Experiment to Study Genes

3127 words (13 pages) Essay

18th May 2020 Biology Reference this

Disclaimer: This work has been submitted by a university student. This is not an example of the work produced by our Essay Writing Service. You can view samples of our professional work here.

Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of UKEssays.com.

RNAi Laboratory Series


Introduction


 

The purpose of this experiment was to obtain a clear concept of how genes work and how genes are studied. Two Drosophila genes were silenced using several techniques and the phenotype were observed. So the process of DNA replication, transcription, and RNAi was used to “knock out” the gene expression of the two genes.

Get Help With Your Essay

If you need assistance with writing your essay, our professional essay writing service is here to help!

Find out more

This experiment consisted of multiple objectives that we classify into couple steps. For the first objectives of the computational biology we were to learn how genes are studied to know their functions in cells, next a computational biology was used to determine the structure and how two of the genes in Drosophila worked, then we were to learn about DNA replication, transcription, and  RNAi into a cell. For the second objectives of the DNA replication we were to isolate genomic DNA from an organism to use it in an analysis to find out how genes work, then we modeled replication in vitro using PCR to amplify the DNA sequence, and we also predicted the results of PCR reaction from the template DNAs based on the early computational result. For the third objectives of agarose gel electrophoresis and DNA purification, we were to learn about its process, then isolate the genomic DNA form the organism, and to model replication in vitro using PCR. In the RNA interference part the objectives were to learn about RNAi’ s process in cells, to complete an agarose gel transcription, and end it up by purifying DNA from the in vitro transcription obtained.

DNA replication is semiconservative process where the parental strand is used as a template for synthesis of a daughter strand. The main enzyme is DNA polymerase, which catalyzes the joining of deoxyribonucleoside 5′-triphosphates ( dNTPs) to grow the DNA chain. In order to have replication, it is also necessary to have proteins and specific DNA sequences to initiate it and to replicate the chromosomes. DNA replication in vitro ( PCR) is very different from the normal way of replicating the cells. In PCR, a large number of copies of DNA is made under a constant temperature where DNA replication happens in the body. DNA replication consists of three steps which are initiation, elongation, and termination , where PCR has denaturation, primer annealing, and strand extension. Only PCR needs artificial primers to undergo replication.

Transcription is one of the steps of gene expression, where DNA is copied into RNA by the enzyme RNA polymerase. Transcription involves different steps where  RNA polymerase binds to a promoter DNA, form a transcription bubble, which separate the DNA helix by breaking the hydrogen bonds. RNA polymerase adds more nucleotides and the RNA sugar phosphate backbone forms an RNA strand. Hydrogen bonds of both nucleic acids break and form the new RNA strand. Compared to in vitro, transcription replicate the phenomenon of RNA and proteins synthesis in an outer cellular environment.

RNA interference (RNAi) or  a post transcriptional gene silencing (PTGS) is a biological way of saving the double stranded RNA to resist parasites and pathogens of the nucleic acids. It also regulates the expression of protein coding genes. So when it comes to its pathway, the first step is that the RNA is reduced shorter by a dicer, then in the next step interfering RNA siRNA are loaded into RISC which is known as RNA induced silencing complex and gene silencing is a result of a degradation of RNA by a slicer. And based on the article “ Revealing the world of RNAi” we know that at the heart of RNA interference lies a remarkable RNA processing mechanism that is now known to underlie many distinct biological phenomena ( Mello, 2004)


 

Hypothesize

   

I hypothesize that after collecting all our data and results at the end of this experiment the two Gene’s will be turned off. I also hypothesis that there will be a great amount of thread and Drp1 that will be created from our agarose gel electrophoresis and that there will be a distinction between Drosophila cells that had Mito GFP and cells that had it with Drp1 dsRNA.


Methods


Computational Analysis

A website was used to find where exactly the primers were located on the chromosomes. The sequences used in this part of the lab were for:

Primer 1was 5’ AGACGTGTCGTCCTTCAGCCGC 3’,

Primer 2 was 5’ATATACGCGCATCACATCGGTG 3’,

Primer 3 was 5’GATCGAGAGCGTTGTGGGACGAT 3’,

Primer 4 was 5’GGAGTTCGTTCTCTTTGAACGCG 3’.

Isolating DNA from cells

0.5 ml of Drosophila cells was transferred to a micro centrifuge tube. Then the tube was spun in the centrifuge for 1 minutes at 1000 X G. Next the liquid was removed and transferred to a biohazard waste container leaving the cell pellet in the tube.

50 microliters of squishing buffer was added, incubated at 50 degree Celsius for 30 minutes and incubated again at 95 degree Celsius for 10 minutes. And for 1 minute it was spinned and placed on ice.

PCR

For this part of the lab, we only added liquid such as H2O, 10XPCR buffer, 50mM MgCl2, and 10 mM dNTPs into 6 different tubes with respective constant number as 75.5 ul, 10 ul, 6 ul, and 2 ul in all 6 tubes.

