Experimental Procedures Plasmids Cell Lines And Antibodies Biology Essay

Published:

Human immunodeficiency virus type-1 (HIV-1) persists in the host by employing multiple genetic strategies that contribute to lifelong infection and successful transmission. First, by irreversibly integrating its DNA into the host cell genome to establish the provirus, HIV-1 safeguards its survival for the lifetime of the infected cell. Second, viral sequence diversification during infection allows the virus to escape or tolerate adaptive immune responses. And, third, despite its compact genome comprising just nine ORFs, four of the accessory genes (nef, vif, vpu, and vpr) now appear to be dedicated to various aspects of evasion from (and manipulation of) adaptive and innate immunity. Indeed, these viral immunomodulatory genes are frequently seen as dispensable in many in vitro cell culture systems-leading to their loss during long-term propagation-yet are strongly maintained in the context of natural infections in vivo. Among these accessory genes, pleotropic functions of Nef have been studied extensively. It is a 27-30 kDa, N-terminal myristoylated protein, having a well characterized CD4 down regulation activity. Nef does not possess any enzymatic activity but it has been shown as an essential protein in viral pathogenesis as it modulates diverse signaling pathways and gene expression of cellular proteins (1;2). Nef influences the activation state of the host cell by bringing together different host cell proteins, protein kinases, and components of the endocytic machinery and making the cells permissible to the virus (3;4). All the functions of Nef are evident by a number of important events such as activation of upstream signaling molecules, activation and up-regulation of transcription factors, inhibition of apoptosis in the infected cell, alleviation of repressors of transcription, as well as increased infectivity of newly produced virions (5). Even though the functions of Nef have been well studied, debate exists on its role in viral infectivity and replication. Earlier studies in literature have reported Nef as both negative (6;7) and positive (8;9) factor for viral replication. Although a number of reports show that Nef increases viral replication by activating T cells, the molecular basis of Nef-induced viral gene expression and replication remains to be clearly understood. Nef has also been reported to physically interact with Tat and augment viral gene expression (10). However, availability of Tat is critical for elongation step of transcription by RNA polymerase II (RNAPII) from LTR promoter. Many cellular factors have been identified for their roles in this process. Different positive transcription elongation factor b (P-TEFb) complexes isolated from mammalian cells contain a common catalytic subunit (CDK9) and the unique regulatory cyclins CycT1, CycT2a, CycT2b, or CycK (11;12). However, CycT1 containing PTEFb complex is a key host factor responsible for HIV-1 transcription elongation (13). Tat is expressed early in the replicative cycle of HIV and is essential for viral gene expression from long terminal repeat (LTR) promoter (14) [14]. It recognizes the 5' bulge in the transactivation response (TAR) stem loop RNA, which is located at the 5' end of all viral transcripts. Tat binds CycT1, and together, they form the combinatorial surface that interacts with the TAR RNA with high affinity and specificity (12). The obligate partner of CycT1, CDK9, then phosphorylates the CTD of RNAPII and thereby promoting HIV-1 transcription elongation (15).

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

HIV-1 gene expression is controlled by many cellular as well as viral proteins. Evidences also suggest that Nef enhances Tat- mediated viral transcription through hnRNP-K-nucleated signaling complex (16). In another study, Hsp40 seems to interact and co-localize with Nef in nucleus and augment LTR driven expression (17). In contrary, HEXIM1and Hsp70 negatively regulates HIV gene expression and replication (18;19). HEXIM1 along with 7SK RNA is essential for inactivation of PTEFb complex (20;21). The HEXIM-7SK RNA complex has been reported to physically compete with Tat for binding to PTEFb (22). Recently, cyclin K (CycK) has been shown to inhibit viral replication in a T-cell line by inhibiting LTR-mediated transcription (23). CycK was first identified as a protein that could restore progression of the cell cycle and is most closely related to human cyclins C and H (24). The kinase partner of CycK was identified as CDK9 (25). This complex between CycK and CDK9 could also function as a CTD kinase in vitro (25). However, no data demonstrating the mechanism behind CycK-mediated HIV-LTR inactivation has been provided.

Earlier, Nef was reported as a negative factor for viral replication in T-cell line (26) but recent evidences have demonstrated Nef as an enhancer of viral replication (10;16;27-31). However, the molecular mechanism of these opposing functions of Nef needs to be clearly elucidated. Nef performs most of its functions by interacting with cellular proteins (1;5;32). Majority of the functional studies of Nef to date have been performed with subtype B Nef protein. However, there is barely sufficient literature regarding subtype C Nef protein. In this study, we have attempted to identify novel Nef-interacting host cell proteins using subtype C Nef as bait in yeast two-hybrid system. Our results showed both subtype C and subtype B Nef interacted with Human Cyclin K, in vitro and in vivo. Furthermore, CycK expression led to reduction in LTR-mediated gene expression and virus replication in presence of Nef. Finally, CycK along with Nef, disrupted CDK9-CycT1 interaction and inhibited nuclear translocation of CDK9, consequently affected viral gene expression.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

Independently, here we provide direct experimental evidences that CycK physically interacts with Nef and reduction in LTR promoter activity is the outcome of this interaction.

Results

HIV-1 Nef protein interacts with a plethora of cellular proteins, most of which perform critical functions in signaling pathways. Role of Nef in HIV-1 pathogenesis has been well studied; however, the molecular mechanism of how Nef utilizes the cellular factors to execute downstream functions is still a conundrum. Initially, majority of studies have been performed with Nef protein from subtype B, so with intention to identify the cellular factors which subtype-C Nef utilizes, we initiated our study with subtype-C Nef. In present study, the screening of subtype-C Nef-interacting host proteins was carried out. The subtype-C Nef from Indian isolate IN301904 (33) used in the screening has been shown to have 84% similarity with NL4-3 Nef (17).

