Early Stage Of Foot And Mouth Disease Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Tumor necrosis factor is one of the earliest anti-viral cytokines against viral infections, and Foot-and-mouth disease virus shows a strong tropism for epithelial cells. Little is known about the tumor necrosis factor response in the early stage of Foot-and-mouth disease virus infection. To explore the tumor necrosis factor response, an epithelial cell line (PK-15) was inoculated with Foot-and-mouth disease virus (O/Akesu/58). The comparative expression levels of two most concerned cytokines (TNF-alpha, and beta) and two major cell receptors (TNF receptor 1, 2) were measured by quantitative PCR. Results show that the virus largely induced the expression of TNF-α, TNFR1, and an unclear effect on TNF-β, TNFR2. Medium change led a reduction of TNF-α, TNFR1, and induced the expression of TNF-β, TNFR2. Boost appearance of FMDV at 6 hpi highly induced the expression of TNF-α, TNFR1 by pathogen stimulus and altered TNF-β, TNFR2 expression by change the medium composition. Over-expressed TNF-α inhibited the virus replication.

Introduction

Foot-and-mouth disease (FMD) is a highly contagious viral disease of domestic cloven-hoofed animals and more than 70 species of wild animals. Foot-and-mouth disease virus (FMDV), causative agent of FMD, is the type species of the Aphthovirus genus of the Picornaviridae family and has a single-stranded, plus-sense RNA genome of approximately 8,500 bases. The convenient transmission by aerosol and rapid replication of FMDV lead to the high morbidity in susceptible animals. Newly formed infectious virions were observed at between 4 and 6 h after infection in different circumstances, and FMDV had a relatively short infectious cycle in cultured cells. Clinical signs appeared within 2 to 3 days after exposure in animals. Facing with so invasive virus, the body response in early stage is necessary to help control the epidemic of FMD.

In the early stage of virus infection, innate immunity was responsible for the anti-virus infection. The first anti-viral cytokines response against viral infections is the production of interferons (IFNs), and tumor necrosis factor (TNF). TNF appears to trigger multiple antiviral mechanisms; it is also able to synergize with IFNs in promoting antiviral activities, and induce IFN-β in several cell types. TNF shows roles of pro-inflammatory activity, proliferative activity, apoptosis, morphogenetic changes and differentiation in body. The TNF response represents the potential anti-pathogen ability. In the TNF superfamily, TNF-alpha, and beta (α, β) were the two most concerned cytokines to induce the immune response while TNF receptor 1(TNFR1) and TNFR2 were the two major receptors for TNF signal pathway.

FMDV shows a strong tropism for epithelial cells, in vivo. Epithelial cells in the upper respiratory tract were thought to be the site of initial virus replication. Soon, the virus was disseminated to the epithelial cells in the area of the tongue, soft palate, feet, tonsils, and tracheobronchial lymph nodes. In these areas, the virus leads to visible clinical typical clinical signs. During the initial and developing of FMD, epithelial cells were the major cell type for the replication of FMDV. The cytokines response of epithelial cells was the major part of early immune response. However, few researches reveal the cytokines kinetics in epithelial cell in the early stage of FMDV infection.

In the present study, epithelial cell line from porcine kidney and FMDV were used to explore the mRNA kinetics of TNF superfamily: TNF-α, TNF-β, TNFR1, and TNFR2 in epithelial cells. We demonstrate that the virus largely induce the expression of TNF-α, TNFR1, and an unclear effect on TNF-β, TNFR2. Medium change led a reduction of TNF-α, TNFR1, and induced the expression of TNF-α, TNFR1. Boost appearance of FMDV at 6 hpi highly induce the expression of TNF-α, TNFR1 by pathogen stimulus and altered TNF-β, TNFR2 change by change the medium composition. Over-expressed TNF-α inhibited the virus replication. It indicates that TNF-α, TNFR1 together response to the virus stimulate while TNF-β, TNFR2 were influenced by environment change. We reason that, during FMDV infection, the TNF-α was mainly response to stimulate immune response and anti-FMDV which results in the timely response to FMDV infection and low mortality in adult animals, while the TNF-β was responsible for the change of internal environment.

