Duck Septicemia Anserum Exudativa Riemerellosis Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The epizootic infectious disease of domestic birds known as septicemia anserum exsudativa was first described by Riemer in 1904 Rimler, 1904; Sergers et al., 1993. The disease is caused by Riemerella anatipestifer (RA). The infection is a serious worldwide problem of natural water fowl and domestic turkey ,duck, and goose populations (Glunder & Hinz, 1989; Sandhu, 2003). The infection typically exacts a severe economic cost, especially when poultry is also infected with other microorganisms. Once the disease invades duck and goose flocks, it can become endemic. Eradication can be difficult, with repeated infectious episodes possible. Infections caused by RA are characterized by the systemic development of exudative serositic lesions, and should be differentiated from fowl cholera, and infections caused by Escherichia coli, Streptococcus faecium, and Salmonella spp. (Sandhu, 2003).

Riemerella anatipestifer is a gram-negative, non motile, non spore-forming, rod-shaped bacterium (Segers et al., 1993) belonging to the Flavobacteriaceae family in rRNA superfamily V(Subramaniam et al., 1997). As at present, there are at least 21 known serotypes of RA (Pathanasophon et al., 2002). RA causes a contagious septicemic disease in domesticated ducklings , turkeys, and various other birds (Brogden, 1989) and accounts for major economic losses in industrialized duck production due to weight loss, high mortality, and culling (Sandhu and Rimler, 1997). The disease occurs as an acute or chronic septicemia characterized by fibrinous pericarditis, perihepatitis, airsacculitis, caseous salpingitis, and meningitis. Similarly, other characteristics of the anatipestifer syndrome in ducks, include; diarrhea, lethargy, respiratory and nervous symptoms, which can lead to high mortality and consequently great economic losses (Asplin, 1955; Glunder and Hinz, 1989). In southeast Asia, RA infection has been a problem in the intensive production of meat ducks since 1982 (Teo, et al., 1992) and it is a continuing problem in many duck farms (Subramaniam et al., 2000).

It has been observed that; adverse climate or concomitant disease often predispose the birds to outbreaks of RA infection. For ducklings infected by RA before 5weeks old, mortality varies from5% to75% and morbidity is usually as high as100%. Older water fowls usually suffer chronic, non-fatal or subclinical disease (Sandhu,2003).

The definitive diagnosis of RA infection requires isolation and identification. The organism is identified on the basis of growth, morphologic and biochemical characteristics. However, RA is characterized more by the absence than by the presence of specific phenotypic properties (Hinz et al., 1998). No selective and or indicative media have been established for RA. However, Media such as; Tryptic Soy Agar (TSA, Difco, NJ, USA) at 37°C for 24h in 5% CO2 or Tryptic Soy Broth (TSB, Difco, NJ, USA) at 37°C,150rpm for 16h has been effective in the culturing and isolation of RA (HU et al., 2010; Hu et al., 2011; Sandhu, 1991, 1979; Layton and Sandhu, 1984; Pathanasophon et al., 1994, Pathanasophon et al 1996; Crasta et al., 2002; Tsai et al., 2005; ). Similarly blood agar has been used in isolation of RA (Fulton and Rimler., 2010). Also, Higgins et al., (2000) have successfully cultivated RA with Todd Hewit broth (Difco, Detroit, MI, USA) with 0.5% added yeast extract (Oxoid, West Mosley, Surrey, UK) at 37°C overnight in either a shake culture or air bubbled culture. Bisgard (1982) used Tryptose blood agar base (Difco) with 5% citrate stabilized calf's blood in isolation of RA.

Cheng et al., (2011) used 10% sheep blood agar with 37°C in 5% CO2 incubation for 24-48h. In their work to elucidate phylogenetic position of RA based on 16S rRNA gene sequence, Subramaniam et al (1997) have used Columbia agar at 37°C and 5% CO2. Blood agar or brain heart infusion broth (Difco) could also be used to achieve the same purpose (Yu, et al., 2008). Although, blood is required to enriched the media for the cultivation of bacteria; Li et al (2011) have used 10% rabbit blood agar plate and then placed at 37°C for 24-48h cultivation in 5% CO2 incubator. After single colony formation, it was transferred into Brain Heart Infusion agar medium (Difco, BD, Franklin Lakes, NJ, USA),for further cultivation. Perhaps different laboratories have different requirements for qualitative cultivation of RA, it suffice to say that; whichever media used, the essence and purpose is to have pure strains as reference or for research work.

