Exploring Different Approaches To Gene Therapy Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The process of evolution has designed organisms in all three domains of life to pass on hereditary information from one organism to another through genes. Particularly, a gene is a hereditary unit that is found in an organism's genome and it usually occupies a specific location on a chromosome. Thus, a gene can also be described as a sequence of DNA that codes for a particular product, such as, a protein for example that a living cell might need. Unfortunately, sometimes the genes are altered or they are defective and thus genetic disorders occur. As a result, the functional products are not formed and the organisms cannot sustain proper function. For instance, in humans this can result in a disease such as cystic fibrosis or Duchenne muscular dystrophy. Nevertheless, with advances in technology and research, the modern field of gene therapy foreshadows a bright future to the treatment of many genetic disorders. Gene therapy is used to correct many defective genes that are responsible for the disease development. The most common approach to fixing the defective genes is to insert a normal functioning gene within the genome and replace the nonfunctional gene (Mansfield, 2009). Another approach to gene therapy is to use a homologous recombination, where an abnormal gene is swapped for a normal gene, without affecting any other locus in the genome. In homologous recombination the nucleotide sequences are exchanged between similar or identical DNA strands, through physical breaking and rejoining of the DNA strands in prophase I of meiosis I. As observed in figure 1.1a, during the homologous recombination the chromosomes align and exchange genes. As also seen in figure 1.1b, the final product contains swapped genes, where gene of interest and engineered construct switched places as a result of homologous recombination.

Figure 1.1: Figure (a) shows the alignment of chromosomes and homologous recombination taking place. Figure (b) illustrates the final product as a result of homologous recombination, where the gene of interest and engineered constructed swapped places.

This experiment utilized a haploid type of yeast called Saccharomyces cerevisae, where homologous gene recombination was employed to delete purine biosynthesis gene called ADE2, using a hybrid piece of DNA that was generated through a polymerase chain reaction (PCR) (Gilbride et al., 2009). The hybrid piece of DNA used in this experiment had untranslated regions (UTRs) of the ADE2 gene and a sequence that codes for a protein of the TRP1 gene. Thus, in the process of homologous recombination, the UTRs of the ADE2 gene that were part of the hybrid PCR fragment, targeted the specific ADE2 gene, which was located in the yeast's genome. Further, in the process, the ADE2 gene was deleted and replaced by the TRP1 gene, which is essential for tryptophan biosynthesis. The yeast strain used in this experiment had a TRP1 gene originally deleted from its genome and thus, it order to survive, it would have to depend on the media that contains tryptophan (trp+), since it is unable to synthesize tryptophan by itself (Gilbride et al., 2009). In this experiment the insertion of the TRP1 gene into the yeast's genome, allowed the yeast to survive on the medium that does not contain tryptophan (trp-) and thus, the organisms that had a deleted ADE2 gene and inserted TRP1 gene could be selected. Furthermore, the organisms could also be differentiated, since the deleted ADE2 gene caused the organism to change phenotypes from cream-colored to red/pink, as a result of accumulation of purine precursors in the vacuole (Gilbride et al., 2009). The phenotype of TRP1 gene in the organisms was also observed, since the insertion of TRP1 gene into the yeast's genome transformed the organism from tryptophan-dependent to tryptophan-independent and the transformed strains were able to survive on the media that did not contain tryptophan. It is hypothesized that in this experiment the ADE2 gene will be deleted and replaced with TRP1 gene through homologous recombination, where the result of this change will be confirmed phenotypically and therefore; the new yeast strain will transform from cream-colored to red/pink colored, to confirm the ADE2 gene deletion and from tryptophan-dependent to tryptophan- independent, to confirm TRP1 gene insertion. Thus, the objective of this experiment was to delete the ADE2 gene and replace it with TRP1 gene through homologous recombination. Furthermore, the other objective of this experiment was to establish the basis for gene therapy, through the observations of phenotypic changes in Saccharomyces cerevisae that confirmed that the gene replacement has taken placed.

Materials and Methods

Refer to pages 20-28 in the Biotechnology 888 Laboratory Manual for detailed description of materials and methods (Gilbride et al., 2009).

