Differentiation Therapy in Chordoma

Published:

Differentiation Therapy in Chordoma: Presence of cancer stem cells?
Introduction

Chordoma first was described by Virchow in 1856 as a small tumor of clivus. Microscopically he observed these tumor cells containing buble-like vacuoles which were called physaliphorus structures [1]. Chordomas are neoplasms, which are rare primary tumors of bone originating from the remnants of notochordial primitive mesenchymal cells, during embryogenesis. They are traditionally considered as slow growing and locally invasive neoplasms with low tendency to metastasize and have high potential of recurrence rate after surgery. The obscurity of chordoma lays beneath its aggressive behavior especially occurrence in younger ages [3] with frequencies diagnosed in the axial skeleton are 32% cranial, 32.8% spinal, and 29.2% sacral [4]. Incidences of chordomas range between 1% to 4% among all bone tumors and annually 0.08 case per 100,000 population are diagnosed with more common occurrence in men (1.0) than women (0.6), and patients younger than age 40 [5]. Based upon data submitted by Almefty et al., patients treated between 1990-2006, out of 67 patients ages between 0 -17 were 16%, 18-40 were 34%, >40 were 49% [6].

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Evidences indicate that tumors consist of different subset of cells, one specifically shares similar properties with stem cells such as self-renewal, asymmetric division, and multilineage differentiation. These so-called subset of cells are known as cancer stem cells. Cancer stem cells originally are thought as being responsible for tumor initiation as well as progression and metastasis. Thus understanding of molecular pathways which control the maintenance and differentiation ability of stem cells and CSCs may contribute new approaches to beat this deathly disease. The mechanism that controls the formation of chordoma tumor is not known clearly, however, some hypotheses including cancer stem cell (CSC) role has been introduced by Omer et al.

Existing chordoma treatments are not only limited but also not effective; surgery is being the most common one. However, depending on the location of the tumor mass surgery is usually not a detrimental solution either, therefore a new perspective as well as novel treatment methods are needed. Differentiation therapy is one of the promising cellular treatment methods that is involved in maturation of cancer cells causing an arrest in the G0 phase of cell cycle. Owing to these promising features of differentiation therapy cancer stem cells are expected to stop proliferating and complete their maturation. Because of its mesenchymal origin chordomas may differentiate into other mesenchymal lineages when induced with differentiation factors such as retinoic acid or chondrogenic/osteogenic factors. We aim to seek the presence of cancer stem cells in chordomas and further investigate the differentiation potential of this tumor by targeting the cancer stem cells.

MATERIALS AND METHODS:

CELL CULTURE

One chordoma cell line; UCH1, generated by Silke Bruederlein at University of Ulm, Germany, was kindly obtained from Chordoma Foundation (?). and 2 primary chordoma cell culture ,which are generated from the specimens obtained from Neurosurgery Department in Yeditepe Hospital, Turkey,. For the cell culture we followed the protocol described previously by Bruederlein. Chordoma cells were grown on gelatinized tissue culture flasks and cultured with IMDM (Iscove’s Medium Dulbecco’s Medium) containing 25 % RPMI (Invitrogen, USA), 10 % fetal bovine serum and 1 % penicillin/streptomycin and incubated at 37 °C in 5% CO2 incubator. The media were changed twice per week until the confluency has reached 70-80 %.

OSTEOGENIC AND RETINOIC ACID DIFFERENTIATION

Once cells have reached confluency, they were tyrpsinized and seeded into gelatinized T-25 flasks and were treated with STEMPRO Osteogenesis Differentiation Kit (Invitrogen, USA) .and 10µM retinoic acid separately as decribed by the manufacturer’s protocol.

ALP ASSAY

Alkaline phosphatase activity was performed on days 0, 7, and 14. For each time point the media were removed, and the cell layers were washed with PBS three times. The cells were tyrpsinized, resuspended, and the pellet were lyased in 500 µl lysis buffer containing 0.2 % Triton X-100 (Sigma, USA). Lysates were vortexed vigorously up to half an hour. Protein lysates (25 µl per sample) were mixed with 75 µl ALP detection solution (Randox Laborotories, Ltd, UK) . Absorbance was measured for every five minutes up to 45 minutes at 405 nm on a microplate reader.

RNA ISOLATION AND CDNA SYNTHESIS

The second group of cells grown in T-25 tissue cultures flaks treated with STEMPRO Osteogenesis Differentiation Kit (Invitrogen, USA) and retinoic acid, were tyrpsinized and total RNA was isolated by using Trizol reagent (Invitrogen, USA) on the day of seven. cDNAs for each cell group were synthesized with Omniscript (Qiagen, USA) method, by using 1 microgram RNA.

SCRATCH ASSAY

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

UCH-1 cells treated with STEMPRO Osteogenesis Differentiation Kit (Invitrogen, USA) and retinoic acid were seeded into three 35 mm petri dishes (25,000 per dish). Cell monolayer was scraped in a straight line to see the effect of osteogenic/RA differentiation treatment on the migration rate of chordoma cells. The observations had been done periodically with an inverted microscope (Leica, GA) and images were saved.

PROLIFERATION ASSAY

Approximately 15,000 UCH-1 cells treated with STEMPRO Osteogenesis Differentiation Kit (Invitrogen, USA) and retinoic acid were placed in a 12-well microplate. Proliferation assay was performed on days of 4 and 14 and quantification of viable cells were measured by using One Solution Reagent (Promega, ?) on a Elisa microplate reader (ELx800, BIOTEK, USA) as described by the manufacturer’s protocol.

OLIGONUCLEOTIDE PRIMERS FOR GENE AMPLIFICATION

Total RNAs from nine tumor tissues and three cell lines were used to synthesize cDNAs as previously described. The following gene primers were used for reverse transcriptase polymerase chain reaction: brachyury (194bp) F: 5’ TGAGACCCAGTTCATAGCGG 3’, R: 5’ TGCTGGTTCCAGGAAGAAGC 3’, c-myc (176 bp) 5' CCTTGCAGCTGCTTAGACGC 3', R: 5' TCTGCTGCTGCTGCTGGTAG 3', klf4 (292 bp) F: 5’- ATTAATGAGGCAGCCACCTG -3’, R: 5’- GGTCTCTCTCCGAGGTAGGG -3’, oct4 (206 bp) F: 5’ CTTGAATCCCGAATGGAAAGGG 3’, R: 5’ CCTTCCCAAATAGAACCCCCA 3’, sox2 (211 bp) F: 5’- TCCTGATTCCAGTTTGCCTC -3’, R: 5’- TCCATCATGTTGTACATGCG -3’, nanog (346bp) F: 5’ CCTCCAGCAGATGCAAGAAC 3’, R: 5’ CCAGGTCTGAGTGTTCCAGG 3’, nestin, CD90 (191 bp) F: 5’ CCAGATCCAGGACTGAGATC 3’, R: 5’ TCAGGCTGAACTCGTACTGGA 3’, CD24, smad2 (272 bp) F: 5' CCCAGCAGGAATTGAGCCAC 3', R: 5' GTGAGGGCTGTGATGCATGG 3'. cDNAs synthesized from total RNAs of cell lines treated with STEMPRO Osteogenesis Differentiation Kit (Invitrogen, USA) and retinoic acid were used as a template in a conventional polymerase chain reaction with genes mentioned above and osteogenic markers; osterix (? bp) F: 5’ TAATGGGCTCCTTTCACCTG 3’, R: 5’ CACTGGGCAGACAGTCAGAA 3’ , osteopontin (?bp) F: 5’ TCACAGCCATGAAGATATGCTGG 3’, R: 5’ TACAGGGAGTTTCCATGAAGCCAC 3’, silaoprotein (?bp) F: 5’ TCAGCATTTTGGGAATGGCC 3’, R: 5’GAGGTTGTTGTCTTCGAGGT 3’, cbfa1 (?bp), F: 5’ GATGACACTGCCACCTCTGA 3’, R: 5’ GACTGGCGGGGTGTAAGTAA 3’ , and osteocalcitonin (?bp) F: 5’ ATGAGAGCCCTCACACTCCTC 3’, R: 5’ CGTAGAAGCGCCGATAGGC 3’. Touch-down amplification was performed (5 minutes at 95°C; followed by 40 touchdown cycles of 95°C/30 seconds, 60-52°C/30 seconds, 72°C/30seconds, and finally 72°C for 15 minutes) and analysis was accomplished on a benchtop UV transilluminator (AVEGENE, Taiwan).