Identification of a Novel HIV-1 Subtype C Nef-interacting Protein

To identify novel cellular factors interacting with subtype-C Nef, we performed yeast-two hybrid screening. Human Leukocyte cDNA library was screened using full length subtype-C Nef as bait. Positive clones were identified after several rounds of screening and culture on X-gal containing dropout plates (Fig. 1A). The gene expressed in positive clone was amplified by PCR using pACT2-specific primers and sequencing was performed. Sequence analysis and DATABASE comparison revealed that the clone expressed a gene encoding for Cyclin K (NM_003858). To further validate this interaction, liquid β-galactosidase assay was performed and clone expressing Cyclin K and Nef showed β-galactosidase activity comparable to positive (Fig. 1B). To validate our finding, GST-Nef (subtype C) pull-down asaay was performed using Jurkat cell lysate, as described in "Experimental Procedures". The result of pull down clearly indicates that Cyclin K (CycK) interacts with subtype C Nef but not with GST (Fig. 1C). In order to know whether these proteins interact in in vivo conditions, immunoflouroscence staining was performed in subtype C Nef transfected cells. Interestingly both the proteins co-localized in the cytoplasm and modest localization was seen in nucleus (Fig. 1D).

Cyclin K interacts with subtype B Nef in vitro and in vivo

To test whether CycK interacts with subtype B Nef, GST pull down assay was performed, as above. Cyclin K expressing HEK 293T cell lysate was incubated with bead-bound GST and GST-Nef (subtype B). Our GST-pull down assay demonstrated that CycK specifically interacts with GST-Nef and GST alone was used a control (Fig. 2E). Immunoflouroscence staining was also performed in pNL4.3 transfected HEK-293T cells to confirm in vivo interaction of CycK with Subtype B Nef. Both proteins were co-localized extensively in cytoplasm (Fig. 1F). We validated this interaction in physiological scenario by co-immunoprecipitation from uninfected and HIV-1NL4.3 infected CEM-GFP cells and western blotting the immunoprecipitates for the presence Cyclin K in co-precipitates. The analysis of immunoprecipitates has clearly suggested that CycK and Nef interact in infected cells (Fig. 1G and 1H). The uninfected cell lysate served as control in co-IP experiments. These results suggested that Nef interacts with Cyclin K in vitro and in vivo.

Cyclin K inhibits LTR activity in 293T cells

Cyclin K was first identified as a novel C-type cyclin possessing both CTD kinase and Cdk-activating kinase activity (24). Both these activities are important for HIV-1 gene transcription. So, we wanted to examine the possible effect of CycK on HIV-1 LTR promoter driven viral gene expression. HEK-293T cells were co-transfected with pLTR-Luc construct and Tat, Nef and CycK expression vectors as shown in figure 2B. With the increase in the amount of CycK, LTR-driven gene expression was definitely reduced when compared to Tat and Nef transfected cells (Bar 3) (Fig. 2B). Maximum reduction in LTR reporter activity was observed when highest dose of CycK was used. In perspective of Nef-CycK interaction, we further examined the role of CycK in modulating LTR activity. HEK 293T cells were co-transfected with increasing amount of CycK along with LTR-Luc construct and Tat alone (Fig. 2A). On contrary, over-expression of CycK in the presence of Tat alone was not capable of modulating LTR activity (Fig. 2A) as it did in the presence of Nef (Fig. 2B). This further indicates that modulation of LTR activity by CycK is Nef-dependent.

Cyclin K inhibits LTR-mediated viral gene expression and production in T-Cells.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

To explore our finding further, we chose Jurkat-1G5 cells (T-Cell line), the natural host of HIV-1. This cell line has a copy of "integrated" LTR-Luc in genome (34). Jurkat-1G5 cells were transfected with increasing amount of CycK with or without pNL4.3 and luciferase assay was performed. There was a significant reduction in luciferase activity upon CycK over-expression (Fig. 2C). The protein expression in these cells was analyzed by western blotting and p24 expression was reduced with the increased expression of CycK (data not shown). To elucidate the effect of CycK on viral gene expression and replication, p24-capture ELISA of culture supernatant was also performed. The release of virus from Cyclin K over-expressed cells was notably reduced when compared to pNL4.3 alone transfected cell supernatant (Fig. 2D). Moreover, when Jurkat-1G5 cells were transfected with pNL4.3∆Nef, CycK mediated reduction in virus production was not observed (Fig. 2E). This data suggests that Cyclin K may act as cellular inhibitory factor against HIV-1 by hindering viral gene expression and replication, in Nef-dependent manner.

Endogenous Cyclin K reduces viral gene expression and replication in T-cells

In order to identify the role of endogenous CycK on HIV gene expression, Jurkat-1G5 cells were co-transfected with pNL4-3 and specific siRNA to silence CycK expression as described in Experimental procedures. After 72 hrs of transfection, cells were harvested and culture supernatants were collected for estimation of virus production by p24gag antigen capture ELISA. The harvested cells were used for both RNA and cell lysate preparation. The efficacy of siRNA was then checked by RT-PCR. As compared to control siRNA transfected Jurkat-1G5 cells, transfection of CycK siRNA along with pNL4-3 showed significant silencing of CycK expression. The luciferase activity observed in CycK siRNA transfected cells was significantly increased as compared to the control siRNA transfected cells (Fig. 3A). The viral gene expression was also checked by RT-PCR for p24­gag gene. The expression level of p24­gag gene was higher in CycK siRNA transfected cells as compared to control (Fig. 3A, inset). Furthermore, similar result was obtained when virus production from siRNA transfected cells was determined by p24gag antigen capture ELISA. The amount of virus in the culture supernatant of CycK siRNA transfected cells was significantly increased when compared to control siRNA transfected cells (Fig. 3B). These results clearly indicate that CycK down regulation leads to increase in HIV-1 gene expression and virus production.