Materials and Methods

Cells and Virus

Epithelial cell line from porcine kidney (PK-15) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), and the cells were incubated in 5%CO2 at 37℃. PK-15 cell line was purchased from CLS Cell Lines Service GmbH.

FMDV, O/Akesu/58 (serotype O, isolated in Akesu, XinJiang, 1958), was adapted to PK-15 cells, and used in the research. The virus was titrated on PK-15 cells by calculating the 50% tissue culture infectious dose per ml (TCID50/ml).

Group Designing

Three bottles of 100% confluent PK-15 cells in 25cm2 flask were digested with trypsin. After fully digested, the cells were collected to a flask with 55mL DMEM with 10% FBS. After mixed fully, 5mL cell mixture was added to each 15cm2 flask. In totally, 11 flasks of PK-15 cells were obtained. After the cell was 90% confluent, one flask of PK-15 cells was randomly selected and named as C. Sample C was stored at -70℃ after discarding the supernatant. Five of the others were inoculated with O/Akesu/58, and randomly named from A1 to E1. The rest which changed the medium with MEM were as controls, and randomly named from A0 to E0. Four hours after virus inoculated, A1 sample in virus inoculated group and A0 sample in control group were stored at -70℃ after discarding the supernatant, repeating this every 2 hours. Each time a sample in virus inoculated group and a sample in control group were collected based on the alphabetical order in alphabet.

Virus Inoculation

Before virus inoculation, the cells were washed twice with MEM. Then, a viral suspension titrated at 102 TCID50 per ml was used for viral challenge. After 1 h of absorption with 900μl viral suspension in each bottle, inoculum was removed and the cells were washed twice with MEM. At last, 5 ml MEM was added to each flask.

RNA Isolation and Quantitative Polymerase Chain Reaction (q-PCR)

Total RNA was extracted with TRIZOL according to manufacturer's protocol, and treated with RNase-free DNase I. The concentration of total RNA was measured by NanoDrop 2000. The first-strand cDNA of the total RNA was synthesized with oligo-dT using Reverse transcriptase M-MLV. The reverse transcription(RT) was performed in the volume of 55μl containing 5μg of total RNA, 0.5mM dNTP each, 5μM oligo-dT primer, 11μl 5Ã-M-MLV buffer, and 800U AMV reverse transcriptase.

The q-PCR was performed with SYBR Premix Ex Taq using the Mx3000P sequence detector system, and ROX reference was use to normalize the fluorescence. The Ct value was determined by baseline-corrected normalized fluorescence (dRn).The q-PCR was in the volume of 25μl containing 2μl of RT product, 0.2μM forward primer, 0.2μM reverse primer, 12.5μl 2Ã-SYBR Premix Ex Taq. Seven genes were selected in the q-PCR, and they were glyceraldehyde-3-phosphate dehydrogenase (GAPDH), TNF-α, TNF-β, TNFR1, TNFR2, and FMDV. For each gene of the samples, three replicates were designed. Their q-PCR primers were designed based on the guidelines in Real-time PCR. The sequences of the primers were shown in table 1.

Quantitative Analysis

The comparative expression level of each mRNA was calculated by the comparative Ct method (δδCt). The formula for comparative expression level is 2-δδCt, and achieved with the software REST 2009. The housekeeping gene GAPDH was selected as normalize in each sample to calculated δCt. Sample C was set as the reference to determine the δδCt, and the expression level of sample C was set as 1.

The histogram of comparative expression level was generated in Microsoft Excel Program.

Results

Cytopathic Effect (CPE) and Quantification of the Gene of FMDV

The CPE of cells in virus inoculated group showed consistent CPE in the observation time. The CPE and the comparative FMDV gene level to sample A1 were showed in table 2. Till 10 hpi, no exfoliated cells were observed which indicated that discarding the supernatant didn't influence the determination of comparative expression level of target mRNA. 12 hpi, the cells began to leave the wall of flask and the cell fragments were observed, so the sample E1 was collected without discarding the supernatant to collect the total RNA in experiment. To avoid the influence of the taking off and obvious lysis of cells on the expression level detection, sample E1, E0 was excluded from the analysis of TNF superfamily response. For the q-PCR of FMDV, no signal was detected in the samples without virus challenge. The earliest time to observe the newly formed virions was at 4 hpi, so the earliest time to collect sample was set at 4 hpi. In sample A1, CPE and the comparative gene level experienced a huge change compared to sample B1, while the comparative level between the samples collected in every two hours was gentle. The CPE and comparative gene level of FMDV were together to indicate that newly formed virons began to appear at about 6 hpi, but not 4 hpi in PK-15. There were no CPE and FMDV gene detected in non-virus inoculated samples which was reasonable.

TNF-α, TNFR1 Response

The histogram of the comparative expression levels for samples was shown in figure 1A (TNF-α), and figure 1C (TNFR1). The expression level of TNF-α, TNFR1 in control samples all showed a huge reduction, while the expression level in treated group kept an obvious increase. The expression level at 6 hpi show a slightly reduction compared to the samples collected at 4 hpi and 8 hpi and the level of TNFR1 showed a reduction compared to sample C. However, the comparative level compared to control sample (table 3) was highest for TNF-α, and second highest for TNFR1. The comparative expression level compared to control sample indicated that the virus challenge greatly increase the TNF-α, TNFR1 expression level. The reduction of TNF-α, TNFR1 at 6 hpi may caused by the environment change which was further analyzed following.

TNF-β, TNFR2 Response

The histogram of the comparative expression levels for samples was shown in figure 1B (TNF-β), and figure 1D (TNFR2). From the histogram of the control samples, from 4 hpi the TNF-β, TNFR2 experienced an up-down change. The peak of the change for TFNR2 appeared at about 6 hpi, while the change was appeared at 8 hpi for TNF-β. Over-expression was observed for the gene in all of the samples except TNF-β at 6 hpi and the TNFR2 in untreated group at 10 hpi. The comparative expression level of TNF-β, TNFR2 (table 3) showed no obvious change between the treated group and the control group compared to TNF-α, TNFR1. For TNF-β at 6, 8 hpi, there was no difference between the virus inoculated sample and the control sample. For TFNR2 at 6 hpi, the expression level in untreated sample was higher than expression level in treated samples. The minor difference and over-expression in both treated and untreated samples suggested that the TNF-β, TNFR2 response to the environment change. With this explanation, the histogram and unclear comparative level change were reasonable. As the change of medium, the TNF-β, TNFR2 were over-expressed. When the cell adapted to the changed medium, the expression of TNF-β, TNFR2 was down at about 6, 8 hpi. Numerous newly formed FMDV change the medium composition second time which lead to induce the expression of TNF-β, TNFR2 at about 8, 10 hpi. What's more, the cell stress to environment change may also lead to inhibit of gene expression of TNF-α, TNFR1 which was indicated by the histogram of the TNF-α, TNFR1 expression level in control group. And at 6 hpi, the influence got highest.

Discussion

TNF play an important role in against virus infection. The research of TNF response focused on the period after appearance of clinical signs, or post vaccination. For FMDV, epithelial cells are the major cell type to replication and invasion. There is no research indicate the TNF response especially in epithelial cells in early period. The IFN-β response triggered by CSFV was shown in PK-15. We reasoned that the PK-15 can also show TNF response with the FMDV challenge.

In the present study, we explored the response of two major cytokines (TNF-α, TNF-β) and two major receptors (TNFR1, TNFR2) in TNF superfamily after the inoculated of FMDV. As the newly formed virions were observed 4 hpi at earliest, the earliest collection time was set at 4 hpi and other collection was performed every two hours. To induce the affect caused by the change of medium, control group which was only changed the medium was set. As expected, after virus inoculated, all of the four target genes showed over-expression.

Comparison of the comparative expression level of TNF-α, TNFR1 in virus inoculated sample and the control sample in corresponding time, it indicated a continuous induce of FMDV to the TNF-α, TNFR1. However, for the TNF-β, TNFR2, FMDV inoculated showed different effects of up-regulation, down-regulation, and non-regulation at different hpi, which was difficult to determine the effects of FMDV challenge. In the non-virus inoculated group, the TNF-α, TNFR1 all showed a huge down-regulation compared to sample C, while for TNF-β, TNFR2, the circumstance was complex. Combined with the difficult of determination the effect of virus inoculated on TNF-β, TNFR2. We assumed that the unclear change of TNF-β, TNFR2 and obvious reduction of TNF-α, TNFR1 in control samples were influenced by stress to environment change.

