection, while individuals infected in the hospital (where the burden of disease is higher) may represent a much larger at-risk group who may or may not carry susceptibility genes. Given this scenario, it is possible that the pattern or number of bacterial determinants associated with disease in the hospitalised host would differ from that seen in the community. However, little difference was found between strains associated with the toxin genes detected, suggesting that bacterial factors could play a role in causing disease. Detection of enterotoxin genes by PCR however does not provide proof that the enterotoxin itself is produced and this technique is limited with regards confirming the expression of the genes. Immunologic methods or bioassay should be employed in order to demonstrate the capability of S. aureus strains to produce enterotoxin proteins (Marcos et al., 1999). The expression of enterotoxin genes in can also be confirmed by a reverse transcription real-time PCR which facilitates detection on an RNA level (Lee et al., 2007). Consequently toxic hazards of S. aureus can be evaluated more effectively when comparing the expression of various staphylococcal toxin genes.

In conclusion, this study has demonstrated the variable presence of toxin genes in natural populations of S. aureus, although in this case colonisation was more prevalent than infection. Strains isolated were neither pathogenic nor invasive and are thought to be present in the intestine as communal gut bacteria. There was also evidence of considerable horizontal transfer of genes on a background of clonality. This study also indicates that it may be an oversimplification to consider virulence of toxin gene in relation to the presence or absence of a given bacterial factor.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.