Then 2ul of  primers 1 and 2 were added into tube 1, 2, and 3. Next we added the same amount for primers 3 and 4 into tubes 4, 5, and 6. After having that mixed, 2 ul of Fly DNA was added into tube 1 and 4, and 2 ul of Thread cDNA and DRP1 cDNA were respectively added to tube 2 and 5. And 0.5 ul of taq polymerase was added by the instructor in all the tubes.

So the cycle to have PCR running was at different temperatures 95, 45, and 72 degrees Celsius, during these temperatures, we respectively let initial denaturation occur for 3min and five times let DNA denaturation step for 30 seconds , then at 45 degree we had the primer binding for 30 sec  and DNA polymerase extension take place for 2min at 72 degrees.

Preparing the agarose gel

An amount of agarose powder was weighed to make 50 ml of 1% agarose gel in 1X TAE buffer, then was added to a 250 ml flask and 50 ml of 1X TAE buffer was added. For 30 seconds intervals, it was boiled in the microwave carefully until all the agarose beads turned into a clear solution. Right after that step, our solution was put in the fridge to cool it down to 50 degrees and we used side with the 10 wells

Preparing the samples

First, 6 tubes were labeled and each PCR sample were prepared by mixing 10 ul of a PCR reaction and 2 ul of loading dye in the designated tube.

The concentration and purity of DNA in our solution

The absorbance of the DNA we purified at 260 nm by using a Nanodrop spectrophotometer and the concentra of our solution was found using our p10 pipetman. Then our DNA and our solution were brought to blank the spectrophotometer (buffer EB) with some DNase/RNase free water. The sample slot of the spectrophotometer was cleaned by pipetting 5 ul of water onto the dot located in the center of the pedestal. We closed and reopened to wipe the water off with a kimwipe. 1 ul of my solution was added to the dot on the pedestal of the spectrophotometer, the arm was closed, and we selected blank. After we got it to blank, we selected measure. Before doing the same process with our 1 ul of DNA solution, everything was wiped off. So we determined the 260/280 nm ratio from the calculated concentration of DNA solution which was automatically provided by the software. We also used the average DNA concentration to determine the amount of DNA would be in 8 ul of our purified sample.

In vitro transcription reaction

So we set up in vitro transcription reactions at room temperature to make RNA from our DNA template. We made one reaction of Thread DNA and one reaction for Drp1 DNA, by adding respectively 8 ul of DNA template, 2 ul of 10X T7 reaction buffer, 2 ul of ATP solution, 2 ul of CTP solution, 2 ul of GTP solution, 2 ul of UTP solution, and 2 ul T7 RNA polymerase enzyme mix. The whole was mix and put in a centrifuge for 10 seconds and was incubated at 37 degrees for 4 hours.
 

DNase and RNase treatment of sample

Before the lab session started, the instructor heated and cooled our transcription reactions to 70 degrees Celsius and room temperature. So 21 ul nuclease free water, 5 ul 10X digestion buffer, 2 ul DNase I, and 2 ul RNase were added to each transcription reaction we had. The solution was mixed and incubated at 37 degrees Celsius water bath for 30 minutes, then was placed on ice and proceeded with the electrophoresis.
 

Electrophoresis of double stranded RNA

In both samples, 2 ul of our transcription reaction was added to a tube containing 6 up of nuclease free water and 2 up of DNA loading dye. Our group sample was added with the other group onto 1% agarose gel provided by our instructor and was electrophoresed on the gel using 100 volts for 30 minutes in 1X TAE buffer.
 

Purification of the double stranded RNA

We added 50 ul 10X binding buffer, 150 ul nuclease free water, and 250 ul ethanol to the DNase/RNase. After, the entire 500 ul mix was added in a clean tube where the column was and we spinned it for 2 minutes. The flow through was removed and the column was put back in the collection tube with 500 ul of wash buffer. The column was spinned a second time for 2 minutes. This process was repeated one more time from where we have to remove the flow through to the waste container. Then we added 100 ul  of elution solution to our column and was incubated at 65° C for 2 minutes and spun in the centrifuge at maximum speed for 2 minutes as well.

Transfection of Mito-GEP with drp- 1dsRNA

 in the section of the lab,  a,b, and c labeled tubes were used. In tube a and b 1 ul of Mito-GET along with respectively 249ul and 224 ul of serum free media and b tube had 25 ul of drp-1dsRNA added. Then tube c received 240 ul serum free media and 10 ul of cellfectin liposome solution; right after that mixture was made it was added in both a and b tubes. Next they were incubated for 30 min.

Results

Genomic location1 and 2

 

Figure1: Shows the genomic locations of primers 1 and 2. So these two primers are responsible for apoptosis in Drosophila. ON the graph it is observed that both of them are located on the exact exons

Genomic location 3 and 4

Figure 2: Shows the genomic locations of 3 and 4. So these two primers are responsible for mitochondrial fission in Drosophila.