For the gene expression level in control group, the environment change led an up-regulation before 6 hpi for TFNR2, 8 hpi for TNF-β. In the following time, the adaption of cell to the environment led to the down-regulation. However, the newly formed virions kept changing the medium composition which led an inconsistent change compared to control group. For the histogram tendency of genes in control group, the expression of TNF-α, TNFR1 all showed an obvious reduction which may be caused by the medium change. But in the virus challenge group, the FMDV stimulus led to a huge over-expression. Though the stress to environment change led the expression level of TNF-α, TNFR1 at the lowest point at 6 hpi, the boost appearance of FMDV make the comparative level reach the peak. This indicates that virus inoculation induced the expression of TNF-α and TNFR1, in turn, over-expressed TNF-α inhibited the virus replication which was shown as the gentle virus replication after 6 hpi.

Conclusions

We suggest that the virus largely induce the expression of TNF-α, TNFR1, and an unclear effect on TNF-β, TNFR2. Medium change led a reduction of TNF-α, TNFR1, and induced the expression of TNF-α, TNFR1. Boost appearance of FMDV at 6 hpi highly induce the expression of TNF-α, TNFR1 by pathogen stimulus and altered TNF-β, TNFR2 change by change the medium composition. Over-expressed TNF-α inhibited the virus replication. It indicates that TNF-α, TNFR1 together response to the virus stimulate while TNF-β, TNFR2 were influenced by environment change. We reason that, during FMDV infection, the TNF-α was mainly response to stimulate immune response and anti-FMDV which results in the timely response to FMDV infection and low mortality in adult animals, while the TNF-β was responsible for the change of internal environment.

Author Contributions

Conceived and designed the experiments: YBM HYC. Performed the experiments: YBM SDG. Analyzed the data: CXH JZD. Contributed reagents/materials/analysis tools: SDG.

Figure legends

Figure 1. Histogram of the comparative expression level of target gene compared to sample C. The axis "X" represents the hours post inoculation while axis "Y" stands for the comparative expression level of gene compared to the sample C whose expression level is set as 1. The histogram in black color represents the samples with virus inoculation while the histogram in white stands for the samples only changed the medium which was set as control sample. (A) The comparative expression level of TNF-α. (B) The comparative expression level of TNF-β. (C) The comparative expression level of TNFR1. (D) The comparative expression level of TNFR2.

Tables

Table 1. q-PCR primers for the genes and product length

Gene name

Primer

Primer sequence (5'-3')

Product length(bp)

TNF-α

FP

ATGATCCGAGACGTGGAGC

226

RP

ACGATGATCTGAGTCCTTGG

TNF-β

FP

CATGACACCACCTGGACG

238

RP

TCTCCAGCGCAGTGAGTCC

FMDV

FP

ACTTCCTCATTGAGAAAGG

RP

TCAATGTACTCATTCACTGC

TNFR1

FP

TGGCATTCTTCCTCTTCGTTGG

RP

ACTGGAGATGGGACTGAAGC

TNFR2

FP

TGCAGCAAGTGTCCACCAGG

RP

AGTGCAGGCTTGAGTTTCTACC

GAPDH

FP

ATCACCATCTTCCAGGAGC

RP

TCATACTTCTCATGGTTCACG

FP: forward primer RP: reverse primer

Table 2. The CPE and the comparative FMDV gene level

sample

hpi

CPE (%)

Comparative level (A1 as reference)

Comparative level to the previous one

C

0

0

0

-

A1

4

0

1

-

B1

6

10

23.75

23.75

C1

8

25

57.68

2.43

D1

10

75

399.85

6.93

E1

12

90

1348.06

3.37

A0-E0

4,6,8,10,12

0

0

hpi: hours post inoculation represents the collection time of samples CPE: Cytopathic effect caused by FMDV

Table 3. Comparative gene expression in virus inoculation sample compared to expression in control sample collected in corresponding time

4

6

8

10(hpi)

TNF-α

20.20

147.15

59.90

69.92

TNF-β

3.24

1.00

0.98

1.53

TNFR1

13.34

20.17

75.13

13.34

TNFR2

1.29

0.42

1.43

7.46

hpi: hours post inoculation number: the comparative gene expression level in virus inoculation group compared to it in control samples collected in corresponding hpi.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.