2.2 The Disease: Duck septicemia anserum exudativa in Malaysia

Duck septicaemia is also known as Anatipestifer syndrome. There are limited reports or under reporting of cases on Duck septicemia in Malaysia. Probably because of its clinical similarities with other disease. Duck septicemia share similarities in clinical characteristics with Fowl cholera or infections caused by Escherichia coli, Streptococcus faecium, and Salmonella species Sandhu, (2003). Perhaps pasteurellosis is one of the common diseases encountered in ducks in Malaysia (Aini, 1993). Duck septicemia causes sudden death in young ducklings, with losses due to mortality or retarded growth. It is sometimes confused with colisepticaemia, except that nervous symptoms may be present in duck septicaemia (Aini,1993). It is likely that Duck septicemia many be confused with Fowl cholera or Coli septicemia looking at the similar clinical characteristics. Riemerella anatipestifer is phenotypically similar to Pasteurellae, and this similarity may cause diagnostic problems. Riemerella anatipestifer can easily be misidentified as Pasteurella multocida, as animals may harbour both species at the same body sites and both pathogens can simultaneously be present in fowl stocks (Tiong 1990). These have probably lead to under reporting, false reporting or misdiagnosis of Riemerella anatipestifer in Malaysia.

2.3 Pathogenesis of Duck Septicemia Anserum Exudativa (Riemerellosis)

The pathogenesis o Duck septicemia which is primarily the disease of ducks and other avian species is poorly understood. However, little is known and has been demonstrated about the pathogenicity of RA in turkeys. Disease and mortality in turkeys has been induced experimentally by intravenous, intramuscular and subcutaneous application of RA (Smith et al., 1987; Cooper & Charlton, 1992; Charles et al., 1993). Cooper (1989) speculated that mosquitoes may serve as vectors for RA transmission in field outbreaks. Not much is known about other routes of infection in turkeys (e.g. via the respiratory tract), which are speculated to play an important role in naturally occurring infections. Smith et al. (1987) have reported that RA inoculation of turkeys into the trachea or infraorbital sinus did not result in clinical signs or gross lesions, whereas RA inoculation of ducks via respiratory routes was found to cause clinical disease and mortality (Hatfield & Morris, 1988; Sarver et al.,2005). The avian metapneumovirus (aMPV), a member of the family Paramyxoviridae, is arespiratory pathogen often found in combination with RA in diseased turkey flocks (McDougall & Cook, 1986). The virus is known to support secondary bacterial infections and may therefore exacerbate RA-induced disease in turkey flocks under field conditions.

Rubbenstroth et al. (2009) have demonstrated that RA inoculation of turkeys via different respiratory routes resulted in systemic RA infection, seroconversion and the development of clinical disease and gross lesions. While inoculation by intravenous, intramuscular and subcutaneous injection has already been reported to induce clinical disease and mortality in turkeys (Smith et al., 1987; Cooper & Charlton, 1992; Charles et al.,1993), attempts of intratracheal inoculation or inoculation into the infraorbital sinus failed to result in RA infection or disease (Smith et al., 1987). In contrast to these findings, intranasal inoculation of ducks led to clinical disease and mortality, although the course of the disease was less severe than after parenteral application (Hatfield & Morris, 1988; Sarver et al., 2005). Comparing the three routes of RA inoculation in these experiments, injection directly into the abdominal air sac induced the highest incidence of gross lesions and was the only route of infection that resulted in mortality. Intratracheal inoculation did not induce lesions, and the rates of RA re- isolation were comparably low. It may be speculated that part of the inoculum had been readily cleared in this group by mucociliary transport, whereas aerosol and air sac injection enabled RA to directly colonize the lower respiratory tract. The higher incidence of gross lesions and the mortality caused by air sac inoculation may be attributed to the skin lesions created by the possibly RA-contaminated injection cannula, which may favour RA bacteraemia. Skin lesions are thought to play an important role in the establishment of

RA infection in ducks (Asplin, 1956; Leibovitz, 1972). RA infection via the oral route, which may also play a role in pathogenesis under field conditions, has not been investigated previously in turkeys. Experimental RA inoculation of ducks via the oral route resulted in less pronounced signs of disease compared with parenteral and respiratory routes (Hatfield & Morris, 1988; Sarver et al., 2005).

RA-induced gross lesions included mainly pericarditis, epicarditis and airsacculitis, as previously described for RA-infected turkeys and ducks (Zehr & Ostendorf, 1970; Leibovitz, 1972; Helfer & Helmboldt, 1977; Smith et al., 1987; Hatfield & Morris, 1988; Cooper & Charlton, 1992; Charles et al., 1993; Cortez de Ja¨ckel et al., 2004). Interestingly they were markedly less severe than those seen during outbreaks in commercial turkey flocks, although high RA doses were used for infection.

From these observations it is concluded that RA is pathogenic for turkeys when delivered via respiratory routes, which may play an important role for natural RA. infection in the field. However, the development of clinical disease and severe gross lesions may largely depend on the contribution of other exacerbating factors, since it was not possible to reproduce severe clinical disease with RA mono-infections in this study. This is in congruence with field observations, in which RA can be isolated from the respiratory tract in turkey flocks showing no or only mild respiratory signs (Behr, 2007).