Thread Drp1 Gel Electrophoresis

Figure 3: This figure shows drp1 at a band of 2700 bps and Thread at 694 bps . The ML stands for marker lane or allele ladder which varies from 12000bps to 100bps. Lane 6 next to the allele ladder showed a band at 100bps. Lane 5 showed a band at 2700bps. Lane 4 showed no band. Lane 3 showed no band. Lane 2 showed a band at 694bps. And lane 1 showed no band.

dsRNA Gel Electrophoresis

Figure 4: For this figure, there were 4 different groups where each group had 2 lanes. From left to right the lanes are numbered 1 to 9 after the first lane which is considered the ML. In lanes 1, 3, 4, 6, and 8 the bands are at 694 bps and in lane 5 there is a band at 2700 bps.

Mito-GFP transfected cells photographs

Presence of Drp1 dsRNA                  Lack of Drp1 dsRNA

Figure 5: The figure with lack of Drp1 dsRNA represents the cells containing our control drp1. The other figure with presence of dsRNA represents the cells containing drp1 dsRNA. It was observed that there was no differences besides the size of the mitochondria cells.

Cells incubated with Thread or control dsRNA under light microscopy

Control dsRNA                                  Thread dsRNA

Figure 6: This particular figure show the control and thread dsRNA under the light microscopy. They both look the same, we did not observe any dying cell.

 

Discussion

The goal of this experiment was to make two Drosophila Gene’s silent using new techniques learned in lab. The hypothesise were that after collecting the data and results, the Gene’s would turn off, it will have a high amount of Thread and Drp1, and there will be a distinction between Drosophila cells with Mito GEP and cells with Drp1 dsRNA.

Find out how UKEssays.com can help you!

Our academic experts are ready and waiting to assist with any writing project you may have. From simple essay plans, through to full dissertations, you can guarantee we have a service perfectly matched to your needs.

View our services

In figure1, primers 1 and 2 were located. They were on the exon and locus. Respectively primer 1 and 2 had 16,039,375 and 16,038,681 nucleotides. After calculations were done the size of the PCR on the genomic DNA was 694 base pairs. And because there was a lack of introns, the size of the PCR from the cDNA template remained the same.

Next figure 2 has the presence of primer 3 and 4. They were involved in drp-1 in Drosophila. The number of nucleotides they both had was respectively 2,584,381 and 2,581,681 nucleotides. After calculations, 2700 base pairs were found to be the size of its PCR which exceeded the limit of 2500. But this time its PCR form the cDNA template was small.

In figure 3, our expectations were that for the Thread, the samples (1-3) for the drp-1 gel electrophoresis were supposed to have a thread product at 694 bps where the other samples (4-6) were supposed to show a drp-1 product 2700 bps which happened.

 Then figure 4, where my group was the only group who had trouble getting a perfect band at 694 bps. And the last lane which was still ours, had no presence of bands.

In figure 5, the presence and the lack of Drp-1 dsRNA was observed by Mito-GEP transfected cells photographs. In this step of the laboratory experiment, it was expected to have an apoptosis which did not occur. It could be the result of mistakes done during the purification which cause presence of less mitochondria cells.

In figure 6, showed the control dsRNA and the Thread dsRNA under light microscopy. So after analyzing the pictures, we came to the conclusion that both pictures were similar. Same thing that happened with our Mito-GEP transfected cells photographs, apoptosis was expected but did not take place. In this case what happened was, there was more mitochondria cells present.

With that being said, mitochondria go through some changes during cell death. Which include swelling and fragmentation of the mitochondrial. Swelling is likely a response to the permeabilization of the outer mitochondrial membrane, and can be observed in fly cells. This is an example of what students should have observed. ( Krieser, 2009)

In conclusion, our results did not meet our hypothesis that there will be a great amount of Thread and Drp1 that will be created from our agarose gel electrophoresis and that there will be a distinction between Drosophila cells that had Mito GFP and cells that had it with Drp1 dsRNA. This conclusion might be the result of students doing the lab wrong or mess up several steps along the way. But the good part of it is that students learn to use new equipment as well as new techniques that will be useful to them in the future.

References
 

  • Fire et al., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans,  Nature 391: 806-811, 1998
  • Mello, C.C., and Conte, D..  Revealing the world of RNA interference,  Nature 451: 338-342, 2004
  • Reagents and protocol for in vitro transcription were modified from Ambion, Megascript RNAi kit.
  • Eltyeb Abdelwahid, Takakazu Yokokura, Ronald J. Krieser, Sujatha Balasunduram, William H. Fowle, and Kristin White.  Mitochondrial disruption in Drosophila apoptosis.  Developmental Cell, 12: 793-806, 2007
  • Krieser, R. J., and White, K.  Inside and enigma:  Do mitochondria contribute to cell death in Drosophila?  Apoptosis, 14: 961-968 2009
  • Gonzales, S., Pisano, D.G., Serrano, M.. Mechanistic principles of chromatin remodeling guided by siRNAs and miRNAs.  Cell Cycle 7 (16): 2601-8 2008


 

Cite This Work

To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Related Services

View all

DMCA / Removal Request

If you are the original writer of this essay and no longer wish to have your work published on the UKDiss.com website then please: