Examining The Breast Cancer Susceptibility Gene Brca1 Biology Essay


Transfer of hereditary materials from one organism to its offspring is only possible through a specific unit of inheritance called a gene (Acharya & Sankaran, 2005). Each gene, also referred to as a functioning subunit of DNA, has a specific message it codes. This specificity is due to the presence of a particular protein or enzyme that produces only a particular product. Some organisms, for instance human beings, do not have genes that code for a specific information. A case of an absence or a total loss of a gene is called gene deletion. Genes are contained in a chromosome of an organism. Procedure followed in identifying relative position occupied by a gene in a chromosome is called gene mapping. The mapping also involves determination of distances between different groups of genes in a chromosome.

Genetic linkage maps, on the other hand, are DNA maps that allocate relative chromosomal landmarks in a chromosome for different genes. The assignment is done using the inheritance frequency of the genes. For a particular organism, all genetic materials that are contained in a chromosome are collectively called genome. Human genome is a total collection of genes required to form a human being (Acharya & Sankaran, 2005). A genome map is, therefore, a diagram indicating an ordered arrangement of genes and other DNA markers found in a chromosome. A condition that leads to a change in a molecular sequence, an arrangement, or total number of genes in a chromosome is called mutation. A genetic change in a sperm or an egg of an organism, which is later integrated into DNA of a somatic cell, is called hereditary mutation (Acharya & Sankaran, 2005). Germline mutation is another description for this mutated gene.

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Mutation can result to gene deletion or inactivation of genes. A function of a particular gene is, thus, affected indirectly by mutation. Genes that are responsible for controlling a cell growth and division process are called tumor-suppressor genes. Inactivation or total absence of these genes results to uncontrolled growth and/or division of a cell. An example of a tumor suppressing gene in human being is the BRCA1 (Kotsopoulos et al., 2006). BRCA1 restrains growth of cells especially around the breast and ovarian regions. However, when undergoes mutation, uncontrolled cell growth occurs predisposing an individual to developing a breast cancer. This mutated BRCA1 is called BRCA1 breast cancer susceptibility gene.

BRCA1 is an important gene in cell division. It functions by dictating when a cell division should occur and at what frequency. The gene also fixes errors that might occur during a cell division process. Mutation, which can be caused by genetic predisposition or environmental factors like tobacco smoke, alters this coordinated network of signals that triggers a cell division process (Pettigrew et al., 2008). Apart from abnormal functioning of tumor suppressor gene, breast cancer can be due to a malfunction of a pathway that repairs DNA and formation of an oncogene from a normal gene. BRCA1 and BRCA2 are the two breast cancer susceptibility genes that lead to cancerous growth. The two mutated genes occur at chromosome number 17 and number 23 respectively.

Normal BRCA1 and BRCA2 functions in the repair of breaks in a double stranded DNA. The function of these genes is specifically for DNA breaks that are caused by radiation (Pettigrew et al., 2008). Apart from being a tumor suppression gene, BRCA 1 also participates in ensuring the stability of a genome. This paper analyzes a Breast cancer susceptibility gene, BRCA 1. The paper specifically studies the genetic map, intron/extron structure, and common mutations of the gene. In addition, the paper discusses Single Nucleotide Polymorphisms (SNPs) within the gene and proposes PCR primers for an exon of the gene.

Chromosomal Map of BRCA1

BRCA 1 gene in human beings is located on chromosome 17 on its long arm (NCBI, 2010). This long arm is denoted by the letter q. at chromosome 17, BRCA1 gene occupy this position only at band 21. This position corresponds to base pairing of 38,449,840 to 38, 530,994. As discussed by Kotsopoulos et al. (2006), any slight mutation of the gene leads to cancerous growth. Other orthologs of the gene also results to breast and/or ovarian cancers. These genes are located near to BRCA1.