Day 1: PCR to Generate ADE2/TRP1 Hybrid Construct

Two PCR reactions were set up, where one microcentrifuge tube contained the plasmid DNA template: pFA6a-TRP1 and the other did not, to serve as a "negative control". Further, Table 4 on page 23 of the Experiments in Biotechnology Lab Manual was used to set up the "Master Mix" in sterile mictrocentrifuge tube, to reach the final concentration in reaction of 1X of 10X polymerase buffer, 1.5mM of 20mM MgSO4, 300µL of each 10mM dNTP Mix, 0.5µL of primer 1 (forward, with a sequence: 5'CAATCAAGAAAAACAAGAAAA TCGGAC AAAACAATCAAGTCGGATCCCCGGGTTAATTAA 3') and primer 2 (reverse, with a sequence 5'TTTTATAATTATTTGCTGTACAAGTATATCAATA AACTTAGAATTC GAGCTCGTTTAAAC3'), which were from the DNA Synthesis Facility, Hospital for Sick Children and lastly, 2.5 units of taq polymerase, making sure that any template DNA was not added to this mix, to avoid any premature reactions. The vortex was further used to mix the contents of the "master mix" and 47.5µL of the "Master Mix" was dispensed into two PCR tubes. To one of the PCR tubes the DNA template pFA6a-TRP1 was added and to the second tube that served as negative control, sterile water was added. These two tubes were further placed in a thermocycler that ran by the program outlined in table 5 on page 23 of the Experiments in the Biotechnology Lab Manual. After the PCR reaction was completed, the tubes were frozen at -20°C until the following week.

Day 2: Confirm PCR Product Generation

Following the instructions on page 4 of the Experiments in the Biotechnology Lab Manual, a 2% agarose gel in 0.5x TBE buffer, with ethidum bromide was prepared to confirm that the PCR product that was around 1000 base pairs in length was formed. Thus, 5µL of each PCR sample was mixed with 2µL of loading dye and along with 100 base pair DNA ladder, the samples were loaded on the gel and electrophoresed at 100volts for 45 minuets. Using the Gel Imaging System, which visualized the bands based on molecular size, it was confirmed that a 1000 base pair PCR product was formed and the leftover PCR tubes were frozen at -20°C until the following week.

Day 3: Transform yeast with hybrid PCR product using lithium acetate

A culture of Saccharomyces cerevisae (ATCC #4007202) was harvested at 0.6 x 10^8 cells/mL and further, centrifuged at 5100 rpm for 5 minutes. The medium was decanted and the cells were resuspended in sterile water. To pellet the yeast cells, the mictrocentrifuge tube with water was subjected to centrifugation at 5100 rpm for 5 minutes. The water was further decanted into the biohazard beaker and the cells were resuspended in 0.1M lithium acetate in TE buffer. This mixture was further divided up between two 1.5mL microcentrifuge tubes, where one of the tubes served the purpose of "negative control". Further, to pellet the mixture, the microcentrifuge was used at top speed for 15 seconds. The lithium acetate/TE was removed and decanted into the biohazard beaker. Further, the table on page 27 of the Experiments in Biotechnology Lab Manual was used to add the listed reagents into the two tubes, making sure not to add the PCR product into "negative control" tube. After the reagents were added, the tubes were vortexed vigorously to resuspend the cell pellet completely and incubated at 30°C for hour and half. Further, DMSO was added to each tube and to mix the contents the tubes were inverted several times by hand and subjected to heat shock at 42°C for 15 minutes. Each tube was further subjected to a centrifuge at 7000rpm for 15 seconds to collect the pellet. The transformation mix was removed and decanted into a biohazard beaker, while the pellet was resuspended in sterile water. Using the spread plate technique, three SDA-trp plates were used for each tube and the transformation contents were plated. For the purpose of determining the transformation efficiency, two different volumes were plated (two 200µL and one 100µL on each plate). Lastly, when all the liquid on the plates was absorbed, the plates were inverted and incubated for 2-3 days at 30°C.

Day 4: Analyze yeast transformation results

The plates were examined for appearance of red and cream colored colonies that formed. Furthermore, the number of each type of colony was counted on each plate and used for calculating the score transformation.