To assess the role of Cyclin K in a more physiological scenario, we performed the above experiment in HIV-1 infected T-cells. RNAi experiments were performed in HIV-1 infected CEM-GFP reporter cell line. The CEM-GFP cells were transfected with siRNA and after 24 hours, cells were infected with 0.5MOI of HIV-1NL4.3­. On day 3 post infection cells were harvested to monitor progression of infection by FACS. The cells transfected with CycK siRNA have higher number of infected cells when compared to control siRNA transfected cells (Data not shown). In order to validate the above result, virus present in culture supernatant was quantitated by p24gag antigen capture ELISA. The CycK siRNA transfected cells produced significantly more virus then control siRNA transfected cells (Fig. 3C). Almost similar pattern was obtained by p24 RT-PCR (Fig. 3C, inset) indicating thereby that CycK acts as an inhibitory factor in HIV-1 infected cells.

Cyclin box 1 is required for CycK-mediated reduction of LTR-driven gene expression

Human CycK is a 354 amino acid protein encoded by 1.1 kbp CDS, however, a less abundant form of CycK consisting of 357 amino acids also exist. The overall structure of CycK is similar to other cyclin structures. CycK consists of ten helical domains, which are arranged in two cyclin boxes composed of 5 helices each. The five helices comprising of N and C- terminal cyclin domains are designated as H1-H5 and H1′-H5′. The N-terminal domain (1-151aa) of CycK is responsible for binding to CDK9, however, the two N-terminal helices, HNa and HNb are not essential (35). The region from 152-267 amino acid forms cyclin box 2 and region comprising of 268-354 amino acids is responsible for forming the C-terminus of the protein (Fig. 4A). The mutants were cloned in pCDNA6-His-C (Invitrogen, USA) as described in Experimental procedure.

To investigate the effect of different CycK mutants on LTR-mediated gene expression, HEK-293T cells were transfected with LTR-Luc reporter plasmid along with pNL4-3 and wild type and different CycK mutants, as indicated in Figure 4A. Upon CycK-wt over expression (Bar 3), the luciferase activity was reduced by ~5-fold as compared to that of vector control (Bar 2). Similar pattern was observed when CycK1-267 (Bar 4) and CycK1-151 (Bar 6) mutants were used in the experiment. However, no significant change in luciferase activity was observed when other mutants CycK152-354, CycK152-267 and CycK268-354 were co-transfected (Fig, 4B), indicating that N-terminal end is important for CycK activity where as the C-terminal end is not essential. The amount of virus produced in culture supernatant of mutant transfected cells was estimated and similar pattern was observed, indicating that CycK1-151 important for CycK mediated reduction in virus production (Fig. 4C). The data suggests that cyclin box 1 is responsible for the activity of Cyclin K. The expression level of all mutants was confirmed by western blotting with anti-Xpress antibody (Invitrogen, USA) (Fig. 4D).

Cyclin box 1 is responsible for CycK-Nef interaction

In order to find the region of Cyclin K important for its interaction Nef, co-immunoprecipitation of CycK mutants and Nef transfected HEK-293T cell lysate was performed with anti-Nef antibody. The western blotting of pull-down complex with anti-Xpress antibody clearly indicated that Nef binds to wild type CycK and also to the mutant bearing region 1-151 (Fig. 5B). This data suggests that domain 1-151 is responsible for Nef binding property of CycK (Fig. 5A). It has been reported that Nef has some signature motifs responsible for binding to plethora of various cellular proteins (32). In order to explore the motif of Nef important for binding to CycK, we used a set of Nef point mutants (36). HEK-293T cells were co-transfected with HA-Nef mutant expression vectors along with CycK-wt expression vector. Initially the expression of all the mutants was confirmed by western blotting to check the expression levels (Fig. 5C). The cell lysates were subjected to co-immunoprecipitation with anti-CycK antibody. The pull-down analysis indicated that myristoylation site of Nef is important for CycK binding activity, as no pull down was observed when G­­lycine at 2nd position was replaced with Alanine (Nef-G2A mutant) (Fig. 5D). This data indicate that myristoylated Nef is important for binding to CycK.

Cyclin K expression profile in HIV-1 infected cells.

To find the expression status of CycK in HIV-1 infected cells, quantitative PCR was performed using cDNA prepared from RNA of HIV-1NL4.3­ infected CEM-GFP and Jurkat cells. These cells were infected with 0.1 MOI HIV-1NL4.3­ virus and harvested on day 3, 5, 7 and 9 post infection. The result of QRT-PCR of both T-cell lines suggested that CycK expression is initially increased but as the infection progresses, the levels of CycK go down (Fig. 6A and 6B). This reduction in the levels of CycK in later days may indicate counter acting ability of HIV to overcome restricting property of CycK.

Cyclin K binds to CDK9 more in the presence of Nef

CDK9-CycT1 complex (PTEFb complex) plays a central role in HIV-1 gene expression and replication (14). CycK and CycT1 both bind to CDK9 thorough N-terminal cyclin box, which has 53 identical residues out of 80 (35). Based on this fact we moved ahead to elucidate the mechanism of CycK-mediated reduction in viral gene expression. We examined the physical association of CDK9 and CycT1 in presence of CycK. To test whether presence of CycK alters this association, we performed co-immunoprecipitation experiment by transfecting pNL4-3 with different amounts of CycK expressing vector. The Co-IP experiment revealed that in the presence of increasing levels of CycK in pNL4.3 transfected cells, CycT1 association with CDK9 was diminished (Fig. 8A). This suggested that the increase in CycK levels in the cell reduces CDK9-CycT1 complex, which is an active protein complex required for HIV gene expression.