The orthologs include BRIP1 and PALB2 (Venkitaraman, 2002). Apart from BRIP1 and PALB2, there also exists another gene close to BRCA1 gene. This gene has a common name of BRCA1 Neighbor gene (Venkitaraman, 2002). It is usually denoted as NBRI1. The gene encodes a protein that is associated with a tumor antigen in an ovary. This encoded protein is characterized by a B-box or a coiled coil motif. This feature is common in genes that have transformational potential. The gene is said to be close to BRCA1 because it also positioned on chromosome 17q21.1 (NCBI, 2010). The gene, in addition, has some aliases, which are KIAA0049, MIG19, 1A1-3B, and M17S2. Moreover, the gene can be characterized using various designations like CA125, which is a carcinoma antigen in ovary. This designation corresponds to surface marker 2 of chromosome 17. Other designations include a membrane component and/or a migration-inducing protein of number 19.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Information about the map of the gene and the closely associated genes was found in two sites, which are http://www.ensembl.org/info/website/tutorials/index.html and http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosom/geneguide.shtml#mutation. The former site, which is developed by a National Center for Biotechnology Information (NCBI), gives a number of tutorials about the human genome map. In the provided maps, the site describes the location of the gene and coding and non-coding regions of the gene. The site, in addition, briefly describes the nearby located genes. The latter site further backs up the NCBI site about the arrangement of coding and non-coding regions in a BRCA1 gene.

Intronic and Exonic Structure

A DNA molecule can be segmented into two major regions, coding and non-coding sections. Coding regions are responsible for transfer of a genetic material and are, thus, translated into a protein. The non-coding regions do not have genetic materials and are, therefore not used in translation. The coding and non-coding sections are referred to as exons and introns respectively. In order to obtain a DNA molecule that only has coding sections; non-coding regions have to be removed. The process of removal of the non-coding sections is called splicing of a DNA molecule. In a DNA molecule, arrangement of an intron and an exon is such that no any two exons or introns align beside one another. In prokaryotes, introns are common rRNA and tRNA. A splicing action in a single gene may result to a greater variation in the sequences of protein translated from a particular gene. The diagram below shows how a splicing process results to a mature BRCA 1 gene with only coding sections, that is, the exonic structure of BRCA1;

The length and the number of exons and introns in a gene vary from one organism to another. However, a mature BRCA1 gene has about 22 exons, which are uniformly distributed in the gene. These 22 exons have a total of 5,592 nucleotides scattered all over the gene.

Common Mutations of BRCA1 Gene

According to Kadouri et al (2007), mutation results to a change in the sequencing and arrangement of bases in a DNA molecule. Alteration of a single base pair in a gene leads to great variation in the characteristics of that particular gene. For BRCA1, such variations predispose an individual to a cancerous growth (Kadouri et al., 2007). Identification of different possible mutations that can be associated with BRCA 1 is done by the use of Polymerase Chain Reaction (PCR) and DNA sequencing (Krum et al., 2003). Mutation of a BRCA1 gene does not only increase chances of a breast cancer, but also exposes a person to a fallopian tube, prostate, and ovarian cancers. Mutations of BRCA1 gene involves rearrangement of varied portions of a DNA molecule. Such rearrangements may further involve duplication or deletion of one or more exons in BRCA1 gene.

Several mutations have been identified to originate from BRCA1 gene (Kadouri et al., 2007). Prevalence of these mutations, however, varies from one population to another. Nevertheless, common mutations of BRCA1 gene include 5382insC, 188deAG, and 185delAG. The three mutations of BRCA1 gene are widespread in the Ashkenazi Jews (Kadouri et al, 2007). Other mutations of BRCA1 gene include 943ins10, which is common in African-Americans, 2795delA, 538insC, C61G, and Q180stop, all found among Austrians, and 3745delT, common in Finland among other mutations (NCBI, 2010). These mutations spread uniformly on the 22 exons found in a BRCA1 gene (Goina et al., 2008). Among the Dutch, however, is a mutated gene of BRCA1 that only involves deletion of exon 2 and 13. This mutant gene is denoted by 2804delAA. Nomenclature of various mutations of the gene requires indication whether mutation is due to insertion or deletion by inserting "ins" and "del" in the name of a mutated gene.

