Dna Sequence Analysis Primer Design Protein Expression Biology Essay

Published:

From the protein BLAST results the organism that exhibited the likely characteristics is Calviceps purpurea. This organism was picked based upon the factors like Max score, total score, query coverage and E value. The Maximum score which is produced by the highest alignment score of the set of alignment sequences is found to be 123. The query coverage, which is the percentage of query length that is found in all the alignments, is found to be 98% and had an E value (Expect value), is found to be 9e-27.

Galactose oxidase (GO) is one among the group of copper containing enzymes. This is an extracellular enzyme secreted by Fusarium species1. Galactose oxidase contains a polypeptide chain of 639 amino acids and has a molecular weight of 68,000 Daltons2. By the reduction of oxygen to hydrogen peroxide, galactose oxidase catalyses the oxidation of D-isomers of primary alcohols into their corresponding aldehyde3. One of the interesting characteristics of galactose oxidase is its ability to catalyze a two electron redox reaction, as it has only one Cu (II) atom and no other dissociable groups4. This enzyme is a monomer and consists of three domains. The Cu II atom is located on the surface of domain 2.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

It was found that the galactose oxidases enzymatic activity is found to be high in the presence of horse radish peroxidise and other oxidases like potassium ferricyanide. The galactose oxidase exists in three different oxidation states5. One is Cu (II) and tyrosine radical, the other is Cu (II) and tyrosine and Cu (I) and tyrosine. Among these three oxidation states Cu (II) and tyrosine radical is of highest oxidation state and is highly catalytically active. From the crystallographic studies it was found that a thio ether bond is situated in between the Sγ of Cys228 and Cϵ1 of Tyr 272. From the spectrographic studies it was found that at 445nm there is an increase in the intense peak as result of overlapping ligand to metal charge in between tyrosine and copper and π- π* transitions in the tyrosine radical2.

Task 4: To predict the structural and functional changes of Galactose oxidase after mutation at residue 228.

From literature it was understood that Cys228 plays a key role in the crystal structure of the protein and also in the aromatic stacking with Trp290 is due to the complanarity of the side chains of Cys228 and Tyr 272. Cys228 forms a thio ether bond with Tyr 272 along with Trp290 is the major reason for the crystal structure of the protein. Tyr272 in the galactose oxidase contains a free radical which is helpful for performing a free radical mechanism for catalysis.

In order to understand in much detail about the protein mutation at the 228 residue can be useful.

If the mutation at the Cys228 is performed successfully the thio ether bond between the Cys228 and Tyr272 might be lost and results in the loss of crystal structure of the protein. Loss of thio ether bond may also show a difference in mobility of the protein. The protein may loss its stability as it will be no longer able to bind copper. These copper binding characteristics may be lost as the ability of Tyr272 to act as copper ligand is influenced by Cys228.

Task 5: To design primers for quick change mutagenesis.

The given DNA sequence is subjected to BLASTX and the identical protein and its sequence is identified. Figure 3 shows the location of cysteine residue at 228th position (obtained from BLASTX results). Now this Cysteine residue has to be replaced by using Alanine (C228A). In order to perform the quick change mutagenesis primers have to constructed based.

Figure 3: BLASX results showing cysteine at 228th position.

From the amino acid codon table the DNA codons for Cysteine and Alanine are obtained.

The DNA codon for cysteine is TGT, TGC. Whereas for Alanine its GCT, GCC, GCA, GCG.

By using expasy software, the given DNA sequence is subjected to translation. As the cysteine is situated at the 228 position frame 3 is considered. The 5'-3' and 3'-5' results are presented below.

The primers are picked by using the primer BLAST tool. The main important rules that have to be followed while picking a primer are, 10-15bases on either side of the desired mutation has to be considered, the primer should have an GC content of minimum 40% and should have an melting temperature (Tm) always less than or equal to 78oC, and the primer sequence should always terminate in one or more C or G residues. Keeping these in mind the following primers are picked by checking the conditions using the software http://depts.washington.edu/bakerpg/primertemp/primertemp.html.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

Forward Primer: 5'ACCGTCCCTCACAAGGCCGT3'

Reverse Primer: 5'TTTGGATCCCCGTTGGCGCC3'

The running the given forward primer in the above website the melting temperature is found to be 74.4oC and has a GC content of 65.0%. The conditions obtained were found to be same for the reverse primer. It has a melting temperature of be 74.4oC and a GC content of 65.0%. Site directed mutagenesis is performed by using Quick-Change® site directed mutagenesis kit protocol marketed by Stratagene, but using 1µl KOD hot start polymerase (1U/µl). The primers used for these are

Forward Primer: 5'ACCGTCCCTCACAAGGCCGT3'

Reverse Primer: 5'TTTGGATCCCCGTTGGCGCC3'

The samples are then incubated in PCR at 94oC for 30sec, 24 cycles at 94oC for 30sec, 55oC for 1 min, and 68oC for 4min 20sec.

Task 6: cloning of coding sequence of mature protein into expression vector pET28c GFP.

The given protein sequence is first subjected to digestion using Nde I at the 285 amino acid, as the sequence of the desired mutation is at 228th position. The pET28c GFP is used as an expression vector and was digested in between the sites Nde I at 5130 amino acid and Hind III at 5885. These sites are digested using the Nde I and Hind III enzymes. Now the protein sequence is set for ligation with the pET vector. After ligation these cells are then transferred into expression host (mostly E.Coli) and left for incubation. The positive clones are identified by using colony PCR.

By using quick change site directed mutagenesis method mutations are created in the DNA sequence cloned into the pET 28C vector and are transferred into XL-1 Blue competent cells provided with the kit. These cells are left for incubation and the positive clones are identified and cultured. The DNA concentration is further checked by using agarose gel electrophoresis.

The desire protein is isolated from the plasmid and the protein expression in the cells is induced by auto induction. The change in the desired mutations is known by using techniques like SDS PAGE and western blotting.

Usage of pET28c that already contains an insert being used as the cloning vector:

The recombinant plasmid pET28c GFP is used as a cloning vector as the T7 promoter helps to drive the transcription of the adjacent gene in the presence of T7 RNA polymerase.

Flowchart presentation of cloning process:

Digestion of protein sequence at 285th a.a using Nde I and digestion of pET28c GFP using Nde I and Hind III enzymes.

Design primers from the given sequence

Clone insert into pET28c GFP

Perform site directed mutagenesis using Quick change mutagenesis method

Transformation into competent cells

Identification of positive cultures

Identification of mutations by extracting plasmid DNA

Transformation into expression host

Introduce expression by auto induction method

Purification and analysis

RERERENCES:

Andrew J. Baron, Conrad Stevens, Carrie Wilmot, Kaqjula D. Seneviratnes, Veronica Blakeley, David M. Dooleyfl, Simon E. V. Phillipsll, Peter F. Knowles, and Michael J. McPherson, Vol. 269, No. 40, Issue of October 7, pp. 25095-25105, 1994.

Michael J. McPhersonS, Zumrut B. Ogels, Conrad StevensT, Kapil D. S. YadavII, Jeffrey N. Keen,and PeterF . Knowles; Vol. 267, No. 12, Issue of April 25, pp. 8146-8152, 1992.

Franck Escalettes and Nicholas J. Turner; DOI: 10.1002/cbic.200700689

Fahmi Himo, Leif A. Eriksson, Feliu Maseras, and Per E. M. Siegbahn; J. Am. Chem. Soc. 2000, 122, 8031-8036

NOBUTOSHI ITO, PETER F. KNOWLES, and SIMON E. V. PHILLIPS [18]