To further demonstrate the role of CycK in context to Nef interaction, we tested whether presence of Nef is essential for CycK activity on LTR promoter. We performed co-immunoprecipitation and western analysis to examine whether presence of Nef and CycK alter the physical association of CDK9 and CycT1. We found significant reduction in CycT1 association with CDK9 in the cells transfected with pNL4.3 and CycK. The amount of CycT1 in CDK9 pull-down in pNL4.3∆Nef transfected cells was unchanged (Fig. 8B). Thus, Co-IP experiments indicated that CycK likely associates with CDK9 in presence of Nef thereby preventing CDK9 to associate with CycT1.

Cyclin K inhibit CDK9 nuclear translocation in the presence of Nef.

Previous study indicated that CDK9 can shuttle between nucleus and cytoplasm and enhanced expression of CycT1 increases CDK9 nuclear translocation (37). The localization of CycK is not studied in detail. It is suggested that some CycK may localize in nuclear speckles but majority of it is present in cytoplasm.

Keeping the above mentioned fact into consideration, we hypothesized whether inhibition of CDK9-CycT1 complex formation by CycK is responsible for restricting CDK9 from translocating in to the nucleus as a part of active PTEFb complex, hence causing reduction in viral gene expression. So we wanted to analyze whether ectopic expression of CycK inhibits CDK9 nuclear translocation. To test this, we performed western analysis of nuclear and cytoplasmic extract of HEK-293T cells transiently transfected with Nef and different amounts of CycK. It was clearly evident that presence of Nef and CycK affects CDK9 translocation to the nucleus as depicted by immunoblotting. This experiment also suggested that with the increase in CycK expression there was substantial decrease in CDK9 levels in the nucleus (Fig. 9A). To further substantiate this finding, we transfected HEK-293T cells with Nef-GFP or GFP and CycK to perform immunoflouroscence study. In Nef-GFP transfected cells, CDK9 was evidently co-localized in cytoplasm with CycK and Nef-GFP (Fig. 9B). Here GFP alone was used as a control and in these cells CDK9 was visible in nucleus. Thus CycK-Nef may act as an inhibitory complex, which may restrict viral replication by restricting CDK9 in the cytoplasm. To further prove above-mentioned hypothesis, we directly examined the localization of CDK9 in pNL4.3 and pNL4.3∆Nef transfected cells in the presence of CycK. In three independent experiments cells were counted and percentage of cells with CDK9 localized in cytoplasm and nucleus was calculated. The results suggest that pNL4.3∆Nef transfected cells have more nuclear-localized CDK9 as compared to pNL4.3 transfected cells (Fig. 10A and B). Taking together, all these results clearly indicate that CycK inhibits nuclear translocation of CDK9 in the presence of Nef.

For further confirmation in physiological scenario, we investigated localization of CDK9 in HIV-1 infected cells. We made nuclear and cytoplasmic extracts of CycK siRNA-transfected infected CEM-GFP cells and performed immunoblotting. The infected CEM-GFP cells which were transfected with CycK specific siRNA have more CDK9 in nucleus than in cytoplasm (Fig. 11A); this result can be correlated with our findings in previous experiments (Fig. 10). In the next step, we performed immunoflouroscence study in HIV-1 infected Jurkat cells. In infected Jurkat cells CDK9 was evidently co-localized with CycK in cytoplasm, while CDK9 was localized in nucleus and CycK in cytoplasm of uninfected cells (Fig. 11B). These data suggests that CycK in the presence of Nef may restrict viral replication and gene expression by binding to CDK9 and inhibiting its translocation in nucleus. The inhibition of nuclear translocation of CDK9 may prevent formation of active PTEFb complex required for HIV-1 gene expression.

Discussion

In the present study, we demonstrate for the first time that Nef interacts with Cyclin K, which has been identified by yeast two-hybrid screening and further validated by GST-pull down assay, immunoprecipitation and co-localization studies. The interaction is not subtype specific as both subtypes B and C Nef bind to CycK. Our data corroborates with previous studies (38) suggesting that despite considerable sequence differences in the Nef across various subtypes, functional properties remain relatively well conserved. The kinase partner of CycK is CDK9 (25), which is a key factor responsible for HIV gene expression (13), hence it was obvious to speculate the role of CycK in transcription. Surprisingly, our results clearly show that CycK reduces LTR-driven gene expression in dose-dependent manner. Moreover, CycK was able to reduce LTR activity in the presence of Nef, which suggests an apparent role of Nef-CycK interaction. Furthermore, CycK ectopic expression in Jurkat 1G5 cells (T-cell line) was able to reduce LTR-mediated gene expression and produced less vorus. Additionally, when endogenous CycK was knockdown using specific siRNA, the viral gene expression was enhanced and virus particle released was also augmented in Jurkat 1G5 cells. Hence, our finding evidently indicates that CycK might possess HIV restricting property and it's not a cell-type dependent phenomenon.