Results

As demonstrated by figure 1.1, the 1000 base pair hybrid DNA that was generated by PCR reaction was confirmed and observed in all four lanes. This hybrid DNA contains 5' and 3' untranslated regions of the ADE2 gene and protein coding sequence of the TRP1 gene. No results were observed for negative control on the gel, since negative control did not contain any DNA. The weight of the hybrid DNA was determined by comparing the distance migrated by the DNA in relation to the 100 base DNA ladder with corresponding weights, which are shown on the right hand side of the image. Lastly, since none of the members in the laboratory received any results on the gel that showed the successful formation of the PCR product, the gel image that is shown in figure 1.1 was provided by the lab coordinator.

Figure 1.1: 2% agarose gel in 0.5X TBE buffer, after electrophoresis showing 6 lanes (from left to right): 100 base pair DNA ladder, Lane 1: 1000 base pair PCR product , Lane 2: 1000 base pair PCR product, Lane 3: 1000 base pair PCR product Lane 4: 1000 base pair PCR product. Lane 5: Negative control without DNA. The corresponding weights for the 100 base pair ladder in base pairs are shown to the right of the gel.

Tables 1.1 and 1.2 illustrated data for the yeast strains that were plated on the plates that did not contain tryptophan (-trp) in the media. As illustrated by table 1.1, the yeast strain that was plated on these plates contained the transformed TRP1 gene and therefore different numbers of colonies were able to grow on these plates that did not have any tryptophan in the media. Furthermore, the color of the colonies corresponds to missing or present ADE2 gene. The cream colored colonies indicate that ADE2 gene was not deleted and that it was still present in these strains. The red color corresponds to the colonies that had the ADE2 gene deleted out of their genome. The calculation for score transformation is shown in the appendix section of this lab report. Table 1.2 shows data for negative control. The tube for negative control contained water instead of the PCR product and therefore the yeast strains plated did not contain the TRP1 gene and were unable to grow on the -trp medium.

Table 1.1: The information for the plates that had growth is illustrated. The volumes plated and type of agar used is also shown. The contents were plated from the tube that contained the PCR product and therefore the transformation was observed in these strains. The number of colonies, colony color as well as total number of colonies formed is also shown in the chart.

Type of Agar Plate

Volume Plated (µL)

Plated from the tube that contained transformation (TRP1+ gene)?

Number of cells formed and cell color

Total number of colonies on each plate

1 ) -trp

200

Yes

65 cream, 2 red

67

2) -trp

200

Yes

56 cream and 1 red

57

3) -trp

100

Yes

33 cream and 2 red

35

Table 1.2: The data for negative control is illustrated. The type of agar used and volume plated is also shown. The negative control contained water instead of the PCR product and therefore this tube did not contain any transformation and TRP1 gene was missing in these strains. No growth was observed on tryptophan missing media.

Type of Agar Plate

Volume Plated (µL)

Plated from the tube that contained transformation (TRP1+ gene)?

Number of cells formed and cell color

1 ) -trp

200

No

No growth

2) -trp

200

No

No growth

3) -trp

100

No

No growth

Discussion

The purpose of the first portion of the experiment was to use PCR to produce ADE2/TRP1 hybrid DNA construct. This PCR fragment contained the 5' and 3' untranslated regions of the ADE2 gene and a sequence that codes for a protein of the TRP1 gene. In this experiment the utilized plasmid DNA was modified to make sure that it contained the TRP1 gene for synthesis of tryptophan flanked by 40bp homology on each end to ADE2, gene of interest. Thus, this 40bp region directed the PCR fragment towards the ADE2 gene in the yeast genome, which acted like a selection marker for this particular gene. The analogy of this method could be observed in figure 1.2a and 1.2b, where the ADE2 gene to be deleted in the genome of wild type Saccharomyces cerevisae (S. cerevisae) is shown above the hybrid DNA product generated by PCR. This PCR product is annealed to the DNA of S. cerevisae after recombination.

a)

b)

Figure 1.2: As illustrated by part (a) of the figure, the DNA of wild type strain of S. cerevisae is shown that contains 40bp homology regions complementary to the TRP1 gene sequences. Part (b) of the figure demonstrates the hybrid piece of DNA that resulted after recombination. The TRP gene is annealed to the 40bp flanking regions at each untranslated region of the ADE2 gene.