A number of concurrent viral and bacterial infections have been detected during RA outbreaks in turkey flocks, such as E. coli, M. gallisepticum, Mycoplasma meleagridis, O. rhinotracheale, Newcastle disease virus or a MPV (Bendheim et al., 1978; Saif et al., 1982; McDougall & Cook, 1986; Smith et al., 1987; Cortez de Ja¨ckel et al., 2004). MPV is known to predispose turkeys to secondary bacterial infections of the respiratory tract (Cook et al., 1991; Naylor et al., 1992; Ganapathy et al., 1998; Van de Zande et al., 2001; Alkhalaf et al., 2002; Marien et al., 2005).

Further field studies have shown that the bacterium rarely acts as a primary agent but rather that in most cases predisposing bacterial and viral infections are involved in causing disease (Sandhu and Rimler, 1997). The natural environment of R. anatipestifer is the heart, brain, air sacs, bone marrow, lungs, and liver of ducklings, and the bacterium is thought to enter through the respiratory tract or skin punctures (Sandhu and Rimler, 1997). Similarly membrane O-sialoglycoprotein substrates present in host cells, such as those present on the mucosal epithelia of the respiratory tracts of ducklings or on immune cell surfaces, may be the natural targets of this enzyme, thus contributing to its pathogenicity, as these are potential sites for an intrinsic cohemolytic reaction of R. anatipestifer with other organisms. The action of two or more factors on individual target structures could initiate events leading to structural and functional disorders and may contribute to the fibrinous exudates on the surfaces of infected organs and inflammatory exudates on lesions that are observed at postmortem (Sandhu and Rimler, 1997).

Variations of virulence as assessed by mortality and morbidity rates have been reported for the different serotypes and within a given serotype. It has been showed that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the cohemolysin and Serotypes 1, 2, 3, 5, and 15 are most prevalent in severe outbreaks of septicaemia anserum exsudativa (Pathanasophan et al., 1994; Teo et al., 1992). The presence of the cohemolysin could contribute to virulence, as it is produced by most of the prevalent serotypes, which may be better adapted at producing the cohemolysin during a natural infection under certain intracellular conditions and therefore able to damage the host and aid in the infection process, thus providing a function essential to pathogenesis. One possible consequence of hemolytic activity in vivo is the release of iron for use by the organism, as pathogenic bacteria require iron in the infection process (Hacker and James, 2000). The Cam protein of R. anatipestifer was found to possess properties similar to those of the sialoglycoprotease from P. haemolytica, which was considered a virulence factor (Lee et al., 1994).

2.4 Immune response of Ducks to Riemerella anatipestifer

Ducks recovering from the acute form of Ra infection are usually resistant to subsequent challenge (Hendrickson et al., 1932, Graham et al., 193), indicating that protective immunity can develop. Members of the genus Riemerella, as with those of the Pasteurella, are facultative intracellular pathogens. However, it is noteworthy that, in Pasteurellosis, antibody (Ab) protects against disease (Collins., 1977); this is not, however,synonymou with protection against infection. It is to be expected that serum Abs, along with complement (C') and phagocytic cells, will be active against extracellular organisms invading the blood and tissues during the septicaemic stages of the infection (with the caveat of the likely functional deficiencies of the IgY.∆Fc.), organisms sequestered within macrophages, as in the chronic and carrier states of disease, will require the effector mechanisms of cell mediated immunity (CMI). Thus, protection against disease is not necessarily synonymous with eradication of the organism from the host.

Previous studies have assessed immunity by challenge or have concerned the production of

Abs as a result of infection or vaccination. Abs produced in response to vaccination or infection have recently been monitored by ELISA, using bacterial cell extracts as antigens (Timms and Marshall,1989; Hatfield et al., 1987). Duck Abs are usually ineffective in precipitin and agglutination tests (Toth and Norcross, 1981; Higgins, 1989) and this is the case also against Ra antigens. Serotyping of Ra isolates is, therefore, usually achieved with chicken or rabbit antisera (Harry, 1969, Bisgaard, 1982, Sandhu and Leister , 1991). There is no information concerning the anti-Ra effector functions of the individual duck Ig isotypes and isoforms.

Interestingly, in unimmunized ducks there is greater resistance to oral challenge than to intranasal challenge, and least resistance to intramuscular challenge (Asplin, 1956,Hatfield and Morris, 1988), suggesting that mucosal defense mechanisms play an important role in primary protection. Vaccination against Ra infection has commonly utilized bacterins, usually formalin killed preparations of the organism (Sandhu, 1979, Layton and Sandhu, 1983, Sandhu, 1991, Floren et al., 1988, Pathanasophon et al., 1996). The efficacy of such vaccines is generally poor: protection is incomplete and short-lived, some bacterins are unacceptably toxic, and while aluminium hydroxide is an ineffective adjuvant the stronger (oil-based) adjuvants leave undesirable tissue residues and lesions (Harry and Deb, 1979, Sandhu, 1979). However, although the efficacy of Ra bacterins is short- lived, it has proved sufficient that, with two injections, protection can be given to table birds for the duration of their 7±8 week life span (Harry and Deb, 1979, Sandhu, 1979Floren et al., 1988). More effective protection has been achieved with vaccines employing live attenuated organisms (Harry and Deb, 1979, Sandhu, 1979, Layton and Sandhu, 1983); it is to be expected that by attaining the intracellular environment, these organisms will persist, and will give prolonged stimulation to the immune system. However, live vaccines can adversely affect growth, can yield positive Ra isolations on culture, and are not acceptable to all authorities responsible for vaccine licencing. Cell free culture fluids can also be highly immunogenic but have received limited attention (Pathanasophon et al., 1996).