Endogenous CycK also substantially reduce progression of infection and virus production, as this was evident in RNAi experiment done using HIVNL4-3 infected CEMGFP cells. In an independent research, Urano et.al (2008) demonstrated that CycK over-expression leads to reduction in HIV-1 production from T-cell lines (23), however the mechanism behind this was unexplored. Our co-immunoprecipitation experiment along with immunoflouroscence studies confirmed that CycK not only reduces binding of CycT1 to CDK9 but also restricts CDK9 translocation into nucleus in Nef-dependent manner. Moreover, immunoflouroscence study with wild-type and nef-deleted HIV molecular clone demonstrate that Nef is essential for CycK-mediated restriction of CDK9 nuclear translocation. Furthermore, immunoblotting analyses of nuclear and cytoplasmic extracts from CycK specific siRNA treated HIV-1-infected CEM-GFP cells show increased translocation of CDK9 into the nucleus of CycK knockout infected cells. Finally, we show that CycK co-localize with CDK9 in cytoplasm of HIV-1 infected Jurkat cells.

However, CDK9-CycK complex is known to possess CTD phosphorylating activity in vitro (25), but the role of CDK9-CycK as PTEFb complex in HIV-1 transcription is not established. CycK and CycT1 have 80 similar residues in the domain (cyclin homology box), which is responsible for binding to CDK9 (35), hence possibility of competition cannot be ruled out. The Tat interaction region, also known as Tat Responsive Motif (TRM), is located outside the cyclin homology box of CycT1, is not present in CycK (39;40). Hence, the probable role of CDK9-CycK complex in activating HIV transcription may not be feasible. CDK9 translocate into the nucleus under the influence of CycT1 levels in cell (37). However, if CDK9 is restricted in cytoplasm the amount active PTEFb complex in nucleus will be reduced, leading to inhibition of Tat-dependent LTR activation. Work in context with Nef-CycK interaction has shown convincingly that Nef-CycK complex binds to CDK9 more that is obligate partner CycT1. Hence, it may be hypothesis that binding to Nef is responsible for high affinity of CycK towards CDK9.

The present study provides insight into molecular mechanism of CycK-mediated reduction in LTR-driven viral gene expression and replication. In summary, we infer that Nef interacts with CycK and the resulting complex leads to reduction in LTR-mediated gene expression. Our data clearly indicate that CycK function is not cell specific and endogenous CycK is also capable of reducing viral gene expression. Finally, Nef-CycK is responsible for inhibiting nuclear translocation of CDK9, leading to reduction in formation of active PTEFb complex and consequently reduced viral gene expression. In the end, finding of CycK as a novel Nef interacting host factor and its consequences provides evidence for involvement of pathogen protein by host in combating the pathogen.

Experimental Procedures

Plasmids, Cell Lines, and Antibodies-The nef gene from HIV-1 subtype C Indian isolate IN301904 (33) was cloned into pGEMTEasy vector (Promega) and pcDNA3.1 (Invitrogen), as described previously [20]. The sequence of cloned nef was confirmed by DNA sequencing (ABI 310 Genetic Analyzer, ABI). Expression of Nef from both vectors was confirmed by immunoblotting. The pAS2-1NefC plasmid expresses subtype-C Nef and Gal4DNAbinding domain as a fusion protein, which was used as the bait protein in yeast two-hybrid library screening. A cDNA library of human leukocytes in the pACT2 vector was obtained from Clontech. The NL4-3 molecular clone (pNL4-3) was obtained from the National Institutes of Health AIDS Reagent Program, USA (41). The nef-deleted NL4-3 molecular clone (pNL4-3∆Nef) and glutathione S-transferase (GST)-Nef (B) plasmids were obtained from Dr. John C. Gautelli (42) and Dr. K. Saksela respectively. The subtype C Nef expressing glutathione S-transferase (GST)-Nef plasmid was constructed by cloning nef gene into BamHI and EcoRI sites of pGEX-5X.1 (Amersham, GE). The sequence of cloned nef was confirmed by sequencing as above and also by western blotting with Nef and GST specific antibody. Cyclin K (CCNK) gene was cloned in-frame into BamHI and EcoRI sites of pcDNA-6 His C (Invitrogen). The cloning of pC-CycK was confirmed by restriction digestion and by DNA sequencing ABI 310 Genetic Analyzer, ABI). The expression was confirmed by western blotting using anti-Xpress epitope and CycK antibody. HEK293T cells (human embryonic kidney cell line) and Jurkat (CD4+ human T cell line) were obtained from the NCCS Cell Repository, India. CEM-GFP, a CD4+ human T cell line, was obtained from the National Institutes of Health AIDS repository (33). Jurkat-1G5 cells (CD4+ human T cell line) having a copy of integrated LTR-Luc in genome (34), were obtained from National Institutes of Health AIDS Reagent Program, USA (30). Antibodies specific for Cyclin K, Cyclin T1, CDK9, GAPDH and HA were obtained from Santa Cruz Biotechnology. Anti-Nef monoclonal antibody was obtained from Fitzgerald, USA, anti-Nef polyclonal sera was obtained from Dr. Shahid Jameel, ICGEB (New Delhi) and anti-p24gag polyclonal sera was obtained from National Institutes of Health AIDS repository.

Yeast Two-hybrid Assay-A human leukocyte cDNA library in pACT2 vector (Clontech) was screened for Nef interacting proteins by co-transformation with the pAS2-1Nef-C bait plasmid into yeast strain AH109 (Clontech), as described previously (17). Positive clones were selected based on growth in medium lacking adenine, histidine, tryptophan, and leucine and also by expression of β -galactosidase. Co-transformants in AH109 yeast strain were screened multiple times for growth on these selection plates and also for β-galactosidase activity to eliminate false positive clones. Liquid β-galactosidase assay was finally performed to confirm the interaction, using the yeast β-galactosidase assay kit from Pierce (USA), as per the manufacturer's protocol. The interacting protein in the positive clone was identified by rescuing the gene cloned, using PCR amplification with pACT2- specific primers followed by DNA sequencing.