Thus, the PCR in this experiment was used to amplify the hybrid DNA that contained the TRP1 gene and 40bp homology that targeted the ADE2 gene. In this reaction, the forward and reverse primers were utilized. The forward primer at the 5' end had the same sequence as the template strand and the reverse primer that was attached at the 3' end of the DNA had a complimentary sequence of the template strand. These primers bound to the DNA fragments and served as attachment sites for the taq DNA polymerase, allowing DNA elongation. The final PCR product was around 1000bp pairs in length; containing the ADE2 5' and 3' untranslated regions, which formed 40 base pair homology and allowed the tryptophan synthesizing TRP1 gene flanking regions to bind to this construct. To ensure that the ADE2/TRP1 hybrid construct was formed, the DNA was run on a 2% agarose gel electrophoresis. As shown in the results section, four bands that were 1000 base pairs in length were observed on the gel. The bands represent the successful PCR reaction and to ensure its accuracy, the PCR sample from the tube that contained DNA was replicated four times. The size of the fragments was determined using a 100 base pair DNA ladder that showed approximate sizes of the fragments. Thus, the bands on the gel were an example of a positive control. The experiment also utilized a negative control, where the tube contained the exact same materials as the reaction tube, but instead of the DNA to be amplified it contained water. When the sample from this tube was loaded onto the gel in lane 5, no results were obtained, since as expected, this tube did not contain any DNA. Unfortunately the results section for this experiment contained the gel image of the gel prepared by the lab technician, since the morning section did not receive any bands on the gel. This could have been as a result of number of factors. For example, mechanical errors like sample contamination could of lead to faulty results. Furthermore, cross mixing could have also occurred where some stock components were added to the tubes that they were not supposed to be added to. The lack of results could have been also due to the polymerase chain reaction itself, where not enough DNA was amplified. This could be possibly blamed on incorrect temperature settings on the PCR machine. If the temperature was too low, the DNA strand would not get denatured and thus, the complementary bases would still be hydrogen bonded to each other and the reaction would not take place. If the temperature was too high, the primers would not be able to anneal to the DNA strands, which would also lead to failed reaction. Furthermore, Taq polymerase has an optimal function of 75-80°C and thus, if the temperature was hindered, taq polymerase function could have been impaired and elongation step would be halted (Chien et al., 1976). As a result, either the DNA that was produced would be too small or it might not have been produced at all. If the DNA was too small, it would run off the gel undetected.

The purpose of the subsequent part of experiment was to demonstrate gene therapy, through homologous recombination. To ensure that a successful transformation reaction has taken place, positive and negative controls were used. The contents of the tubes were identical, except for the fact that negative control did not contain the PCR product and positive control did. This experiment utilized the S. cerevisae (ATCC #4007202) strain, where using homologous recombination, the ADE2 gene was deleted and replaced with TRP1 gene simultaneously, transforming the new strain from tryptophan-dependent to tryptophan-independent. This transformation occurred through homologous recombination, where the hybrid ADE2/TRP1 DNA was transformed back into the wild type by deleting the ADE2 gene, replacing it with TRP1 gene and expressing the TRP1 gene in the genome of S. cerevisae (ATCC #4007202). As illustrated by figure 1.3a, the homologous recombination occurs because the 5' and 3' untranslated regions of the hybrid piece of DNA complements the flanking regions of the ADE2 gene on the wild type DNA. As a result, during homologous recombination these two regions bind to each other and the TRP1 gene is inserted into the wild type S. cerevisae (ATCC #4007202) strain. The final product of homologous is illustrated in figure 1.3b.

a)

b)

Figure 1.3: In the part (a) of the figure, the homologous recombination is shown. The top strand is the wild type S. cerevisae (ATCC #4007202) stain that contains the ADE2 gene. The bottom strand is the hybrid ADE2/TRP1 DNA construct. As a result of homologous recombination, the ADE2 gene is deleted and the TRP1 gene is inserted into the S. cerevisae (ATCC #4007202) wild type strain. The new wild type strain that contains the TRP1 gene is shown in part (b) of this figure.