Protection of very young ducklings is based on vaccination of the laying ducks with transfer of Abs to the duckling via the egg yolk. This achieves only short-term (7 - 12 days) protection. If the levels of Ab inherited are very high, they will persist longer but might then neutralize Ra vaccines administered to ducklings in the first 2±3 weeks of life.

Polyacrylamide gel electrophoresis of Ra lysates under reducing and non-reducing conditions reveals the presence of many polypeptides most of which are common to all serotypes while some are restricted to a single serotype or group of serotypes (Higgins, unpublished). Tan et al. (1991) found that sera from ducks that had been immunized against, and then survived challenge with, Ra serotype 10 possessed Abs (not found in unvaccinated birds) to an Ra antigen of 67 kDa, while birds similarly exposed to Ra serotype 1 possessed Abs to a 48kDa component; it was suggested that these bands represent protectively immunogenic antigens, but it seems strange that Abs were not also generated to a broader range of proteins.

2.5 Economic importance of Duck Septicemia Exudativa in South East Asia

In Southeast Asian countries such as Vietnam, Philippines, Thailand, Malaysia, Hong Kong and Korea, ducks are important cuisines. Thus their importance in agricultural development and food security can never be over emphasized. In Malaysia, the main outlets for broiler ducks are Chinese restaurant and stalls selling roast ducks. The consumption of duck meat is limited; it is not common on the daily household menu. Eggs are mostly consumed as salted or preserved eggs rather than fresh eggs (Awang, 1993). Riemerella anatipestifer infection which primarily cause disease in domestic ducks, accounts for major economic losses to the industry ( Sandhu and Rimler, 1997). In southeast Asian countries; including Malaysia, Riemerella anatipestifer infection has been a continued problem in the intensive production of meat ducks since 1982 (Teo, 1992). The Mortality and morbidity rates are usually between 10 and 30% but mortality of as high as 75% has been recorded in infected duck farms. Mortality in susceptible ducklings in a natural outbreak can reach 75% (4). Various drugs have been found effective in reducing mortality(1), but their use is highly restrictive, expensive, and not economically feasible. Persistence of Riemerella anatipestifer is a severe problem in the intensive duck industry in many countries.

Serious economic losses occur as a result of deaths, culling, depressed growth rate, and the necessity for veterinary treatment. High condemnation rates at slaughter may also occur. The onset of the disease is often rapid and flock medication is most often ineffective even when

instituted at therapeutic levels at the time the disease is detected. Continuous medication

with prophylactic levels of antibiotic is costly and may appear ineffective also (Bisgard, 1982). Therefore a sustainable means of control is by vaccination; as at current information on the disease prevalence is lacking in Malaysia, similarly the vaccines to be used in control of the disease. Development of vaccine would reduce incidence of mortality and cost of medication which is highly expensive and appears to be ineffective.

2.6 Diagnosis of Riemerellosis in Avian species

2.6.1 Direct microscopic examination

The collection of material for any laboratory examination should be cooled immediately or frozen where appropriate and should be transported to the laboratory as quickly as possible in a leak-proof container. The samples to be taken are largely where Riemeralla anatipestifer is known to invades. Ra mostly affects respiratory tracts, thus; swab samples from trachea, lungs, and other major organs should be aseptically taken.

A detailed case history is required for accurate diagnosis. Direct microscopic examination would involved making smear of the sample which is stained with Gram's stain and examined under the microscope as described (Quinn et al., 1994). Riemerella anatipestifer would appear as Gram-negative, none-motile, nonespore-forming, rod-shaped bacterium (Hu et al., 2010).

Also, Hinz et al (1998) described Riemerella anatipestifer as Gram-negative rod-shaped microorganisms with an average size of 0.2 to 0.4 by 1.25 to 2.5 μm, of which some were spherically swollen, spindle or lemon-shaped and arranged in short chains. This is in clear contrast with the most recent reports.

2.6.2 Isolation and identification of Reimerella anatipestifer

Reimerella anatipestifer, the causative agent of new duck disease causes a contagious septicemic disease especially in ducklings, turkeys and other birds. (Hirsh et al., 2004). The disease is also known as duck septicemia or infectious serositis in ducks.