HIV-1 Infection and Virus Quantitation- 2x106 CEM-GFP cells were infected with HIV-1 NL4-3 virus at a multiplicity of infection of 0.1 in the presence of Polybrene (1µg/ml) as described earlier (43). After 24 h post-infection, cells were transfected with 200nM siRNA and then 48 h later cells were harvested for RNA preparation (Trizol method). The culture supernatants from infected and molecular clone-transfected cells were used to determine HIV-1 production by p24gag antigen capture ELISA (PerkinElmer Life Sciences).

Transient Transfection and Luciferase Assay-HEK-293T cells were transfected with HIV-1 LTR-reporter vector (pLTR-Luc) along with other expression vectors using calcium phosphate precipitation and harvested 36 h post-transfection for luciferase assay. Jurkat-1G5 cells were transfected with pNL4-3 and pC-CycK using Lipofectamine 2000 (Invitrogen) according to manufacturer's protocol and cells were harvested 48 h post-transfection for luciferase assay. The cells were then lysed in cell lysis reagent (Promega, USA), and luciferase assays were performed using Luclite substrate (PerkinElmer Life Sciences, USA). Normalization of transfection efficiency was done using the enhanced green fluorescent protein reporter (pEGFP-N1) co-transfection and quantitation as described earlier (44). For RNAi experiments, Jurkat-1G5 cells were transfected with 100nM siRNAs along with expression vectors using Lipofectamine 2000 (Invitrogen) according to manufacturer's protocol. The culture supernatants were also collected at the time of luciferase assay from pNL4-3 transfected cells to determine virus production.

GST-Pulldown , Immunoprecipitation and immunoblotting- Escherichia coli BL21(DE3) cells expressing either GST or GST-Nef were induced with isopropyl β-D-thiogalactoside followed by recombinant protein purification using glutathione-Sepharose beads (Amersham Biosciences, USA). Jurkat cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 5 mM EDTA, 0.12 M NaCl, 0.5% Nonidet P-40, 0.5 mM NaF, 1 mM dithiothreitol,0.5 mM phenylmethylsulfonyl fluoride) with a Protease inhibitor cocktail (Roche Applied Bioscience) on ice for 45 min. The clarified lysates were incubated with either GST or GST-Nef protein immoblized on glutathione-Sepharose beads at 4 °C and subjected to five washes with lysis buffer. The complexes were resuspended in Laemmli's sample buffer, boiled, and resolved on 12% SDS-PAGE. Proteins were transferred onto polyvinylidene difluoride membrane and the membrane was probed with anti-CycK antibody.

Infected and uninfected CEM-GFP cells and co-transfected HEK 293T cells were lysed in lysis buffer, as mentioned above. The clarified lysate was incubated with polyclonal antibody and the antigen-antibody complex was pull down by equal mixture of protein-A and -G beads followed by resolution on 12% SDS-PAGE. The proteins were transferred onto polyvinylidene difluoride membrane and then it was probed specific antibodies mentioned above. The blots were developed by using the ECL Plus system (Amersham Biosciences). Furthermore, equal amounts of protein were taken from cell lysates and were run on SDS-PAGE, followed by immunoblotting for CycK and other proteins.

Immunofluorescence Microscopy-HEK-293T cells grown on coverslips were co-transfected with expression vectors using Lipofectamine (Invitrogen). Cells were harvested 24 h post-transfection and stained with CycK antibody and Nef antibody after fixing with 2% paraformaldehyde (PFA). The secondary antibodies used were Cy3-conjugated, Cy5-conjugated and fluorescein isothiocyanate-conjugated to specific antibodies (Chemicon). For infected Jurkat cells, cells were fixed with 3.7% PFA and then further processing was done after adhering the cells onto glass slide by using cytospin. After washing, cells were mounted in mounting media (containing antifade, SantaCruz USA) on the slide, and the samples were analyzed with a confocal microscope (Zeiss LSM 510, Germany).

Reverse Transcription-PCR-RNA was prepared from HIV-1 NL4-3-infected and uninfected CEMGFP cells or from Jurkat 1G5 cells using TRIzol Reagent (Invitrogen). The cDNA was made using Moloney murine leukemia virus Reverse Transcriptase (Invitrogen) followed by amplification by PCR for CYCK, β-ACTIN and HIV-p24 gene with Taq polymerase (Bangalore Genei) using standard conditions and gene-specific oligonucleotide primers, The primers used for CYCK: forward primer 5' TGCAAAAGCAACTCAAAGGTG 3'; reverse primer 5' AACAAACTGCTCCCACCCTC 3'; β-ACTIN: forward primer 5' ATCTACCCGTGTCACACCCACTGGGGCAGT 3'; reverse primer 5' GGGAGGTAGCAGGTGGCGTTTACGAAGATC3' and HIV-p24: forward primer 5' ATAATCCACCTATC CCAGTAGGAGAAAT 3'; reverse primer 5' TTTGGTCCTTGTCTTATGTCCAGAATGC 3'.

Quantification of CYCK Expression by Real-time PCR- CYCK expression level was analyzed by quantitative real-time PCR of cDNA in a 10 µl reaction mixture containing SYBR Green IQ supermix (Bio-Rad) and 10 pmol concentration of each of the human GAPDH and CYCK primer pairs, using the Realplex4 real-time thermal cycler (Eppendorf). The amplification was performed using one cycle of 95 °C for 3 min and 40 cycles of 95 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 30 sec followed by melt curve analysis. The changes in the threshold cycle (CT) values were calculated by the equation ∆CT=CT,target -CT,input. The fold difference was calculated as follows: -fold difference = 2-∆ (∆CT)

Preparation of Nuclear and Cytoplasmic Extracts- 5x106 infected CEM-GFP and HEK 293T cells were harvested and washed with ice cold phosphate-buffered saline (PBS). Nuclear and cytoplasmic extracts was prepared using ProteoJET (Fermentas) according to manufacturer's protocol. Equal amounts of nuclear and cytoplasmic extracts were used for immunoblotting.