Single Nucleotide Polymorphism (SNP) Within the Gene

A Single Nucleotide Polymorphism (SNP) occurs in a genome when a DNA sequence of the nucleotides varies within members of a similar species (Vreeswijk et al, 2009). This nucleotide variation could involve replacement of an Adenine (A) with a Thiamine (T) or a Guanine (G) with a Cytosine (C). This variation often occurs at a particular position of a DNA molecule. A SNP results to an overall variation in both phenotypic and genotypic characteristics. For this reason, the total number of SNPs in a gene corresponds to the number of variants in a gene. A BRCA1 gene has a total of over 800 genetic variants (Vreeswijk et al., 2009). According to Vreeswijk et al. (2009), distribution of these variants is not even. Introns of this gene have around 50 known variants while the rest are in exon sections.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Even though the proportion of intronic variants is smaller than that of exonic, they have a great effect on a splicing process. In an intron of the gene, a variant occurs by a duplication process of 12 base pairs (GTATTCCACTCC) and 48 base pairs of a donor junction (Vreeswijk et al., 2009). Exonic variants, on the other hand, include a wide range of SNPs. However, only two exonic variants affect mRNA splicing. As indicated by Goina et al. (2008), these two variants are both situated in exon 18. One of the variants is BRCA1 c.543C→G (p.Pro1812Ala). This variant was is common in patients suffering from ovarian cancer. In order to arrive at this conclusion, RT-PCR method was used to analyze RNA of a patient (NCBI, 2010). Further splicing effect was investigated by the use splicing reporter hybrid minigene assays. The latter variant causes skipping of exon 23, which consequently, result in frameshift. This skipping, in addition, leads to a second BRCT domain protein termination. A resourceful site that provides information about the SNPs found in the gene is that of the NCBI. This site can also be accessed through http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosom/geneguide.shtml#mutation. The site summarizes the SNPs found in the gene. An estimate of the number of SNPs in both the introns and exons are also provided in the site. Moreover, the site gives the specific site onto, which common SNPs are located.

Polymerase chain reaction (PCR) Primers for a BRCA1 Gene Exon

Polymerase chain reaction (PCR) is an important part of molecular biology because the technology can be used to amplify a small amount of a genetic material (Pattyn et al., 2003). The amplified material can then be used in identification and manipulation of a DNA strand, detection of genetic variations, and identification of infectious organisms. According to Pattyn et al. (2003), this technology is characterized by three basic steps denaturation, annealing followed by an extension step. The three steps are highly dependent on temperature, thus, a successful primer design procedure is only achievable at specific temperatures. The proposed respective temperatures for the three steps are 940C, 600C, and 700C (Pattyn et al., 2003). The first step involves denature of a double stranded genetic material. This action converts a double stranded molecule to a single stranded one. Annealing step involves pairing of the primers to their respective complementary bases of the obtained single strand from denaturation. This step requires the enzyme primase. The third step involves extension of the newly formed double strand molecule. This final step is controlled by the enzyme DNA polymerase (Krum et al., 2003).

Designing PCR primers for an exon in a BRCA1 gene requires an appropriate probe to be used (Krum et al., 2003). A gene probe is a DNA or RNA fragment that is used as a tool in identification of a gene. This material is usually marked by a radioactive or a chemical substance. The marker enables the material to bind to a particular gene. By use of a gene probe, forward and backward primers are obtained (Pattyn et al., 2003). In the two cases below, two different gene probes have been used in order to design exonic PCR primers at specific temperatures. When a gene probe of AATTGGGCAGATGTGTGAGGCACCTG is used, the corresponding forward and reverse primers are CAGAGGACAATGGCTTCCATG and CTACACTGTCCAACACCCACTCTC respectively. This designation is only possible at an annealing temperature of 600C. However, when a different gene probe is used at the same temperature, different primers result. That is, by using the probe CATCATTCACCCTTGGCACAGGTGT, the resulting forward and reverse primers are ACAGCTGTGTGGTGCTTCTGTG and CATTGTCCTCTGTCCAGGCATC respectively.


The study of human genome requires full understanding of different properties or characteristics and functions of both RNA and DNA molecules. Understanding of these two molecules is an important tool in the field of genetics. Mutation, which results to a change in the sequence and/or number of nucleotides in a DNA molecule, alters both genotypic and phenotypic characteristics of a person. BRCA1 is a specific gene that suppresses tumor growth in a person. However, mutation of this gene results to uncontrolled cell division, which develops into a cancer. As indicated in the discussion section, several mutations have been associated with the gene. The gene also has SNPs that is responsible for different variations in a group individual of the same species. Exonic SNPs, nevertheless, have a greater effect than intronic SNPs. Possible PCR primers of the coding regions of the gene can be designed by the use of a primer design program. Success of this program is, however, dependent on a gene probe used and the working temperatures for the three steps required in the program.