The standard laboratory methods for diagnosis of bacterial diseases are based on bacterial isolation and identification which is based on culture. However, culture-based methods are time-consuming, tedious, invariably monospecific (i.e. they detect only one type of pathogen), and have low throughput. Samples are inoculated on blood agar plates which shows convex, transparent, non-hemolytic colonies of 1mm in diameter after 24 hours of incubation. Better growth is noticed on plates incubated under anaerobic conditions. In addition to that, slightly mucoid, weak hemolytic colonies will also be observed. When the organisms are purified and on Gram's staining it revealed short Gram negative rods. Which are non-motile; positive for catalase and oxidase tests; negative for indole and H2S production; failed to grow on MacConkey agar and were identified as R. anatipestifer.

2.6.3 Serotyping of Riemerella antipestifer

As at present, there are at least 21 known serotypes of Riemerella anatipestifer (Pathanasophon et al., 2002) and the only tool used for serotyping remained the slide and tube agglutination test as described (Sandhu and Liester, 1991; Bisgard, 1982). Recent developments showed predominant immunogenic outer membrane protein (OmpA) was characterized for its possible use in the serodetection of R. anatipestifer infections (Subramaniam et al., 2000). They have suggested that OmpA is valuable for the serodetection of R. anatipestifer infections, independent of their serotypes. According to Tsai et al., (2005) since a greater variation of ompA exist the diagnostic value of the protein product is unclear. Although the purpose of using recombinant technology in diagnostic veterinary medicine is to develop a diagnostic approach that could safe time, reduce cost and labour. It then means that the conventional serological test used earlier in the serodetection of RA remained the only useful tool for serotyping, because the recombinant approach has not taken care of the discrepancies on variation in ompA. Thus, slide and tube agglutination tests has the advantage of been consistent and reliable.

Sandhu and Leister, (1991) showed that; slide agglutination test involves mixing 1 or 2 colonies on a glass slide with a drop of undiluted antiserum. Clear clumping of cells within a few seconds regarded as positive. Most of the isolates reported worldwide were serotyped by this method. Cultures showing nonspecific or partial agglutination could be tested by tube agglutination. Tube agglutination test is conducted using serial two-fold serum dilutions ranging from 1:5 to 1:1280. Equal volumes (0.5 ml) of antigen and diluted antiserum is mixed and incubated at 37°C. Undiluted normal serum and FPSS is included as negative controls. An appropriate reference serum is used as a positive control. Tubes are read after 18 and 48 h of incubation. Titres is recorded as the highest serum dilution exhibiting clear agglutination. Although in both tests surface antigens are presumed to determine serotype specificity. The advantage of agglutination test is that it allowed quantitation in terms of serum titres. Moreover, nonspecific reactions have been reported with the AGP test between heterologous serotypes as well as between PA and other bacteria (Harry, 1980, Sandhu, unpublished data). Slide agglutination is a quick convenient test to screen a large number of isolates; nonspecific reactions can be eliminated by the use of washed cells as antigen.

Whereas Bisgard (1982) has demonstrated the two tests as follows: Slide agglutination tests is performed on ordinary glass slides (7.5 cm by 2.5 cm) the slide is placed on a black background. Cells from an 18-hour-old blood agar culture is stirred into a drop of undiluted antiserum with an inoculating needle. In cases where no agglutination occurred after the culture had been well stirred into the serum, the slide is tilted back and forth. Distinct clumping of cells observed within a few seconds is recorded as a strong positive reaction. Late reactions without distinct clumping of cells is designated as weak. For control purposes, a loopful of the same culture is mixed in a drop of saline, to test for autoagglutination. Tube agglutinations is carried out in round-bottom agglutination tubes (1.2 cm by 7.5 cm). Antisera to living and heated cells is titrated respectively with nonheated and heated antigens. Slide tests is also perform with living cells in antisera raised against heated antigen. Equal volumes (0.5 ml) of antigen and serial doubling dilutions of antiserum is mixed, the serum dilutions ranging from 1:10 to 1:1280. Normal rabbit serum and PBSM is included as controls.

The tubes are incubated at 37°C for 18 hours before reading. The highest serum dilution resulting in agglutination of the antigen, leaving the liquid above clear, is recorded as the serum titre in case of cross-agglutination serum absorption is performed as indicated by Kauffmann (1972)

2.6.4 Molecular diagnostic methods for the detection, identification and differentiation of Riemerella anatipestifer

Molecular identification of Riemerella anatipestifer

A number of protocols have been developed for the specific detection of these pathogenic bacteria. For the detection of Riemerella anatipestifer, several assays have been reported, including polymerase chain reaction (PCR) for the ompA gene (Hu et al., 2002; Zheng et al.,2010), 16S rRNA (Qu et al., 2006; Subramaniam et al., 1997), the rpoB gene (Christensen and Bisgaard, 2010), and an ERIC (enterobacterial repetitive intergenic consensus) fragment (Kardos et al., 2007) and more recently multiplex PCR (m-PCR) assay (Hu et al., 2011). These are described as follows:

ERIC PCR:

Whereas the PCR developed by Kordos et al., (2007) have proved to be specific for R. anatipestifer and capable of correctly identifying it from pure culture. Furthermore, it seems to be capable of demonstrating it directly from clinical samples. Importantly, the assay differentiates between R. anatipestifer and P. multocida, which can be difficult and time consuming with traditional methods. Precise and rapid identification is especially important in case of the targeted R. anatipestifer, as mistaking it for P. multocida leads to false alarm of fowl cholera, while confounding it with nonpathogenic Pasteurellae results in delayed diagnosis of anatipestifer syndrome. In both cases, the excess expenses and/or losses caused by false or delayed diagnosis can be considerable. The primers used ERIC1R (5´-ATGTAAGCTCCTGGGGATTCAC-3´) and

ERIC2 (5´-AAGTAAGTGACTGGGGTGAGCG-3´).

Multiplex Polymerase Chain Reaction (m-PCR) assay:

The m-PCR method showed specific amplification of respective genes from R. anatipestifer, E.coli, and S.enterica using the m-PCR system, bacterial strains isolated from diseased ducks and the pathogens could also be detected in clinical samples from diseased ducks. Therefore, the m-PCR system could distinguish the three pathogens simultaneously, for identification, routine molecular diagnosis and epidemiology, in a single reaction (Hu et al., 2011).

Species-specific m-PCR assay has been reported to be one of the valuable and rapid tools for the identification and differentiation of pathogens (Kong et al., 2002; Suo et al., 2010). Moreover, the m-PCR is suitable for the examination of large numbers of samples leading to simultaneous detection of these three pathogens. The detection could be completed within 4h, which is significantly shorter than bacterial isolation and identification (which takes at least 24-48h) (Hu et al., 2011).

RA and RC are to date the only members of the genus Riemerella (Vancanneyt et al., 1999). While RA is an economically important pathogen of different avian species, such as water fowl and turkeys(Sandhu,2003), RC has been isolated mainly from pigeons and little is known about its pathogenic role (Vancanneyt et al.,1999). Due to their relatively low biochemical activity the differentiation between the two species, as well as from other related bacteria is difficult in this way (Christensen and Bisgaard, 2010; Hinz et al., 1998; Vancanneyt et al.,1999; Vandamme et al.,2006). Thus molecular based diagnostic to enabled differentiation was developed.

MALDI-TOF MS analysis:

Rubbenstroth et al., (2011) have demonstrated that bacterial fingerprinting using matrix assisted laser desorption/ionisation-time of flight mass spectrometry(MALDI-TOF MS) analysis is useful for the identification and differentiation of RC and RA. Since an unequivocal differentiation between aesculin-negative RC-strains and RA solely by biochemical properties was not possible. MALDI-TOF MS analysis was demonstrated to be a valuable tool for the identification of Riemerella spp.

In their study, MALDI-TOF MS fingerprinting yielded high similarities between the 26 RC- strains tested, which formed a tight cluster regardless of their aesculin hydrolysis or pigmentation phenotype. The Bruker MALDI Biotyper software clearly discriminated RC from RA and other Flavobacteriaceae species, including poultry pathogens such as Ornithobacterium rhinotracheale or C. anatina, by their protein mass profiles. Once the necessary equipment is available, MALDI-TOF MS finger printing is quick, easy and cost-effective to perform. As for Flavobacteriaceae no extraction is required, a rapid smear protocol can be used. This would allow identification of isolates within few minutes, given that a substantial number of reference strains of the respective species are included in the database. Thus, the method may provide a valuable tool also for veterinary microbiological diagnosis in the future.

Loop-mediated Isothermal Amplification (LAMP) assay:

A novel loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for the detection of Riemerella anatipestifer (RA) infection. The LAMP assay exhibited a higher sensitivity than conventional polymerase chain reaction (PCR) and microbial isolation. The specificity of the assay was determined by restriction enzyme digestion of the LAMP products and detection of Escherichia coli, Salmonella enterica and Pasteurella multocida. The LAMP assay was able to detect RA effectively in samples of the reference strains, isolated strains and infected duck brains. LAMP assay was shown to be effective, specific and rapid in the detection of RA infection from field, laboratory and clinical samples. The assay could be carried out in a local laboratory without any special equipment and shows the advantages of simplicity, rapidity, sensitivity and specificity .The system is suitable for the diagnosis of RA infection in the field or in laboratories in epidemic areas. Thus is a useful tool for the diagnosis of RA infection (Zheng et al. 2011).

16SrRNA Polymerase Chain Reaction (PCR) Typing

Li et al. (2010) have employed 16SrRNA PCR amplification assay in the identification of RA in clinical sample from a flock of chicken infected with RA. The 16SrRNA gene fragment was amplified using primer pairs 16S-L (AGAGTTTGATCCTGGCTCAG) and 16S-R (ACGGCTACCTTGTTACGACTT). The amplification conditions were: 150ng genomic DNA, 5μl 10Ã-Taq buffer, 2μl dNTP mix (2mM each), 1μl of each primer (10pmol/ml) and 0.2μl Taq DNA polymerase (1U) in a volume of 50μl. The reaction parameters: a denaturation step (60s at 95°C) was followed by 35 cycles of denaturation (40s at 95°C), annealing (60s at 53°C) and elongation (100s at 72°C). An elongation step (300s at 72°C) terminated the PCR. The DNA was purified and sequencing was done (TaKaRa Biotech., Dalian, China). (Stackebrandt et al., 1994; Subramaniam et al., 1997). This has demonstrated the importance of 16SrRNA in the identification of RA in clinical samples. PCR amplification of 16S rDNA has been showed to be rapid and specific in the identification of Riemerella anatipestifer (Qu et al., 2006).

The rpoB Gene Sequencing :

Partial sequencing of rpoB has turned out to allow fast and reliable identification at the species level (Korczak et al. 2004; Bisgaard et al. 2009). Adekambi et al. (2008) proposed rpoB sequence comparison as an alternative to DNA-DNA hybridization to classify bacterial species. On the Identification and classification of Riemerella spp .

Christensen and Bisgaard (2010) argued that: The future investigation might be based on rpoB as a target for PCR in a specific test for identification of Riemerella anatipestifer. PCR amplification of a partial region of the rpoB or the 16S rRNA gene with subsequent sequencing is the fastest way to confirm identification of Riemerella anatipestifer. Since Riemerella anatipestifer are often misidentified, they warned that new serovars should not be accepted unless they have been properly characterized by relevant genetic methods such as gene sequencing. Based on their findings they disputed that previously published PCR tests are not specific for this species; because in their study, they showed that; previous PCR tests also detect other bacteria which may lead to a high rate of false positive reactions. Four isolates from lesions in chickens made up a separate rpoB cluster tentatively named Riemerella-like taxon. Subsequent sequencing of 16S rRNA demonstrated that this taxon constitutes a candidate for a new species of Riemerella. Riemerella like taxon 2 was found associated with chickens and demonstrated 96.4 and 95.4% 16S rRNA similarity with Riemerella anatipestifer and Riemerella columbina, respectively. Currently, rpoB sequence comparison can be used to identify Riemerella-like taxon 1 and 2.

2.6.4 Virulence Factors in Riemerella anatipestifer

Outer Membrane proteins (OMP)

Previous investigation showed that R. anatipestifer OmpA is an immunogenic protein (Subramaniametal.,2000). In this study, for the first time, they've demonstrated that R.anatipestifer OmpA is an important virulence factor and involved in the pathogenesis of R. Anatipestifer infection .The results also suggest that the Biological functions of OmpA protein, to some extent, are Conserved among R. anatipestifer, E. coli and Pasteurella multocida ,etc. ,despite their low homogeneity. The results showed that the adhesion n of Th4D ompA mutant to Vero cells was 75% decreased, but not completely lost, suggesting other adhesins are involved in the adherence of R.anatipestifer to Vero cells in addition to OmpA protein. Analysis of the nucleotide sequence of the ompA gene of R. anatipestifer revealed that it encodes a protein of 387 amino acids which contains six EF-hand calcium-binding domains and two PEST regions, suggests OmpA play a possible role in virulence ( Subramaniam et al., 2000). However, to date, no report has documented the biological functions of R. anatipestifer OmpA, except for immunogenicity. The results demonstrated that OmpA is a virulence factor of R. anatipestifer , and that it may act as an adhesin.

Virulence-associated Proteins D (VapD)

To determine whether the R. anatipestifer genome also harbored a vapD gene, Southern blot analysis of EcoRV-digested genomic DNA hybridized with a vapD probe at low stringency is employed. A positive signal was only found from R. anatipestifer containing either pCFC1 or pCFC. This indicated that the vapD gene probably is not part of the R. anatipestifer genome. However, previous studies found that 72% of the isolates contain either pCFC1 or pCFC2 (Chang et al., 1998). Due to the similarity with the D. nodosus virulence-associated proteins, VapD1 from R. anatipestifer may be virulence-associated. Further study on the role of VapD1 in the pathogenesis of disease is needed.

Riemerella anatipestifer is the causative agent of polyserositis of ducks and geese. It was previously reported that a 3.9-kb plasmid, pCFC1, carries protein genes (vapD1 and vapD2) that are similar to virulence-associated genes of other bacteria. In a study by Weng et al. (1999), they have reported that; the complete sequence of a second plasmid of 5.6 kb, pCFC2. pCFC2 has a 28% G-C content and three large open reading frames (ORFs). One of the ORFs (designated asVapD1) encodes a polypeptide that shares 53.9, 53.9, 48.3, 48.3 and 46.1% identity with virulence-associated proteins of Dichelobacter nodosus, Actinobacillus actinomycetemcomitans, Neisseria gonorrhoeae, Helicobacter pylori and Haemophilus influenzae, respectively. These are all very pathogenic and their pathogenicity has been documented. The role of VapD in their virulence needs not to be overemphasized.

CAMP Cohemolysin Virulence Factors

Riemerella anatipestifer (RA) causes epizootics of infectious disease in poultry and results in serious economic losses, especially for the duck industry (Hu et al., 2010). Variations of virulence as assessed by mortality and morbidity rates have been reported for the different serotypes and within a given serotype. However, cohemolysin has been shown to be expressed by RA thus contributing to its virulence. Serotypes 1, 2, 3, 5, and 15 have been reported as the most prevalent in severe outbreaks of septicaemia anserum exsudativa (Pathanasophon et 1994, Teo et al., 1992 ). The presence of the cohemolysin could contribute to virulence, as it is produced by most of the prevalent serotypes, which may be better adapted at producing the cohemolysin during a natural infection under certain intracellular conditions and therefore able to damage the host and aid in the infection process, thus providing a function essential to pathogenesis. One possible consequence of hemolytic activity in vivo is the release of iron for use by the organism, as pathogenic bacteria require iron in the infection process (Hacker et al., 2000). The Cam protein of R. anatipestifer was found to possess properties similar to those of the sialoglycoprotease from P. haemolytica, which was considered a virulence factor (Lee et al., 1994).

In another view, the CAMP effect describes the synergistic lysis of erythrocytes in the presence of diffusible substances, one of which is the CAMP cohemolysin, produced by microorganisms growing adjacent to each other on the surface of blood agar (Christie et al., 1994). Since the cohemolysin causes lysis of red blood cells, it is considered a potential virulence factor.

Prevention and Control of Duck Septicemia Anserum Exudativa in Poultry

2.7.1 Vaccination against Duck septicemia in Malaysia

In most Asian countries there is routine vaccination for poultry diseases. However, depending on local conditions, programmes and procedures may differ from one country to another, or even from one farm to another within the same country. While some of the vaccines used are manufactured within the countries of the region, a large number are imported. India is the only Asian country that is self-sufficient in vaccine production. The classical live attenuated and the killed vaccine and the new generation of recombinant vaccine have been used to prevent disease and improve poultry health and productivity (Aini, 1990). As at currently there is no known vaccine for use against duck septicaemia in Malaysia. Perhaps the only vaccine used against seeming duck septicaemia infection is the fowl cholera vaccine against pasteurellosis. It is either duck septicaemia is misdiagnosed for pasteurellosis or there is probably completed absence of the disease in ducks in Malaysia.

2.8.2 Biosecurity for the control of RA on Duck farms

The insufficient biosecurity and inadequate husbandry of the goose farms increase the exposure of geese to R. anatipestifer. In addition, R. anatipestifer infection often causes subclinical disease in old waterfowls (Sandhu, 2003). Furthermore, improper antibiotic use may increase development of multidrug-resistant isolates. Although, biofilm formation by RA has been reported to contribute to the persistent infections on duck farms (Hu et al., 2010). EDTA has been found to prevent the formation of biofilm by S. epidermidis (Juda et al.,2008) as such addition of EDTA to packing materials or formites on duck farms may reduce the incidence of RA infections by interfering with biofilm formation and/or destroying the existing biofilm (Hu et al., 2010). Adequate disinfection of materials or formites is necessary.

2.8.3 Chemotherapy

Pathanasophon et al (1994) showed that RA Thai isolates were highly susceptible to ampicillin, erythromycin, penicillin G and tylosin, moderately susceptible to cephalexin, chloramphenical, nalidixic acid, oleandomycin, oxytetracycline and spiramycin, weakly susceptible to dihydrostreptomycin, and resistant to colistin, gentamicin, kanamycin and sulfadimethoxin. Similarly in another study, clinical cure of R. anatipestifer septicaemia was reported with an optimum dosage of 50 ppm enrofloxacin (Baytril 10%), followed by 25 ppm for a five days regimen (Turbahn et al., 1997).

However, Priya et al (2008) have isolated RA from an outbreak of New Duck Disease in India; the isolates showed resistance to penicillin-G,oxytetracycline and co-trimoxazole but were sensitive to enrofloxacin, gentamicin, chloramphenicol, amoxicillin and doxycycline. Furthermore, they showed that; the severely infected ducks in the outbreak were treated with enrofloxacin at 5mg / kg body weight intramuscularly for 5 days and rest of the birds were given oral suspension of enrofloxacin for 5 days as recommended by Turbahn et al. (1997). Chemotheapy is however a very expensive approach to the control of duck septicemia infection.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.