Figure Legends

Figure 1

HIV-1 subtype C Nef physically interacts with Cyclin K protein. A, Nef interacts with Cyclin K in the yeast two-hybrid assay. A human leukocyte cDNA library was screened using subtype C Nef as bait in the yeast two-hybrid system. One of the clones co-expressing Cyclin K and Nef was found positive after repeated screening. B, Liquid β-galactosidase activity assay was performed using lysates from yeast co-transformants as described under "Experimental Procedures". C, GST-Nef (subtype C) pull down from Jurkat lysate. GST and GST-Nef (sub-C) were incubated cell lysate followed by SDS-PAGE and immunoblotting with CycK antibody. D, Co-localization of Cyclin K and subtype C Nef in co-transfected HEK-293T cells. HEK-293T cells were grown on coverslips and transfected with pcDNA-NefC and pcDNA6-CycK (pC-CycK). After 24 h, transfected cells were stained with Nef antibody and Cyclin K antibody as described in the text. The indirect immunofluorescence was visualized by confocal microscopy. E, GST-Nef (subtype B) pull down from Jurkat lysate. GST and GST-Nef (sub-B) were incubated cell lysate followed by SDS-PAGE and immunoblotting with CycK antibody. F, Co-localization of Cyclin K and subtype B Nef in co-transfected HEK-293T cells. HEK-293T cells were grown on coverslips and transfected with pNL4-3 and pcDNA6-CycK (pC-CycK). The indirect immunofluorescence staining was performed as above; D. G and H, Nef and CycK interact in HIV-1-infected CEM-GFP cell. CEM-GFP cells were infected with HIV-1NL4-3 virus as described in text. The cells were lysed on day 5 post-infection. The lysates of uninfected [U] and infected [I] CEM-GFP cells were co-immunoprecipitated with either Nef antibody (G) or CycK antibody (H) and followed by immunoblotting with CycK antibody or Nef antibody, respectively.

Figure 2

Cyclin K-mediated reduction in LTR activity in HEK-293T and Jurkat cells is Nef dependent. A, HEK-293T cells were transfected with HIV-1 LTR-Luc reporter vector along with expression vector as indicated in the figure. pC-CycK was transfected in increasing amount (0.3 µg-1.2 µg) along with pcDNA-Tat (0.25 µg) (Bars 3-5) and without pC-CycK (Bar 2). Total amount of DNA transfected was equal in all lanes. B, HEK-293T cells were transfected with HIV-1 LTR-Luc reporter vector along with expression vector as indicated in the figure. pC-CycK was transfected in increasing amount (0.3 µg-1.2 µg) along with pcDNA-Nef (0.5 µg) (Bars 4-6) and pcDNA-Nef along with pcDNA-Tat (0.25 µg) alone (Bar 3). 24 hours post-transfection, cells were lysed in Promega cell lysis reagent and luciferase assay was performed. C, Jurkat-1G5 cells were transfected with pNL4-3 (1 µg) and with (Bars 3 and 4) or without (Bar 2) increasing amount of pC-CycK (0.25 µg-0.5 µg). 36 hours post-transfection, culture supernatant was collected and cells were lysed in Promega cell lysis reagent followed by luciferase assay. D, the amount of virus present in culture supernatant of C was estimated by p24gag antigen capture ELISA (PerkinElmer Life Sciences). E, Jurkat-1G5 cells were transfected with pNL4-3∆Nef (1 µg) and with (Bars 2 and 3) or without (Bar 1) increasing amount of pC-CycK (0.25 µg-0.5 µg). 36 hours post-transfection, culture supernatant was collected and the amount of virus present in culture supernatant was estimated as above. The asterisk indicates significant change. Error bars show means ± SD from three independent experiments. The p value in the graph was calculated on the basis of the mean values of the indicated bars. (* = p <0.05 and **=p < 0.01).

Figure 3

Endogenous Cyclin K reduces LTR-mediated gene expression and HIV-1 production T-cell line. A, Jurkat-1G5 cells were transfected with 100 nM of Control siRNA (Bar 1) or CycK specific siRNA (Bar 2) and 24 hours post transfection cells were transfected with pNL4.3 vector (1 µg). After 48 hours post-transfection, supernatant was collected and cells were harvested to lyse in cell lysis reagent (Promega) to perform Luciferase assay. B, The virus released in culture supernatant was of cells transfected in A was estimated by p24 capture ELISA (Perkin Elmer). C, CEM-GFP cells were transfected with 200 nM of Control siRNA (Bar 1) and CycK specific siRNA (Bar 2). 24 hours post transfection, cells were infected with HIVNL4-3 at 0.5 MOI and on day 3 cells were harvested and culture supernatant was collected for p24gag antigen capture ELISA (PerkinElmer Life Sciences). The insets in A and C show the efficacy of siRNA mediated silencing by semi-quantitative PCR. The asterisk indicates significant change. The p value is based on three experiments. Error bars show means ± SD from three independent experiments. The p value in the graph was calculated on the basis of the mean values of the indicated bars. (p < 0.01).