References:

14) Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma (Gentao Liu, 2006)

20) Tumour-initiating cells vs. cancer ‘stem’ cells and CD133: What’s in the name? (Jiri Neuzil, 2007)

Cıkarttıklarım

As Sundaresan (2008) et al. described evidently, “Grossly, chordomas are lobulated, gray, partially translucent, glistening, cystic, or solid masses that resemble cartilage tumors or occasionally a mucin-producing carcinoma. The consistency varies from firm and focally ossified or calcified tissue to extremely soft, myxoid, gelatinous, or even semifluid material… This tumor may show a wide range in its histologic appearance and pattern. In addition to the areas showing physaliphorous cells, an occasional tumor may show a typical spindle cell sarcoma arrangement or a round cell pattern, whereas others may show an epithelial arrangement” [2].
The precise identity of the CSCs is the most important issue to clarify the mechanism of tumor initiation as well as treat it. It has been shown that CSCs and stem cells also express same surface marker and transcription factors for self-renewing and differentiation. Although these markers vary depending on the tissue type it is much easier to be able to characterize

Recent evidences indicate that various types of cancer including leukemia, melanoma, breast, prostate, brain, gastric, colorectal, and hepatocellular carcinomas have a subpopulation of cells to be able to proliferate and form new tumors.

Studies aimed to determine the genes expressed specifically by cancer stem cells help the current therapies become more applicable and targeted. For instance, CD133 gene has been found to be expressed in glioblastoma tumors and thought as having a role in initiation (20). Liu et al demonstrated that CD133 positive cells isolated from human glioblastoma may be responsible in initiation of the tumor and show resistant to chemotherapy (14).

Up to date there are limited approaches to cure chordoma;
In addition to surgery new approaches are required to be able to by the researchers.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

For the first time in AML patients, differentiation therapy was performed via using all-trans retinoic acid combined with chemotherapy as a differentiation factor which causes tumor regression to be prolonged.

Brachyury is a T-box transcription factor significantly involved in mesoderm formation in early stages of embryonal development in chordates with no expression afterwards. It has been demonstrated that during mesoderm formation cells lose their epithelial properties and gain mesenchymal properties and brachyury gene plays a major role in this process. Therefore brachyury may help cells to differentiate into other mesenchymal originated lineages.

The origin of chordomas is thought to arise from the embryonal notochord. Therefore, cancer stem cells may play a role in initiation of this tumor.
We investigated for the first time to see the presence of cancer stem cells in chordoma tumors. and based on that to detect if chordoma cells are induced with retinoic acid or osteogenesis differentiation factor, then these cells due to their mesenchymal origin might leave the cell cycle and differentiate into a mesencyhmal lineage, and found that chordoma cells differentiated into osteocytes under the . Therefore differentiation therapy may be an additional method to conventional therapies as well as a promising one to treat chordomas.

Cancer cells which have these valuable abilities are called cancer stem cells.

Unfortunately contrary to somatic stem cells, cancer cells can escape from apoptosis and can proliferate without external induction.
Although these distinguishing features give stem cells a unique opportunity to generate normal tissues, sometimes cause cancer cells to become more aggressive.