The TRP1 transformation was detected using the synthetic defined yeast media lacking tryptophan agar plates (SDA-trp). Since the ADE2 yeast strain was altered prior to the experiment, it was unable to produce tryptophan and thus, it would have to be plated on the media that contains tryptophan in order for it to survive. In this experiment, SDA-trp media was used for the purpose of selecting the yeast strain that undergone homologous recombination. Thus, if the homologous recombination was successful, in theory the TRP1 gene should have been inserted into the genome of this new strain and this strain would be able to produce its own source of tryptophan and as a result, survive on the SDA-trp media plates. Results demonstrated that TRP1 gene was indeed inserted into the genome of this new strain, since the cell growth on SDA-trp plates was observed. Furthermore, the ADE2 gene provided the basis to distinguish the cells based on the phenotypic traits. Thus, if the ADE2 gene is present the yeast cells appear cream-colored, which displays normal purine biosynthesis. However, during the homologous recombination the ADE2 gene is deleted and replaced by the TRP1 gene. As a result of the ADE2 gene deletion, the yeast cells change from cream-colored to red-colored, due to accumulation of the purine precursors in the vacuole. In this experiment red yeast cells were observed, which confirmed that homologous recombination has taken place.

After the yeast strains were plated, different results were obtained. When two 200µL and 100 µL volumes were plated from the negative control, as expected, no cell growth was observed on the plates. This is due to the fact that, this tube did not contain the PCR product and thus, there would be no way for the yeast cells to transform from trp-dependent to trp- independent strain and survive on the -trp media. However, after the plating the cells using the positive control tube, different number of cell growth has taken place. After plating the first 200 µL volume, 65 cream and 2 red cells grew on the -trp plates. This means that transformation has taken place in 2 cells and the calculated transformation score for this volume was 2.99%. For the second 200µL volume, 56 cream colored and 1 red colored cells were observed, where transformation score for this volume was 1.75%. Lastly, for 100µL volume, 33 cream-colored and 2 red cells were observed, where transformation score for this volume was 5.71%. Overall, the transformation scores are very low. Several sources of error might have contributed to the low transformation scores. For example, mechanical errors where tubes were contaminated could of lead to the low transformation scores. Furthermore, the hybrid piece of DNA could have attached to the genome of the yeast strain and supply the TRP1 gene which allowed the cell to survive on the -trp plates, however, the ADE2 gene was never deleted and thus that is why the colonies did not change color. Also, the cells that grew on the plates could have reverted back to wild type TRP1 as a result of a mutation, and thus these cells would be also able to survive on the -trp plates. Lastly, there could be a chance that TRP1 gene was never deleted in the majority of the original yeast cells that were supplied for this lab and thus, regardless of the experiment the TRP1 gene would be present in the yeast genome, allowing it to survive on the -trp plates and appear white.

Conclusion

This laboratory provided the basis for gene deletion and gene therapy. The overall purpose of this laboratory was to delete the ADE2 gene and replace it with TRP1 gene and to establish the basis for gene therapy by observing the phenotypic changes. Both of the tasks produced mediocre results, since low transformation scores were obtained. Lastly, the hypothesis of this experiment was supported since the yeast strain transformed from tryptophan-dependent to tryptophan-independent, and phenotypic changes were also observed.

Gene Deletion Questions

1. The purpose of the following reagents in the transformation mixture is:

Lithium acetate allows yeast cells to become more permeable to exogenous DNA. This increases the DNA uptake and thus, overall the transformation frequency.

Polyethylene glycol (PEG) increased the permeability of the yeast cells by enlarging the pores in the cell membrane (Hood & Stachow, 1992). Also PEG protects the yeast cells from high salt concentrations and precipitates.

Salmon sperm DNA (ssDNA) is used as a carrier to increase the rate of transformation. Also, salmon sperm reduces the binding of the plasmid DNA to the yeast cell membrane and thus, increases the overall transformation rate (Shiestl & Gietz, 1989).

2. This question is answered in the lab.

4. In this experiment the cream-colored colonies should not be growing on the "+ DNA" plate because the purpose of this experiment was to delete the ADE2 gene and replace it with the TRP1 gene. Thus, cream-colored colonies represent the hybrid construct, where the ADE2 gene was not deleted and the TRP1 gene is expressed, since the yeast strain is able to survive on the -trp plate. The cream-color phenotype occurs as a result of normally functioning ADE2 gene that is involved in purine biosynthesis. The phenotype changes to red as a result of purine precursors accumulating in the vacuole and in this case this does not happen.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.