Figure 4

Cyclin box 1 (1-151 aa) is important for CycK-mediated reduction in LTR-driven gene expression and HIV-1 production. A, Schematic representation of Cyclin K mutants generated and used in this study. B, HEK-293T cells were transfected with LTR-Luc reporter vector and pNL4-3 along with various CycK mutant expression vectors, as indicated in figure. 24 hours post transfection, culture supernatant was collected and cells were harvested followed by cell lysis in Promega cell lysis reagent for luciferase. C, the amount of virus present in culture supernatant of B was estimated by p24gag antigen capture ELISA (PerkinElmer Life Sciences). D, cell lysates were examined for expression of various CycK mutants and GAPDH by western blot analysis.

Figure 5

Domains or motif responsible for CycK-Nef interaction. A, Schematic representation CycK mutants and their interaction with Nef. B, HEK-293T cells were transfected with HA-Nef expression vector along with various CycK mutant expression vectors. 24 hours post-transfection, co-immunoprecipitation was performed with Nef antibody and pull-down was analyzed by western blotting with Xpress tag antibody. C, HEK-293T cells were transfected with various Nef mutant expression vectors as shown in figure and cell lysates were examined for expression by western blotting with Nef antibody. D, co-immunoprecipitation of above cell lysates was performed using CycK antibody followed by western blot analysis with Nef antibody.

Figure 6

Expression Profile of Cyclin K in HIV­NL4.3 infected T-cell lines. RNA was isolated from infected CEM-GFP and Jurkat cells were harvested on Day 3, 5, 7 and 9 followed by qRT-PCR for Cyclin K using gene-specific primers as described in "Experimental Procedures"

Figure 7

Endogenous Cyclin K modulates LTR-mediated gene expression and HIV-1 production in infected T-cell line. A, Jurkat-1G5 cells were transfected with 100nM of Cyclin K siRNA and control siRNA as mentioned in text. After 24hrs cells were transfected with pNL4.3. After 48 hrs of transfection cells were harvested and lysed to perform luciferase assay, as mentioned in text. Cellular mRNA was also prepared to check the expression Cyclin K and p24 (inset). B, The virus production was determined in culture supernatant of Jurkat-1G5 cells (A) by p24 capture ELISA (Perkin Elmer). The asterisk indicates significant change. The p value is based on three experiments. Error bars show means ± SD from three independent experiments. The p value in the graph was calculated on the basis of the mean values of the indicated bars. (p < 0.005). C, siCtrl (control siRNA) and siCycK (Cyclin K specific siRNA) transfected-infected CEMGFP cells were fixed and acquired to analyze GFP expression as mentioned in text. C, Cellular mRNA was prepared and cDNA was prepared (as mentioned in text) from all the three experiment to check the efficacy of siRNA. p24 and cycK gene were amplified and actin was used loading control (inset). D, The virus production from infected cells in C was estimated by p24 capture ELISA (Perkin Elmer).The asterisk indicates significant change. The p value is based on three experiments. Error bars show means ± SD from three independent experiments. The p value in the graph was calculated on the basis of the mean values of the indicated bars. (p < 0.05).

Figure 8

Cyclin K replaces Cyclin T1 from PTEFb complex in the presence of Nef. A, HEK 293T cells were transfect pNL4.3 and CycK expression vector as shown in the figure. 200 µg lysate was immunoprecipitated with anti-CDK9 antibody as mentioned in text, followed by immunoblotting. B, HEK 293T cells were transfected with pNL4-3 and nef-deleted HIV-1NL4.3 molecular clone (pNL4-3∆Nef) with or without pcDNA6-CycK. 150 µg of cell lysate was immunoprecipitated with anit-CDK9 antibody followed by immunoblotting with anti-CycT1. Total amount of DNA used for transfection was equal.

Figure 9

Cyclin K restricts CDK9 nuclear translocation in the presence of Nef. A, HEK 293T cells were co-transfected with different amount of pcDNA6-CycK and with or without pCl-HA-Nef. Nuclear and cytoplasmic extract of transfected cells was made as described under "Experimental Procedures". Equal amount of extracts were used for immunobloting with anti-CDK9 and anti-CycT1. The same blot was probed with anti-HA and GAPDH was used as loading control. B, HEK 293T cells were grown on coverslip and co-transfected with pcDNA6-CycK and Nef-GFP or only GFP expressing vector. After 24 hrs cells were stained for CycK and CDK9 as described in text. Cells were then mounted onto glass slide to be visualized by confocal microscope.

Figure 10

Nef is essential for Cyclin K-mediated restriction of CDK9 nuclear translocation activity. A, HEK 293T grown on cover slip were transfected with pNL4-3 or pNL4-3∆Nef along with pcDNA6-CycK. Immunoflouroscence staining was performed with anti-CDK9 and anti-CycK antibody. Cells stained for CDK9 were counted and separated on the basis of its localization. Black and grey bar indicate CDK9-stained cells transfected with pcDNA-CycK with pNL4-3 or pNL4-3∆Nef, respectively. B, Right and Left panels are representative of immunoflouroscence images of cells transfected with wild-type and nef-deleted molecular clones along with pcDNA-CycK respectively.

Figure 11

Endogenous Cyclin K also posses CDK9-restricting ability in HIV infected T-cells. A, CEMGP cells were transfected and infected with HIV-1 as mentioned in "Experimental Procedure". Nuclear and Cytoplasmic fractions were separated as described in text. Equal amounts of extracts were used for immunoblotting with anti-CDK9, anti-CycT1, anti-CycK and anti-Nef. GAPDH and Lamin A/C was used for loading control. B, Jurkat cells infected with HIV-1 at 0.5 MOI as mentioned in text. Day 3 infected and uninfected cells were processed for indirect immunoflouroscence staining for CDK9 and CycK, as decribed in "Experimental Procedure". The cells were visualized under confocal microscope.